ID: 978783668

View in Genome Browser
Species Human (GRCh38)
Location 4:112584047-112584069
Sequence ATATCACTTAAAACCATGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978783666_978783668 27 Left 978783666 4:112583997-112584019 CCTCATAAAGTGGTATCTTTTGA 0: 1
1: 0
2: 0
3: 21
4: 165
Right 978783668 4:112584047-112584069 ATATCACTTAAAACCATGCCAGG 0: 1
1: 0
2: 1
3: 35
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978783668 Original CRISPR ATATCACTTAAAACCATGCC AGG Exonic
901408431 1:9066007-9066029 AGAACACTTAGGACCATGCCTGG + Intronic
901753030 1:11423447-11423469 ATAAGACCTAAAGCCATGCCAGG + Intergenic
902096683 1:13951384-13951406 AAAGCACTTAGACCCATGCCTGG + Intergenic
902202220 1:14842211-14842233 CCAGCACTTTAAACCATGCCTGG + Intronic
903390614 1:22961170-22961192 AAATCACTTTATGCCATGCCTGG - Intronic
904046783 1:27613915-27613937 ATATCACTTAAAACAGTGTCTGG - Intronic
905844650 1:41218702-41218724 AAAGCACTTAATACCATGCCTGG - Intronic
905853613 1:41292495-41292517 AAAGCACTTAGAACAATGCCTGG + Intergenic
905943131 1:41879918-41879940 AAAGCACTTAAGACCATGCTAGG - Intronic
905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG + Intronic
906523672 1:46481555-46481577 TTACCACTTAGCACCATGCCTGG - Intergenic
907008261 1:50937879-50937901 ATATGAATAAAAACCATGTCGGG + Intronic
907574777 1:55516444-55516466 ATAGCACTTAAAATTATACCTGG - Intergenic
907668263 1:56451902-56451924 AAAGCACTTAAAATAATGCCTGG - Intergenic
907878015 1:58513723-58513745 AATACACTTAAAACAATGCCTGG - Intronic
907931606 1:59006212-59006234 AAATCAATTAAAGCAATGCCTGG - Intergenic
908643815 1:66254967-66254989 ATCTCACTAAAAACCTTCCCTGG + Intronic
908826276 1:68135653-68135675 ATACCACTTAAAGCAATGGCTGG - Intronic
909155520 1:72069987-72070009 ACATCACTAAGAACCATGCCTGG - Intronic
909340052 1:74521371-74521393 AAGTCACTTAAAACAATACCTGG + Intronic
909372260 1:74897738-74897760 ATATCATAAAAAACCATGCGGGG - Intergenic
909649491 1:77958123-77958145 ATTTCACTTTACACTATGCCTGG + Intronic
911456577 1:98131664-98131686 ACATCACCTAACACAATGCCTGG + Intergenic
911604288 1:99885356-99885378 AAAACACTTAATACAATGCCTGG + Intronic
912558144 1:110530966-110530988 AAAACACTTAGAACAATGCCTGG + Intergenic
912945950 1:114084307-114084329 AAAGCACTTAGAACAATGCCTGG + Intergenic
913415357 1:118599486-118599508 ATATGACTTAAAATTAGGCCTGG + Intergenic
914227707 1:145735172-145735194 ATATCACTTAGCACAATGCCTGG - Intronic
915220792 1:154372892-154372914 AAATATGTTAAAACCATGCCTGG + Intergenic
915494421 1:156271439-156271461 GTATAACTTAAAAGCATTCCAGG + Intronic
915587286 1:156851038-156851060 AAAGCACATAAAACAATGCCTGG - Intronic
916843669 1:168626452-168626474 ATCTCACTTACTACCAGGCCAGG - Intergenic
917522306 1:175758304-175758326 ATATCTACTAAAACCATGACAGG + Intergenic
918433904 1:184491104-184491126 AAAACACTTAAAATAATGCCTGG + Intronic
918549613 1:185727125-185727147 ATTTCACTTAAAATAGTGCCTGG + Intergenic
918568484 1:185958619-185958641 AAAACACTTAGAACAATGCCTGG - Intronic
918666844 1:187161989-187162011 AAAGCACTTAAAACCATGCCTGG - Intergenic
919649821 1:200136357-200136379 ATTTCACTTAACATCATGCCTGG + Intronic
919702672 1:200647674-200647696 ATATATCTTAAAAGCAGGCCAGG + Intronic
919769818 1:201150408-201150430 ATAGCACTTAGAACAATACCTGG - Intronic
919852580 1:201683204-201683226 ATATCAGTTAAAACCACTGCAGG - Intronic
