ID: 978784237

View in Genome Browser
Species Human (GRCh38)
Location 4:112591720-112591742
Sequence CTGAATGAAGAGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1237
Summary {0: 1, 1: 1, 2: 4, 3: 115, 4: 1116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978784237_978784241 9 Left 978784237 4:112591720-112591742 CCTTTCTCCCTCTCTTCATTCAG 0: 1
1: 1
2: 4
3: 115
4: 1116
Right 978784241 4:112591752-112591774 CCAGTGTCATCTTATCAGAGAGG 0: 1
1: 0
2: 7
3: 50
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978784237 Original CRISPR CTGAATGAAGAGAGGGAGAA AGG (reversed) Intronic
900562658 1:3315137-3315159 CGGAGTGAAGCGGGGGAGAAAGG - Intronic
901083204 1:6595210-6595232 CAGAAGGAAGTGAGGGAGCAAGG - Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901212258 1:7533304-7533326 CTGACAGAAGAGAGGGAGGTGGG + Intronic
901359157 1:8681009-8681031 CTGAGTGGAGAGCCGGAGAATGG + Intronic
901749933 1:11399870-11399892 CTGAATGAAGACAGGAAGGCTGG + Intergenic
901922187 1:12545264-12545286 ATGAATGAAGGGAGGAAGGAAGG - Intergenic
902107442 1:14049618-14049640 AGGAAGGAAGAGAGGGAGAGAGG - Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902648180 1:17818644-17818666 CTGAATGAAGTGAGGGAATAAGG - Intronic
902757491 1:18558494-18558516 AGGAAGGAAGAGGGGGAGAATGG + Intergenic
902954172 1:19913502-19913524 CAAAATGAAGAATGGGAGAATGG - Intergenic
903433955 1:23332123-23332145 CTGAATGGAGAGAGGGGAGAGGG + Intronic
903934523 1:26885973-26885995 CTGGATGTTGAGAGGGATAAAGG + Exonic
904042640 1:27593341-27593363 CTGCAGGGAGAGAGGGAGAGAGG - Intronic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904997737 1:34644066-34644088 GTGAATGAAGTTAGGGATAACGG - Intergenic
905275519 1:36815382-36815404 CTGAGTGAAGAGAGAAGGAAGGG - Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905615165 1:39391962-39391984 CTGGAAGAAGAGTGGGAGAAGGG + Intronic
905715859 1:40149308-40149330 CTGAGTTTAGAGAGGGAGCAGGG + Intergenic
905761744 1:40564157-40564179 CAGAAAGAAGAGAGAAAGAAAGG - Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906532650 1:46532551-46532573 TGGGAGGAAGAGAGGGAGAAGGG - Intergenic
906634921 1:47403002-47403024 CTGCATGAAGAAAGGCACAAAGG + Intergenic
906797642 1:48710667-48710689 CTGAAAGAAAAGAGGGACAGAGG - Intronic
907097547 1:51795505-51795527 CAGAATGAAGATAGAGAGAAAGG + Intronic
907573765 1:55507397-55507419 AGGAATGAAGAGCAGGAGAAGGG - Intergenic
907952302 1:59195594-59195616 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908732350 1:67239011-67239033 CTGAAGGAAGGGAGGGAGTGAGG + Intronic
908735009 1:67267346-67267368 CAGAAGCAAGAGAGAGAGAAGGG - Intergenic
908800907 1:67879755-67879777 AGGAAGGAAGAAAGGGAGAAAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909985791 1:82159190-82159212 CTGAATGTAGAGAGAGAGTGGGG - Intergenic
910118060 1:83754579-83754601 ATGAAGGAAGGGAGGGAGGAAGG - Intergenic
910245656 1:85135539-85135561 TTCATTGAAGAGAGGGAGACTGG - Intergenic
910380486 1:86621817-86621839 GGGAAGGAAGAGAGGGAGAGAGG - Intergenic
910434005 1:87187044-87187066 AAGAAAGGAGAGAGGGAGAAAGG - Intergenic
910994765 1:93092615-93092637 ATGAATGAGGAGAGGAATAAGGG + Intronic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
911406869 1:97452126-97452148 CTAAGTGAAGATATGGAGAATGG - Intronic
