ID: 978776357

View in Genome Browser
Species Human (GRCh38)
Location 4:112510169-112510191
Sequence GAGAATAATAAGAAGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978776350_978776357 10 Left 978776350 4:112510136-112510158 CCCCAAACCAAGCGCTTTGGAAA No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data
978776345_978776357 30 Left 978776345 4:112510116-112510138 CCCAAGGGAGATGCACCATCCCC No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data
978776347_978776357 15 Left 978776347 4:112510131-112510153 CCATCCCCCAAACCAAGCGCTTT No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data
978776353_978776357 3 Left 978776353 4:112510143-112510165 CCAAGCGCTTTGGAAAAGAAACT No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data
978776346_978776357 29 Left 978776346 4:112510117-112510139 CCAAGGGAGATGCACCATCCCCC No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data
978776352_978776357 8 Left 978776352 4:112510138-112510160 CCAAACCAAGCGCTTTGGAAAAG No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data
978776351_978776357 9 Left 978776351 4:112510137-112510159 CCCAAACCAAGCGCTTTGGAAAA No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data
978776349_978776357 11 Left 978776349 4:112510135-112510157 CCCCCAAACCAAGCGCTTTGGAA No data
Right 978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978776357 Original CRISPR GAGAATAATAAGAAGCATGG GGG Intergenic
No off target data available for this crispr