920671583 1:208007512-208007534 CTTTCACTGAAAACCTTGCCAGG - Intergenic
921534372 1:216327708-216327730 ATATCACTTAAATACTTGTCAGG - Intronic
922276582 1:224084582-224084604 AAAGTACTTAGAACCATGCCTGG - Intergenic
922581228 1:226699587-226699609 AAACCACTTAGAACAATGCCTGG + Intronic
923997615 1:239512961-239512983 ATATCTCTCAAATGCATGCCTGG - Intronic
924574041 1:245262958-245262980 AAAGCACTTAGAACCATACCTGG + Intronic
1063540818 10:6932061-6932083 AAAACACTCAAAACCATGCCTGG + Intergenic
1065256819 10:23878175-23878197 ATTTCAATAAAAACCATGTCTGG - Intronic
1065617895 10:27547393-27547415 CTAGGACTTAGAACCATGCCTGG - Intergenic
1065992763 10:31029282-31029304 AAAGTACTTAAAACCCTGCCTGG + Intronic
1068758413 10:60680937-60680959 AAATCACTTAGAACAGTGCCTGG + Intronic
1068920017 10:62473651-62473673 AAAGCTCTTAGAACCATGCCTGG + Intronic
1069627849 10:69879318-69879340 AAAGTACTTAAAACAATGCCTGG - Intronic
1071178750 10:82958361-82958383 AAAGCACTTAAAACCATGTGTGG + Intronic
1072907693 10:99469929-99469951 AAAGCACTTAAAACAGTGCCTGG - Intergenic
1073278825 10:102336479-102336501 AAATTGCTTAATACCATGCCTGG + Intronic
1073791080 10:106941139-106941161 AAAGCACTTGAAGCCATGCCTGG + Intronic
1074291905 10:112143929-112143951 ATATTACTGAAGACCTTGCCAGG + Intergenic
1074423658 10:113331603-113331625 AAAACACTTAGAACCATGCCTGG - Intergenic
1075563964 10:123490143-123490165 ATATTCCTTAAAACCCTGCGTGG + Intergenic
1077651542 11:3977591-3977613 AAAGCACTTAATACAATGCCTGG + Intronic
1078662942 11:13301759-13301781 AAAGCTCTTAGAACCATGCCTGG - Intronic
1079584202 11:22105469-22105491 AAAACACTTAAAACAGTGCCTGG + Intergenic
1080311738 11:30901923-30901945 ATATAACTTAGAACAATGCCTGG - Intronic
1080599871 11:33810756-33810778 CTGTCACTTAGAACCAGGCCTGG - Intergenic
1081417825 11:42836848-42836870 AAAGCATTTAGAACCATGCCTGG + Intergenic
1085027933 11:73249156-73249178 ATACCACGTAAAACCACACCTGG + Intergenic
1085786838 11:79459720-79459742 AAAGCACTTAAAACAATGCTGGG - Intergenic
1086988644 11:93278368-93278390 ATTTTACTTAAAATCTTGCCTGG + Intergenic
1087060032 11:93968229-93968251 AGCGTACTTAAAACCATGCCTGG + Intergenic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087767547 11:102172653-102172675 TCATAACTTAGAACCATGCCTGG - Intronic
1089000520 11:115048218-115048240 ATATAACCTAGAACAATGCCTGG + Intergenic
1089663199 11:119999081-119999103 ATTTCACTTAAATCCAGGCCAGG - Intergenic
1090979079 11:131701330-131701352 AAATCGCCTAGAACCATGCCTGG + Intronic
1091515229 12:1173314-1173336 CCAACACTTAAAAACATGCCAGG - Intronic
1092699199 12:11208579-11208601 AAATCACTTAGAACAGTGCCTGG - Intergenic
1093359405 12:18204174-18204196 ATAGAACTTAAAACCATTGCTGG + Intronic
1095508991 12:42928872-42928894 ACAGAACTTAGAACCATGCCTGG - Intergenic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1097700358 12:62813859-62813881 AAAACACTTAAATCAATGCCTGG + Intronic
1098225102 12:68313132-68313154 CCAGCACTTAAAACAATGCCTGG + Intronic
1098266870 12:68730507-68730529 GTATCACTTGAGACCAGGCCTGG - Intronic
1099101308 12:78444351-78444373 ATATCATTTGAAACCAGGCAGGG - Intergenic
1099739548 12:86615224-86615246 ATATCACTCAAAAAAATGACTGG + Intronic
1100216404 12:92454306-92454328 AAATCACTTAAGATAATGCCTGG - Intergenic
1100461689 12:94805877-94805899 CTAACACTTAGAACAATGCCTGG + Intergenic