911720491 1:101186300-101186322 TAGAAAGAAGAGAGAGAGAAAGG - Intergenic
911898572 1:103471353-103471375 AAAAAGGAAGAGAGGGAGAAAGG - Intergenic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
914334521 1:146702254-146702276 CTGACCAAAGAAAGGGAGAATGG + Intergenic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
916322035 1:163515331-163515353 CTAAAAGAAGAAAGGAAGAAAGG + Intergenic
916348203 1:163818531-163818553 CAGAATGAAGAATGAGAGAAAGG + Intergenic
916782804 1:168054040-168054062 CTGAAATAAGTGAGGGAGATGGG - Intronic
917008004 1:170437006-170437028 ATGAAGAAAGATAGGGAGAAAGG + Intergenic
917011816 1:170482872-170482894 CTGAAAGTAGAGAAAGAGAAGGG + Intergenic
917058692 1:171013007-171013029 CTGAAAGATGAGAGAGAGGAGGG - Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
917729699 1:177862371-177862393 CTGAAAGAAGAGAAGGAGTGAGG - Intergenic
917871726 1:179248162-179248184 AGGAAGGAAGAGAGAGAGAAGGG + Intergenic
918038364 1:180896989-180897011 ATGAAGGAAGAGAGGGAGGGAGG + Intergenic
918125894 1:181583322-181583344 CAGAATGAGGAGTGGTAGAAAGG - Intronic
918210965 1:182350310-182350332 CTGAATGCAGAGAGGTTGCATGG + Intergenic
918312544 1:183295434-183295456 CTGCATGAAGGGAGGTAAAAAGG - Intronic
918922107 1:190726318-190726340 CTGAAAGAAGCCAGGGAGGATGG - Intergenic
919783850 1:201244260-201244282 CTGAAGGAGGAGAGAAAGAATGG - Intergenic
920235044 1:204497255-204497277 CTGAATCAAGAGAGAGGGAGGGG - Intergenic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
920757169 1:208743875-208743897 AAGAAAGAAGGGAGGGAGAAAGG - Intergenic
921200493 1:212800694-212800716 CTGAAAGAAGAAAGGAAGAAGGG - Intronic
921312329 1:213856508-213856530 AGGAAGGAAGAAAGGGAGAAAGG - Intergenic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
921996021 1:221419245-221419267 CTGGAAGTAGAGAGTGAGAAAGG - Intergenic
922030951 1:221797648-221797670 ATGAATGAAGACAGGGAGGATGG + Intergenic
922429613 1:225537536-225537558 CTGAATGAAGAAAGAGTTAATGG - Intronic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
923127853 1:231047683-231047705 AAGAAAGAGGAGAGGGAGAAAGG - Intergenic
923210518 1:231799924-231799946 GACAAAGAAGAGAGGGAGAAAGG - Intronic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923458130 1:234183842-234183864 ATGAATGGAGAGAGGAAGACAGG - Intronic
923566501 1:235080383-235080405 AAGAATGAAGAAAGAGAGAAAGG + Intergenic
923844431 1:237713165-237713187 CTGATGGAAAAGAGGGAAAAGGG - Intronic
924141548 1:241028969-241028991 ATGAATGGTGAGAGGAAGAAAGG + Intronic
924159988 1:241220988-241221010 AGGAAGGAAGAGAGAGAGAAAGG + Intronic
924261202 1:242233528-242233550 CTAAAGGAAGAGAGAGAGAGAGG + Intronic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
924603233 1:245509848-245509870 CTGAAGGCAGGAAGGGAGAAGGG - Intronic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063252604 10:4289784-4289806 CACAAAGAAGACAGGGAGAAAGG - Intergenic
1063290268 10:4738628-4738650 AAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1063618362 10:7622050-7622072 CTGCATGAAGACAGGAAGATGGG - Intronic
1063755000 10:8997612-8997634 AGGAAGGAAGAGAGAGAGAATGG - Intergenic
1063915919 10:10882264-10882286 CTCAATGAAGAAAGGAAGTAAGG + Intergenic
1063972920 10:11393944-11393966 GGGAAAGGAGAGAGGGAGAAAGG - Intergenic
