ID: 978776509

View in Genome Browser
Species Human (GRCh38)
Location 4:112510989-112511011
Sequence TTGGGTCTAAACGCCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978776502_978776509 10 Left 978776502 4:112510956-112510978 CCCAGACTGGCGGGTGGGCAGCT No data
Right 978776509 4:112510989-112511011 TTGGGTCTAAACGCCCTTCCTGG No data
978776503_978776509 9 Left 978776503 4:112510957-112510979 CCAGACTGGCGGGTGGGCAGCTG No data
Right 978776509 4:112510989-112511011 TTGGGTCTAAACGCCCTTCCTGG No data
978776494_978776509 28 Left 978776494 4:112510938-112510960 CCCTTTAGCAGCCTGTGACCCAG No data
Right 978776509 4:112510989-112511011 TTGGGTCTAAACGCCCTTCCTGG No data
978776495_978776509 27 Left 978776495 4:112510939-112510961 CCTTTAGCAGCCTGTGACCCAGA No data
Right 978776509 4:112510989-112511011 TTGGGTCTAAACGCCCTTCCTGG No data
978776499_978776509 17 Left 978776499 4:112510949-112510971 CCTGTGACCCAGACTGGCGGGTG No data
Right 978776509 4:112510989-112511011 TTGGGTCTAAACGCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978776509 Original CRISPR TTGGGTCTAAACGCCCTTCC TGG Intergenic
No off target data available for this crispr