1100601847 12:96118469-96118491 AAAGCACTTAAAACAATGCCTGG - Intergenic
1100797158 12:98194580-98194602 AGAGCACTTAGCACCATGCCTGG + Intergenic
1101116413 12:101536227-101536249 AGAGCACTTAAAACATTGCCTGG + Intergenic
1103572207 12:121852577-121852599 ATAGCACTTAGAACAGTGCCTGG - Intronic
1104241727 12:126996555-126996577 ATAAGACCTAAGACCATGCCAGG - Intergenic
1105523359 13:21151891-21151913 ATAGCATTTAGAACCATCCCTGG + Intergenic
1105613816 13:21994168-21994190 ATATCAGTTAAACTCAGGCCAGG - Intergenic
1105964948 13:25375229-25375251 CTAGCACCTAGAACCATGCCGGG - Intronic
1106141684 13:27017130-27017152 ATAAGACCTAAAGCCATGCCAGG - Intergenic
1106714118 13:32369897-32369919 AAAGCGCTTAACACCATGCCAGG + Intronic
1107632813 13:42359636-42359658 AAATCCCTTAGAACAATGCCTGG + Intergenic
1107640909 13:42442280-42442302 AAATCACTTAGCACCAAGCCTGG - Intergenic
1107919317 13:45187029-45187051 ATTTAACCTAAAACCATGACAGG - Intronic
1108343261 13:49518558-49518580 AAAGCACTTAGAACTATGCCTGG - Intronic
1108582805 13:51841077-51841099 AAGCCACTTAAAACCCTGCCTGG + Intergenic
1112071110 13:95851372-95851394 ATATAAATTAAAACCATGATTGG + Intronic
1112517825 13:100070676-100070698 ATATCCCTCAAAACAATCCCAGG - Intergenic
1112725133 13:102294895-102294917 ATAGCACTTAGAACAATGTCTGG + Intronic
1113200531 13:107864159-107864181 ATATCACTTTAACTTATGCCTGG - Intronic
1114168386 14:20245634-20245656 AGAGCACTTAGAACTATGCCTGG + Intergenic
1115247026 14:31306175-31306197 AGAAGATTTAAAACCATGCCAGG + Intronic
1115608465 14:35029645-35029667 ATGTCATTTAAAACTATGCCTGG + Intergenic
1116473266 14:45309929-45309951 AAAGCTCTTAAAACAATGCCTGG - Intergenic
1117770676 14:59130951-59130973 ATAACAGTTAAAACCATTTCTGG + Intergenic
1118874628 14:69773247-69773269 ATGGCACTTAAAACAGTGCCTGG - Intergenic
1119919429 14:78432637-78432659 ATATAACTTAAAACCAGGCAAGG - Intronic
1119952755 14:78762731-78762753 AGAACACTTAGAATCATGCCTGG + Intronic
1123830538 15:24131811-24131833 ACAGGACTTAAAAACATGCCAGG - Intergenic
1123860573 15:24462222-24462244 ACAGGACTTAAAAACATGCCAGG - Intergenic
1124068662 15:26370677-26370699 ATGACACTTAAAACCAGGACAGG - Intergenic
1124809219 15:32917533-32917555 AAAACACTTAGAACAATGCCTGG - Intronic
1126468282 15:48980499-48980521 ACAGCACTTAAAACAGTGCCTGG - Intergenic
1127345654 15:58095150-58095172 AAAGCACTTAAAATAATGCCTGG - Intronic
1127824954 15:62695013-62695035 AAAGCACATAAAACAATGCCTGG + Intronic
1128829433 15:70753643-70753665 CTAGCACTTAGAACAATGCCTGG + Intronic
1128899795 15:71410066-71410088 CTATCACTTCACACCAAGCCTGG - Intronic
1129592495 15:76930065-76930087 ACACCACTGAAAACCATGCAGGG + Intergenic
1129962687 15:79702315-79702337 ATACCACTTTAAAGCATGTCAGG + Intergenic
1130123071 15:81069012-81069034 CTAACCCTTAGAACCATGCCTGG - Intronic
1130718711 15:86364298-86364320 AAATCACTTAGCACAATGCCTGG - Intronic
1132166324 15:99595064-99595086 ATAGCAGTTAAAAGCATTCCTGG + Intronic
1135946515 16:26869741-26869763 CTAACACTTAAAACAATACCTGG + Intergenic
1136595528 16:31246645-31246667 TAATCACTTAGAACCATGTCTGG + Intergenic
1138472185 16:57246505-57246527 AAAACACATAAAACCAGGCCAGG + Intronic
1139333968 16:66217877-66217899 AAATCACTTAGAACATTGCCTGG + Intergenic
1142498395 17:318994-319016 AAAACTCTTAAAACCTTGCCTGG - Intronic
1142796348 17:2310554-2310576 AAATCCCAAAAAACCATGCCAGG - Intronic
1143209753 17:5176607-5176629 GTATCACCTACAGCCATGCCAGG - Intergenic