1064002240 10:11673301-11673323 CGGAAGGAAGAAAGGAAGAAAGG - Intergenic
1064500616 10:15968857-15968879 CTGAATTGAGGGAGGCAGAAAGG - Intergenic
1064872327 10:19952216-19952238 AGGAAGGAAGAAAGGGAGAAGGG - Intronic
1065371775 10:24994272-24994294 ATGAAGGAAGGGAGGGAGAAAGG - Intronic
1065825057 10:29563033-29563055 ATGCATGGAGAGAGGGGGAAGGG + Intronic
1065952352 10:30663786-30663808 ATGCATGGAGAGAGGGGGAAGGG - Intergenic
1066012730 10:31209442-31209464 CTGGCAGCAGAGAGGGAGAAAGG - Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066514456 10:36141708-36141730 CTGAATGATGACAGGGAGAGTGG - Intergenic
1067428834 10:46228709-46228731 CCCCATGGAGAGAGGGAGAATGG - Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1067832814 10:49620198-49620220 AGGAAAGAAGAGAGGGTGAAAGG + Intronic
1068594820 10:58891290-58891312 GTGAATGAAGACAAGGAGAATGG + Intergenic
1068643478 10:59438082-59438104 CTGAATGAATAGGAAGAGAAAGG - Intergenic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069190585 10:65483138-65483160 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1069745602 10:70713087-70713109 CTGAAAGATGAGAGAAAGAATGG - Intronic
1070102209 10:73399076-73399098 ATGAAGGAAGAGAGAGAGCATGG - Intronic
1070153155 10:73817716-73817738 CAGACTGCAGAGAGGGAGACGGG - Intronic
1070182253 10:74025645-74025667 AAGAAAGAAGGGAGGGAGAAAGG + Intronic
1070350086 10:75583428-75583450 CAGAAGGAAGAGAGAGAGAAGGG + Intronic
1070492470 10:76990588-76990610 AGGAATGAAGACAGGGAGGAAGG - Intronic
1070499303 10:77055475-77055497 AGGAAGGAAGAGAGGGAGGAAGG - Intronic
1070760235 10:79019682-79019704 TTGAATGAAAAGAGGGTGGATGG + Intergenic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071137511 10:82469202-82469224 CGGAAGGAAGGGAGGGAAAAGGG - Intronic
1071268967 10:83989775-83989797 AGGAAGGAAGAGAGAGAGAAAGG + Intergenic
1071444810 10:85735964-85735986 AAGAAGGGAGAGAGGGAGAAAGG + Intronic
1071705329 10:87992190-87992212 CGGACTGAAGAGACAGAGAAAGG + Intergenic
1072168519 10:92837771-92837793 CGGAATGAACAGTGAGAGAAAGG + Intronic
1072723225 10:97793697-97793719 AAGAAGGAAGAGAGGAAGAAAGG - Intergenic
1073142558 10:101258502-101258524 TTAAAAGAAGAAAGGGAGAATGG + Intergenic
1073337159 10:102718448-102718470 CTGAAGCAAGAGTGGGAGGAGGG - Intronic
1073640095 10:105243674-105243696 ATGAAAGAAGAAAGGGAGTATGG - Intronic
1073954099 10:108847989-108848011 AGGAATGAAGAGAGAAAGAAAGG + Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074081288 10:110169918-110169940 CAGAAGGAAGGGAGAGAGAAAGG + Intergenic
1074273543 10:111979031-111979053 CTGGAGGAGGAGCGGGAGAAAGG + Intergenic
1074485063 10:113868277-113868299 AGGAAAGAAGAGAGGGAGACAGG - Intronic
1075005950 10:118830265-118830287 CTGCTTGGAGAGAGGGAGACTGG - Intergenic
1075019757 10:118943351-118943373 CTAAAGGAAGAAGGGGAGAATGG - Intergenic
1075552497 10:123402415-123402437 AGGAAAGAAGAGAGGGAGGAGGG + Intergenic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1076458228 10:130619450-130619472 ATGAGTGAAGAGAGGGAGACAGG - Intergenic
1076558669 10:131346862-131346884 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558682 10:131346909-131346931 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558695 10:131346956-131346978 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1076998270 11:309931-309953 GGGAAGGAAGAGAGGGAGAGAGG + Intronic
