ID: 978775539

View in Genome Browser
Species Human (GRCh38)
Location 4:112502856-112502878
Sequence CTAAGGGAACACTAGTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978775534_978775539 17 Left 978775534 4:112502816-112502838 CCAGTCCTTGGGGGGGGGAAAAT No data
Right 978775539 4:112502856-112502878 CTAAGGGAACACTAGTTCATAGG No data
978775535_978775539 12 Left 978775535 4:112502821-112502843 CCTTGGGGGGGGGAAAATGTTAT No data
Right 978775539 4:112502856-112502878 CTAAGGGAACACTAGTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978775539 Original CRISPR CTAAGGGAACACTAGTTCAT AGG Intergenic
No off target data available for this crispr