1143800462 17:9375631-9375653 ATATCACTTAAAACCATCTTTGG - Intronic
1145028779 17:19488870-19488892 ACAGCACTTACCACCATGCCTGG - Intergenic
1146701418 17:34963807-34963829 AAAGCACTTAGAACCATGCCTGG - Intronic
1149085676 17:52712871-52712893 AAAGAACTTAAAACAATGCCTGG - Intergenic
1149689182 17:58559707-58559729 ATAGCACTTAAACCAATGCCTGG - Intronic
1149928758 17:60728102-60728124 ATACCACCAAAAACCAGGCCGGG - Intronic
1150944343 17:69728649-69728671 ATATAACTTGAAACTATGCAAGG + Intergenic
1151312755 17:73304222-73304244 AAATCACCTAACACAATGCCTGG - Intronic
1153138287 18:1942482-1942504 ATTGCACTTAAAAGGATGCCTGG + Intergenic
1153194335 18:2577126-2577148 AAAGCACTTAAAACAATGTCTGG - Intronic
1155596911 18:27498660-27498682 AACTCACTTAATACCCTGCCTGG - Intergenic
1155851239 18:30777162-30777184 AAATAACTTAATACCATGCTTGG - Intergenic
1157929559 18:51806357-51806379 ATAGCATTTAAAACAAGGCCTGG - Intergenic
1158405936 18:57159258-57159280 CTAGCACCAAAAACCATGCCTGG + Intergenic
1159362784 18:67426982-67427004 ATATCTCATAAATTCATGCCTGG - Intergenic
1159482428 18:69007399-69007421 TTATCACTTAAAAATATGCAAGG - Intronic
1161519320 19:4714750-4714772 CCATCACTTAAAACCCTTCCTGG + Intronic
1162827403 19:13261835-13261857 GTATCACTTAAAAGCATCTCTGG - Intronic
1164505461 19:28857042-28857064 ATAGTACTTAACACCATGGCTGG + Intergenic
1164829659 19:31310814-31310836 AAAGCACTTAGCACCATGCCTGG + Intronic
1167109220 19:47449059-47449081 CCAACACTTAAAACAATGCCTGG - Intronic
1167637442 19:50662989-50663011 AAAGCACTTAGAACAATGCCTGG - Intronic
1168351248 19:55677326-55677348 AAAGCACTTAAAACAGTGCCTGG + Intronic
925336919 2:3105591-3105613 ATAACATCTAAAACCACGCCTGG + Intergenic
925819127 2:7782302-7782324 ATTTCTCTTGAAACCATTCCAGG - Intergenic
927507300 2:23622792-23622814 AAAGGACTTAGAACCATGCCTGG - Intronic
927528782 2:23774305-23774327 ACAGGACTTACAACCATGCCTGG - Intronic
928123956 2:28603454-28603476 AAAGCACTTGAAACAATGCCTGG - Intronic
930499376 2:52192839-52192861 ATCTCACTTAAAAGGGTGCCTGG - Intergenic
931408074 2:62000435-62000457 ATACCACGCACAACCATGCCTGG + Intronic
931691852 2:64840436-64840458 AAATCACTTAGCACAATGCCTGG + Intergenic
931909105 2:66875517-66875539 ATACCAAATAAAATCATGCCTGG + Intergenic
932455744 2:71848887-71848909 CTAACATTTAGAACCATGCCTGG - Intergenic
932920010 2:75902146-75902168 ATAATACTTAAAAACAGGCCAGG + Intergenic
933410806 2:81922357-81922379 ATATCACTGAGAACAATCCCTGG - Intergenic
934584977 2:95483911-95483933 ATAAAAATTAAAACCAAGCCAGG + Intergenic
935972094 2:108539739-108539761 AAACCATTTAACACCATGCCAGG + Intronic
937898665 2:126999024-126999046 ACATCCCTTAGAACCATTCCTGG - Intergenic
938553974 2:132407220-132407242 AAAACACTTAAAACAATGCTAGG - Intergenic
938921194 2:135996692-135996714 ATTACACTTAAAACAGTGCCTGG - Intergenic
939936904 2:148304185-148304207 AAAACACTTAAAACAGTGCCTGG - Intronic
940234051 2:151490614-151490636 AAAGTACTTAAAACCATGCTTGG - Intronic
940487201 2:154310886-154310908 AAATCACTTAAGACAATGTCTGG + Intronic
940539032 2:154986948-154986970 AAAGCACTTAGAACAATGCCTGG + Intergenic
940826559 2:158418799-158418821 ATATCTCTTAGAATAATGCCTGG + Intronic
941082333 2:161076802-161076824 AAGACACTTAAAACAATGCCAGG + Intergenic
941964372 2:171286281-171286303 ATATCACTTAAAATGATCACAGG + Intergenic