1077159606 11:1106644-1106666 GTGAATGGAGGGAGGGAGAATGG - Intergenic
1077310400 11:1886411-1886433 TTGAATGGATAGAGGGACAATGG - Intronic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1077404855 11:2378280-2378302 CTGGGTGAGGAGAGGGAGATCGG - Intronic
1077664815 11:4098345-4098367 AGGAAAGAAGGGAGGGAGAAAGG - Intronic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1078179129 11:8995829-8995851 CTGAATGAATAAAGGGAGAGTGG - Intronic
1078896262 11:15599971-15599993 ATGAATGAAGAGAGAGAGCAAGG + Intergenic
1078925747 11:15873308-15873330 CAGAATAGAGAGAGAGAGAATGG + Intergenic
1079128770 11:17735704-17735726 AGGAAAGAAGGGAGGGAGAAAGG - Exonic
1079140077 11:17802745-17802767 CTGATTGAAGGGAGGGAGGGAGG - Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1079384514 11:19966916-19966938 CGGAATGAAAAGAGAGAGAAAGG + Intronic
1079911825 11:26319318-26319340 ATGGAAGAAGAGAGGGAAAAAGG - Intronic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080118880 11:28652020-28652042 AGGAAGGAAGAGAGGGAGAGAGG - Intergenic
1080327310 11:31091518-31091540 ATGAATAGAGAGGGGGAGAAAGG + Intronic
1081557199 11:44175786-44175808 AGGGATGGAGAGAGGGAGAAAGG + Intronic
1081576733 11:44323346-44323368 ATGAATGAAGAAAGGAAGGAAGG + Intergenic
1081583484 11:44368202-44368224 CTGATGGAAGGGAGGCAGAAAGG - Intergenic
1081747224 11:45481760-45481782 ATGAAGGAAGAGAGGAAGAGAGG - Intergenic
1081819656 11:45979517-45979539 CTGTCTGAAGAAGGGGAGAAAGG - Intronic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1082192569 11:49265242-49265264 AAGGAGGAAGAGAGGGAGAAGGG + Intergenic
1082273094 11:50193179-50193201 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1084113906 11:67030862-67030884 GTGAATGAGGAGAGGAACAAAGG - Intronic
1084212343 11:67630005-67630027 CCGAAAGCTGAGAGGGAGAAGGG + Intergenic
1085642947 11:78204618-78204640 ATGAATGAATAGAGGCAAAAAGG - Intronic
1085788403 11:79474936-79474958 TCTAATGAAGACAGGGAGAATGG + Intergenic
1085796864 11:79549760-79549782 TTGAATGAAGTGAGGAAGAAAGG + Intergenic
1085847507 11:80083194-80083216 AAGAAGGAAGAGAGGGAGGACGG - Intergenic
1086077441 11:82869479-82869501 AAGAAGGAAGAGAGGGAGAAAGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086439744 11:86816192-86816214 CTAATTGAAGAGATGGAGGAAGG - Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086538258 11:87876348-87876370 GTGAAAGAAGAGAAGGAAAAAGG - Intergenic
1086558532 11:88140619-88140641 CTGAAGGAAGAGTGAGAGACAGG + Intronic
1087058980 11:93960166-93960188 ATCGATGAAGAGAGTGAGAAAGG - Intergenic
1087623211 11:100565966-100565988 CAGAATGAAGAGATAGAAAAAGG - Intergenic
1087940963 11:104096493-104096515 CTGAATGAAGAAAGGGAATTTGG - Intronic
1088436061 11:109814431-109814453 ATGAAGGAAGGAAGGGAGAAAGG - Intergenic
1088488918 11:110368303-110368325 GTGAATGAACAGAGCGTGAACGG + Intergenic
1088599002 11:111459451-111459473 CTGAATTCAGAAAGGAAGAAAGG - Intergenic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1088871835 11:113896980-113897002 CTGAGTGGGGAGAGGGTGAACGG - Intergenic
1089115016 11:116087846-116087868 AAGAAAGGAGAGAGGGAGAAGGG - Intergenic