943330465 2:186552622-186552644 ATTTCTCTTAAACTCATGCCTGG + Intergenic
944040795 2:195351891-195351913 AGCTCACTTAAAACCATGGCAGG + Intergenic
945180862 2:207089786-207089808 ATATTAATTAGAACAATGCCTGG + Intronic
945709839 2:213282126-213282148 AAAGCACTTATAACCATGTCTGG - Intergenic
945729072 2:213510183-213510205 ATATCACTTCAAACCCTTCCTGG + Intronic
945901952 2:215548570-215548592 TGATCACTTAAACCCATGCTAGG + Intergenic
946514361 2:220395226-220395248 AAGACACTTAACACCATGCCTGG - Intergenic
947186693 2:227461737-227461759 AAAGCACTTAAAACAATGTCTGG - Intergenic
947417064 2:229907861-229907883 AAAACATTTAAAACAATGCCTGG - Intronic
1168802044 20:649903-649925 AAAGCACTTCAAACCATGCTTGG + Intronic
1169556004 20:6750694-6750716 ATACCACTTAAAACAGTGCCTGG - Intergenic
1170762134 20:19260373-19260395 AAAGTACTCAAAACCATGCCCGG + Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172840428 20:37899942-37899964 AAAGCACTTAGAACAATGCCAGG - Intergenic
1177276456 21:18918627-18918649 ATAAGACCTAAGACCATGCCAGG + Intergenic
1177936611 21:27355008-27355030 ATATCAGTTAAAAACATACATGG + Intergenic
1178774373 21:35535439-35535461 ATATTAATTAAATCCATGCGTGG - Intronic
1180246598 21:46552501-46552523 AAATAACTTAAAACCCTGCAAGG + Intronic
1181310958 22:21944516-21944538 ATATCACCTGAAGCCATGACAGG - Intronic
1181884005 22:26004614-26004636 ATATCACTTAGCACAATGCCTGG + Intronic
1185187205 22:49408212-49408234 CAATCACTGAAAACCATGACAGG + Intergenic
951403788 3:22268935-22268957 AATTCACTTAAATTCATGCCTGG + Intronic
951689028 3:25376026-25376048 AGAGCTCTTAAAACCATGCCTGG + Intronic
952676397 3:36036262-36036284 AAAACACTTAATGCCATGCCAGG + Intergenic
952916589 3:38250262-38250284 ATAACGCTTAAGACAATGCCTGG - Intronic
953313412 3:41902890-41902912 AAAGCACTTAAAACAATGCCTGG + Intronic
955461777 3:59190682-59190704 ACAGCACCTAAAACAATGCCAGG - Intergenic
956425373 3:69128869-69128891 ATATCACTAAATACTATGCTAGG - Intergenic
956951094 3:74283335-74283357 AAATTACTTAGAACCATGACCGG + Intronic
957479611 3:80774630-80774652 ATATGACTTATAATTATGCCTGG - Intergenic
960025961 3:113009785-113009807 AAAGCACTTAGAACAATGCCTGG + Intronic
960885699 3:122392008-122392030 ATATTGCCTAAAACAATGCCTGG + Intronic
962015113 3:131431431-131431453 ATATAACAGAAAACCATTCCAGG + Intergenic
962446608 3:135471465-135471487 ATATCTCCTAAAAGCAAGCCTGG + Intergenic
964065772 3:152577123-152577145 ATGCTACTTAAAACCATCCCTGG + Intergenic
964405544 3:156344651-156344673 GAATCACTCAAAACCATCCCAGG - Intronic
964668509 3:159200117-159200139 ATATCACTTTGAACAATGCCTGG + Intronic
964979113 3:162657151-162657173 AGATTTCATAAAACCATGCCTGG - Intergenic
965611077 3:170544502-170544524 AAATCAGTTAAAATCATGGCAGG - Intronic
965932007 3:174055757-174055779 AAAACACTTAAAACAATGCTTGG + Intronic
966005384 3:175005130-175005152 AAATTACTTAGAACAATGCCGGG - Intronic
966293460 3:178388086-178388108 AAATCACTGAAAACTATGCTGGG - Intergenic
967999517 3:195195246-195195268 AAAGCACTTAGAACAATGCCTGG + Intronic
970484242 4:16508214-16508236 ATATCACTTAGCAGCATGCCTGG - Intronic
970492352 4:16587263-16587285 AAAGCACTTAGAACAATGCCTGG - Intronic
971768696 4:30868212-30868234 AAAACACTTAGCACCATGCCTGG - Intronic
972233130 4:37098500-37098522 ATATCACTTTAACTCATGCCTGG + Intergenic
972429032 4:38962708-38962730 ATATAAATCAAAACCATGCTGGG - Intergenic