1089199409 11:116714790-116714812 CTGAGTGTGGAGAGGGGGAAAGG + Intergenic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1090640742 11:128726903-128726925 CTGAAGGAGGGGAGGGACAACGG + Intronic
1090708966 11:129368785-129368807 AAGAATGAAGAGAGGGCAAAAGG - Intergenic
1090747035 11:129714046-129714068 CTGATTGGTGACAGGGAGAATGG + Intergenic
1090919834 11:131197957-131197979 CTGGATGAAGAGAGAGAAATAGG + Intergenic
1091142804 11:133250481-133250503 AAGAATGAAGAAAGGGAGGAAGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091427095 12:400578-400600 AGGCAAGAAGAGAGGGAGAAAGG + Intronic
1091494881 12:963946-963968 CTGAATGAAATGAGTGAGAAGGG + Intronic
1091771450 12:3154579-3154601 GGGAAGGAAGAGAGGGAGGAAGG - Intronic
1092109164 12:5946597-5946619 CTGGAAGTAGACAGGGAGAAAGG - Intergenic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1092351200 12:7757333-7757355 AGGAAGGAAGAGAGGGAGATAGG - Intergenic
1092393629 12:8104721-8104743 CTGAGTGGGGAGGGGGAGAAGGG - Intergenic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1092778518 12:11964585-11964607 GGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1092996979 12:13959711-13959733 CTGATTGAATGAAGGGAGAAGGG + Intronic
1093123066 12:15295978-15296000 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
1093128130 12:15355058-15355080 GAGGATGAAGAGAGAGAGAAAGG + Intronic
1093205567 12:16244610-16244632 AAAAATGAAGAGAGGGAGAAGGG + Exonic
1093447632 12:19278796-19278818 CGGGGTGGAGAGAGGGAGAAAGG - Intronic
1093517204 12:20002701-20002723 CTGAATGACTATGGGGAGAAAGG - Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094396931 12:30016999-30017021 CTGCGAGAAGAGAGGCAGAAAGG - Intergenic
1094484690 12:30915129-30915151 CTGAATGAAAGGAAGGAGTAAGG + Intergenic
1095658087 12:44695053-44695075 AGGAAGGAAGAGAGGGAGGAAGG + Intronic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1095758859 12:45804002-45804024 ATATATGAAGAGAGGGAGAGAGG + Intronic
1095942149 12:47734358-47734380 GGGAATGGAGAGAGGGAAAAAGG + Intergenic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096565821 12:52477950-52477972 CAGAAGGAAGAGAGAGAGAAGGG - Intergenic
1096756306 12:53802713-53802735 TTGAGAGAAGAGAGGGAGAAGGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097366602 12:58721285-58721307 ATGAATAAAGAGCGGGAAAATGG - Intronic
1097925101 12:65118523-65118545 CCGAATGAGTAGAGAGAGAAAGG + Intronic
1098213227 12:68188016-68188038 CAAGAAGAAGAGAGGGAGAATGG + Intergenic
1098569629 12:71974051-71974073 TTGAAAGAAGAGAGAGAAAAGGG - Intronic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099496358 12:83351703-83351725 GGGAATGGAGGGAGGGAGAAAGG - Intergenic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099739901 12:86620853-86620875 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
1100184970 12:92129071-92129093 CTGCATGGAGGGAGGGGGAAGGG + Intronic
1100471250 12:94895214-94895236 CAGAAGGGAGAGAGGGAGCAAGG - Intergenic
1101254541 12:102964769-102964791 AGGAGTGGAGAGAGGGAGAAAGG - Intergenic
1101389325 12:104286175-104286197 CTGAATGAAGGAAGGAAGGAAGG - Intronic
1101483166 12:105122853-105122875 AGGCTTGAAGAGAGGGAGAAAGG - Intronic
1101664606 12:106800348-106800370 CAGGAGGAAGAGAGAGAGAAGGG + Intronic
1101977054 12:109368800-109368822 GGGAAGGAAGAGAGGGGGAAAGG - Intronic
1102371091 12:112382571-112382593 CTGAATGGCCAGGGGGAGAAGGG - Intergenic
1102396016 12:112586439-112586461 CTGGATGCAGTGAGGGAGTAAGG + Intronic
1102500162 12:113346619-113346641 CTGAAGGAAGGGAGGGTCAAAGG + Intronic
1102754198 12:115323561-115323583 AGGAATGAAGAAAGGAAGAAGGG + Intergenic
1102756593 12:115346523-115346545 AAGAATGGAGGGAGGGAGAAAGG + Intergenic
1102759678 12:115374601-115374623 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1102856318 12:116297555-116297577 GTGAATGAAGACAGGGAAATAGG + Intergenic
1103047379 12:117748762-117748784 CTAAATTAAGACAGGGATAAAGG - Intronic
1103366827 12:120389753-120389775 AGGAAGGAAGAGAGGGAGGAGGG + Intergenic
1103371458 12:120422701-120422723 CTGAGTCCAGAGAGGGCGAAGGG - Intergenic
1103578984 12:121900152-121900174 CTGAATGATGAAAATGAGAATGG + Intronic
1103688538 12:122752152-122752174 ATGAAGGAAGGGAGGGAGGAAGG + Intergenic
1104066808 12:125313498-125313520 ATGAAGGAAGGGAGAGAGAAAGG - Intronic
1104092563 12:125527869-125527891 GTGAATGAAAAGAGAGAAAATGG + Intronic
1104289016 12:127451456-127451478 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1104691959 12:130833168-130833190 ATGAATGAAGAGCAAGAGAAGGG + Intronic
1105334231 13:19449922-19449944 CTGAAAGAAGGGAAGGAGAAAGG - Intronic
1105947549 13:25202669-25202691 CTGAATGAAAAGTGGGAAACAGG + Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106166168 13:27248431-27248453 CTGAAAGAAAGGTGGGAGAAAGG + Intergenic
1106380771 13:29236720-29236742 GTGGAGGAAGAGAGAGAGAAAGG + Intronic
1106393511 13:29358586-29358608 GTGAAGGAAGAGAGGAAGCAGGG + Intronic
1107169326 13:37321239-37321261 GAGAGTGGAGAGAGGGAGAAGGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108166575 13:47699540-47699562 CGGAAGGAAGAGAGGCATAATGG - Intergenic
1108363266 13:49686792-49686814 CAAAAAGAAGAGAGAGAGAATGG - Intronic
1108588313 13:51890400-51890422 AGGAAGCAAGAGAGGGAGAAAGG - Intergenic
1108628193 13:52253591-52253613 CTGAAAGAAGGGAAGGAGAAAGG - Intergenic
1108657866 13:52552858-52552880 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic
1108839562 13:54595088-54595110 CTAAATGAAGCTAGAGAGAAGGG + Intergenic
1108959947 13:56214358-56214380 CTGCATGAATCCAGGGAGAAAGG - Intergenic
1109033458 13:57224226-57224248 AAGAATGAAAGGAGGGAGAAAGG + Intergenic
1109229779 13:59742679-59742701 AGGAAGGAAGAAAGGGAGAAAGG + Intronic
1109393453 13:61723387-61723409 ATGAAAGGAGAGAGGAAGAAAGG + Intergenic
1109479433 13:62929487-62929509 CTGAAAGAGGAGAGAGAGCAAGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110216413 13:73029502-73029524 CTGGAAGAAGAGAGAGACAAAGG - Intergenic
1110223374 13:73095471-73095493 CTGAATGAAGAGGATGAGAGGGG - Intergenic
1110422535 13:75329128-75329150 TTGAAGGAAGAGGGGAAGAAAGG - Intronic
1110485652 13:76038590-76038612 CTCAATGAAGGATGGGAGAATGG + Intergenic
1110499840 13:76214172-76214194 CTGGATGGAGAGAGAGAAAAGGG + Intergenic
1110738161 13:78962833-78962855 CTAAATGAATAGAGGAAAAAGGG - Intergenic
1110951229 13:81494147-81494169 CAGAATGAGGAGAGAGACAAAGG + Intergenic
1111017181 13:82396917-82396939 GGGAAGGAAGAGAGGGAGAGAGG - Intergenic
1111048441 13:82846831-82846853 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1111116683 13:83787523-83787545 CAGAATGAAACGAGAGAGAAAGG - Intergenic