973090304 4:46127352-46127374 AGATCACTTGAAACAGTGCCTGG + Intergenic
974578342 4:63759956-63759978 AAATAACTTAGAACAATGCCTGG + Intergenic
975387561 4:73774961-73774983 AGAACACTTAGAACAATGCCTGG - Intergenic
976788906 4:88854928-88854950 AAATCTCTTGGAACCATGCCTGG - Intronic
977196478 4:94067210-94067232 AAAACACTTAAAACTAGGCCGGG - Intergenic
977596390 4:98886216-98886238 CTAGCACTTGAAACCGTGCCTGG - Intronic
977923368 4:102670347-102670369 AGAGCACTTAGAACAATGCCTGG + Intronic
978090118 4:104705596-104705618 ATAGCACTTAATACAGTGCCTGG - Intergenic
978267811 4:106847821-106847843 AAAGCACTTAAAACAGTGCCTGG + Intergenic
978783668 4:112584047-112584069 ATATCACTTAAAACCATGCCAGG + Exonic
979392723 4:120145443-120145465 AAAGCACTTAAAACAGTGCCGGG + Intergenic
979772369 4:124543596-124543618 GAATCACTTAAAACAATACCTGG - Intergenic
980307637 4:131083660-131083682 ATGTCATTTAAAACCATGAATGG + Intergenic
980941527 4:139279725-139279747 AAAGCACTTAAAAACGTGCCTGG - Intronic
981936099 4:150241553-150241575 CTAGCACTTAAAATCATGCCTGG - Intronic
983056692 4:163105346-163105368 TTACCACTTAACACAATGCCTGG + Intergenic
984229681 4:177079718-177079740 AAATCACTTAGAACAATGTCTGG + Intergenic
986018993 5:3783468-3783490 ATATCACTTTCAATCTTGCCTGG + Intergenic
987206938 5:15637616-15637638 AATGCAGTTAAAACCATGCCTGG - Intronic
987398258 5:17446364-17446386 ATGTCAACTAACACCATGCCTGG - Intergenic
989602894 5:43216206-43216228 ACTTCACAGAAAACCATGCCTGG - Intronic
990218514 5:53561178-53561200 AAACCACTTAAAACCATGGAAGG - Intronic
990624917 5:57599838-57599860 AAAGTGCTTAAAACCATGCCAGG + Intergenic
990747065 5:58969154-58969176 CTAGCACTTAAAACTATGCCTGG - Exonic
991255187 5:64605530-64605552 AATTCACTTCAAACCATCCCAGG + Intronic
992264974 5:75009437-75009459 CTACCACTTAGAACAATGCCTGG - Intergenic
993089048 5:83400965-83400987 AAAGCACTTAAAACAATGTCTGG - Intergenic
993921554 5:93811000-93811022 AAAGCACTTAAAACAACGCCTGG + Intronic
993956702 5:94243155-94243177 AAAACACTTAGAACAATGCCTGG + Intronic
994319263 5:98371988-98372010 AAATCAATTAAAACCATCCTGGG - Intergenic
994714190 5:103302069-103302091 GTATCACTAAAAATCATGGCAGG - Intergenic
994964995 5:106658080-106658102 ATAACAATTAAGCCCATGCCTGG + Intergenic
995238897 5:109863077-109863099 ATATCACTTGATAGCATGCATGG - Intronic
995311836 5:110722036-110722058 ATATCACATAAAACATTGTCAGG + Intronic
995323992 5:110871271-110871293 ATTGAACTCAAAACCATGCCCGG - Intergenic
996424946 5:123304462-123304484 ATAGGACTTAAGGCCATGCCAGG - Intergenic
997452620 5:133995868-133995890 CTTTCACTTAACACCCTGCCAGG + Intronic
998889782 5:146733988-146734010 AAAGCACTTAAAACAATTCCTGG - Intronic
1000162335 5:158610910-158610932 TCATTATTTAAAACCATGCCTGG - Intergenic
1001200115 5:169708316-169708338 AAAGCACTTAAAACAGTGCCTGG - Intronic
1002195463 5:177498592-177498614 TTATCTCTTGAAGCCATGCCAGG + Intergenic
1003818721 6:9871087-9871109 AAAGCACTTAAAACAATGCCTGG + Intronic
1004528604 6:16432513-16432535 ATATAATTTAAAAGCATGCAAGG + Intronic
1005224862 6:23630829-23630851 ATGTAACCTAAAACCATGGCTGG - Intergenic
1005389869 6:25322067-25322089 ATAGCACGTACCACCATGCCTGG + Intronic
1005423551 6:25677930-25677952 AAATCACTTAAAATCATTACTGG - Intronic
1005765601 6:29008369-29008391 AAATCACTTAACACATTGCCTGG + Intergenic
1007273119 6:40653357-40653379 ATGTCACTGATGACCATGCCAGG - Intergenic
1007403980 6:41622924-41622946 TTAACACTTAAAACAGTGCCTGG + Intergenic
1007912127 6:45526324-45526346 AAATTACATAAAACCATGCAAGG - Intronic
1008229907 6:48973395-48973417 ATATCACATAAAAACATGTTTGG - Intergenic
1008285248 6:49641403-49641425 ATATCAGTTAAAATCTTCCCAGG + Intergenic
1008750285 6:54724954-54724976 ATATCACTCATATCCAAGCCCGG - Intergenic
1009350616 6:62672535-62672557 ATATGAGTCAAAACCATGCTTGG + Intergenic
1010073821 6:71776737-71776759 ATATCAATTAAAACCAATGCAGG - Intergenic
1010415682 6:75608785-75608807 ATATTACTTAAAGCAATTCCAGG + Intronic
1011027961 6:82890178-82890200 ATTTCATTTTAAACCATGCTGGG - Intergenic
1011723492 6:90184172-90184194 ATATCATTTAAAAAAGTGCCAGG + Intronic
1013184439 6:107745656-107745678 ATAGCACTTACCACCATGCAGGG - Intronic
1014804534 6:125813805-125813827 ATAACACTTAACACTATGCAAGG - Intronic
1015337882 6:132062151-132062173 ATTCCACTTAAATTCATGCCCGG - Intergenic
1016842160 6:148535235-148535257 CTATCACCTAGAAACATGCCCGG - Intronic
1021006363 7:15399021-15399043 ATATTAGTTAAAATGATGCCAGG + Intronic
1021468711 7:20976667-20976689 CTATCACTTAATACAGTGCCTGG - Intergenic
1021951263 7:25777177-25777199 AGAGCACTTAACACAATGCCTGG - Intergenic
1024138871 7:46440882-46440904 ATATTACATAAAACCATGTAAGG + Intergenic
1026257892 7:68728524-68728546 AAAGCACTTAGAACAATGCCTGG - Intergenic
1027392534 7:77719736-77719758 ATATACATAAAAACCATGCCAGG - Intronic
1027759521 7:82260249-82260271 AAAACACTTAGAACAATGCCTGG + Intronic
1028199381 7:87943200-87943222 AAATCACTCAATACAATGCCTGG - Intronic
1028561192 7:92178372-92178394 ATCTCACTTAAAAACATGGCTGG + Intronic
1029951032 7:104585798-104585820 AAATTACTTAAAATCATGCAGGG + Intronic
1029969410 7:104774305-104774327 AGAAGACTTAGAACCATGCCTGG - Intronic
1030094791 7:105888545-105888567 ATACCACTTAAGACCAGGCGCGG - Intronic
1030120466 7:106105697-106105719 ATACCACTGAAACCCATGCTGGG + Intronic
1030430205 7:109436037-109436059 ATCTCACTTAAACCCATTGCAGG + Intergenic
1030926293 7:115459565-115459587 AAAGCACTTAAAACAATACCTGG - Intergenic
1030964587 7:115974913-115974935 AAAGCACTTAGAAGCATGCCTGG - Intronic
1031039518 7:116824589-116824611 AAATCACTCAAAACCATACATGG - Intronic
1031140282 7:117935376-117935398 ATATCTCCTTAAACCATACCTGG - Intergenic
1033997272 7:147366740-147366762 AAATCACTTAAAAACATACCTGG - Intronic
1035172504 7:157025866-157025888 ACAGCACGTAACACCATGCCTGG - Intergenic
1036909999 8:12749931-12749953 CTAGCACCTAAAACAATGCCTGG + Intronic
1037507669 8:19547980-19548002 GAATCACTTAATACAATGCCGGG - Intronic
1038255026 8:25943169-25943191 ATCTCATTTAAAACAAGGCCAGG + Intronic
1038398332 8:27263497-27263519 AAATCACTTAGAACATTGCCTGG + Intergenic
1041184319 8:55283247-55283269 AAAGCACTTAGCACCATGCCAGG - Intronic
1041656784 8:60360387-60360409 ATATTACTGAACACCCTGCCTGG + Intergenic
1042210449 8:66375543-66375565 TTATCACCTAGCACCATGCCTGG - Intergenic
1043074932 8:75686273-75686295 AAAACACTTAAAACCAAGCCTGG - Intergenic
1043108480 8:76147172-76147194 ATGGCATTTAAAACCATGGCAGG + Intergenic
1043146361 8:76660690-76660712 AAAGCACTTATCACCATGCCTGG + Intergenic
1044154859 8:88832430-88832452 TTATAACTTAAATCTATGCCTGG - Intergenic
1044418763 8:91967154-91967176 AAAGCACTTCATACCATGCCTGG + Intronic
1044833171 8:96269943-96269965 AAAGCACTTAAAACAGTGCCTGG - Intronic
1044871262 8:96622140-96622162 AAAGCACTTAGAACAATGCCTGG + Intergenic
1045505550 8:102775855-102775877 AAAGCACTTAGCACCATGCCTGG + Intergenic
1046514002 8:115234898-115234920 ACATCACTTAGAAACATGCCTGG - Intergenic
1047633042 8:126729006-126729028 AAATCATTTAGAACCATGCCTGG - Intergenic
1048185559 8:132237331-132237353 ACAGCACTGAAAACAATGCCTGG - Intronic
1050777496 9:9284370-9284392 ATAAAACTTACAACCATGGCAGG - Intronic
1050851794 9:10296775-10296797 ATGACAGTGAAAACCATGCCTGG - Intronic
1051093794 9:13441380-13441402 AAAGCACTTAAAACAATGGCTGG - Intergenic
1051248126 9:15132484-15132506 ACAACACTTAGAACAATGCCTGG + Intergenic
1051512178 9:17890137-17890159 ACAACACATAAAACAATGCCAGG - Intergenic
1053438134 9:38091082-38091104 AAAGGACTTAAATCCATGCCTGG - Intergenic
1055089883 9:72352796-72352818 ACAACACTTAAAACTGTGCCTGG - Exonic
1055275077 9:74606139-74606161 AAATCTCTTAACACAATGCCTGG + Intronic
1055377737 9:75668222-75668244 ATAGCACTTAATACAGTGCCTGG + Intergenic
1055446464 9:76388417-76388439 AAAGCACTTAAAACGGTGCCTGG + Intronic
1055481411 9:76712177-76712199 AAAACCCTTAGAACCATGCCTGG - Intronic
1055759034 9:79587115-79587137 CTAGCACCTAAAACAATGCCTGG + Intronic
1058121935 9:101148290-101148312 ATCTGACTTCAAACCCTGCCCGG + Intronic
1059225816 9:112672061-112672083 AAAGCACTTAAAACAATGCCTGG + Intergenic
1059592884 9:115681276-115681298 ATCTCAATTAAAACCATAGCCGG - Intergenic
1059758730 9:117318299-117318321 ACAGCACTTAAAAACTTGCCTGG + Intronic
1059867647 9:118534245-118534267 TTATCACTTAATACAATTCCTGG - Intergenic
1060400341 9:123344978-123345000 AGAGCACTTAGAATCATGCCTGG + Intergenic
1061021917 9:128021290-128021312 AGATCACTTAACAACATTCCAGG - Intergenic
1062029113 9:134354063-134354085 ATAACACTTAGGTCCATGCCTGG + Intronic
1186237676 X:7531207-7531229 TTATCACTGAGAACAATGCCTGG - Intergenic
1186777654 X:12881846-12881868 AAAACACTTAAAATGATGCCTGG + Intronic
1186995625 X:15118543-15118565 AAAACACTTAGAACAATGCCTGG + Intergenic
1188804045 X:34565749-34565771 ATCTCTCTTAGAACAATGCCTGG - Intergenic
1189036163 X:37495489-37495511 AAATCACTTAGAGCAATGCCTGG + Intronic
1189245368 X:39559225-39559247 GTAACACTTAGAACCATGCCCGG + Intergenic
1189650311 X:43181820-43181842 ATAACACTTAGAACCATGCTTGG - Intergenic
1189795587 X:44642935-44642957 AAAGCACTTAGAACAATGCCTGG + Intergenic
1190851455 X:54247567-54247589 ATATTAATTAAAATCATGTCTGG + Intronic
1191248098 X:58243951-58243973 ATATCACTCATTACAATGCCTGG - Intergenic
1191979558 X:66910973-66910995 AGATCACTTAGCACCATGCTTGG - Intergenic
1192594044 X:72387684-72387706 AAAGCACTTAAAACAGTGCCAGG + Intronic
1192862674 X:75094383-75094405 ATTTTACATACAACCATGCCAGG - Intronic
1194756132 X:97741988-97742010 AGTTCACTTAACACCATGCTTGG + Intergenic
1195348005 X:103970391-103970413 AAAGCACTTAGAACAATGCCTGG + Intergenic
1195359437 X:104068450-104068472 AAAGCACTTAGAACAATGCCTGG - Intergenic
1195778156 X:108430885-108430907 AAAACACTTAAAACAGTGCCTGG - Intronic
1196553606 X:117060455-117060477 ATACCACTGAAAACTGTGCCTGG - Intergenic
1197149745 X:123207317-123207339 AAATCACTTAGAAGGATGCCTGG - Intronic
1198762595 X:140048781-140048803 AAAACACTTAAAACAGTGCCTGG - Intergenic
1199315990 X:146378889-146378911 ACATCACTGTAGACCATGCCTGG + Intergenic
1199804115 X:151280825-151280847 AAATCACTTAGATCAATGCCTGG + Intergenic
1200041300 X:153372039-153372061 AAGACACTTAAAACCAGGCCAGG + Intergenic