1111233865 13:85382284-85382306 ATTAATTTAGAGAGGGAGAAAGG - Intergenic
1111279973 13:86009851-86009873 ATAAATGTAGAGAGGTAGAAGGG + Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111337126 13:86839159-86839181 GGGAATGGAGAGAGGGAGAGAGG - Intergenic
1111634378 13:90884449-90884471 CTCAAGGGAGAAAGGGAGAAGGG + Intergenic
1111674855 13:91374797-91374819 ATGGAGGAAGAAAGGGAGAATGG + Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1112199689 13:97262574-97262596 CAAAAATAAGAGAGGGAGAAGGG - Intronic
1113058655 13:106297436-106297458 CAGGAGGAAGAGAGAGAGAAGGG - Intergenic
1113203938 13:107895080-107895102 TTAAATCAAGAGAGGGAGAAGGG + Intergenic
1113309172 13:109113345-109113367 AGGAAGGAAGAGAGGGAGGAAGG + Intronic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1113674103 13:112196303-112196325 AGGAATGAAGAGAGAGAGGAAGG - Intergenic
1113830266 13:113290299-113290321 CTGAAGGACGTGAGGAAGAAAGG - Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1115909610 14:38240902-38240924 ATGGCTGGAGAGAGGGAGAATGG + Intergenic
1116492816 14:45526536-45526558 CTGAATGAAACCTGGGAGAAGGG + Intergenic
1116650334 14:47583226-47583248 TAGAATGACGTGAGGGAGAATGG + Intronic
1116780086 14:49227564-49227586 TTTAAGAAAGAGAGGGAGAATGG - Intergenic
1116790225 14:49332034-49332056 TAGAATGAAGGGAGGGAGAAAGG - Intergenic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117118867 14:52547645-52547667 CTGTTTGGAGAGAGGAAGAATGG - Intronic
1117601119 14:57375891-57375913 CTCAATGAGGATAGGGATAATGG + Intergenic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118270263 14:64336873-64336895 CTGAATGAAGAGAGGAAGTTAGG - Intronic
1118352602 14:64983830-64983852 ATGAGTGAAAACAGGGAGAACGG + Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118517148 14:66543026-66543048 CTGGAGGAAGAGAGAGAGAGTGG + Intronic
1118604069 14:67490312-67490334 GAGAATGAAGAGAGGCAGAGTGG + Intronic
1118759446 14:68870887-68870909 CTGAAGGAAGGAAGGGAGTAAGG - Intergenic
1118809518 14:69262589-69262611 GTGCAGGAAGAAAGGGAGAATGG + Intronic
1118991929 14:70804903-70804925 CAGAAAGAAGGGAGGGAGGAAGG + Intronic
1119123018 14:72097567-72097589 AAGAATGAAGAGGAGGAGAAGGG + Intronic
1119896077 14:78220911-78220933 CTGAATGAGGAAGGGGAAAAGGG + Intergenic
1119913805 14:78376525-78376547 CTGAAACATGAGAGGGAAAAGGG + Intronic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1119949637 14:78730985-78731007 CTGAAGGGAGGGAGGAAGAAAGG - Intronic
1120696522 14:87650906-87650928 CAGAATGAAGGGAAGAAGAAGGG - Intergenic
1120795889 14:88632491-88632513 ATGAATGTAGAGAGGGATAGTGG - Intronic
1121060742 14:90907073-90907095 CTGGATGTTAAGAGGGAGAAAGG - Intronic
1121347604 14:93147644-93147666 GCGAATAAAGAGAGAGAGAAGGG - Intergenic
1121381909 14:93479252-93479274 AAGAATGGAGGGAGGGAGAAAGG - Intronic
1121481397 14:94278580-94278602 ATGAAGGAAGAGAGGGAGGGTGG - Intronic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121714742 14:96065578-96065600 TTGGAGGAAGAGAGAGAGAAGGG - Intronic
1122021976 14:98845570-98845592 ATGTTTGAAGAGAGGGAGACAGG + Intergenic
1122147480 14:99700214-99700236 CTGAAGGGAGAGAGGAAAAAGGG + Intronic
1122298464 14:100718624-100718646 CAGAAGGAAAAGAGAGAGAAAGG - Intergenic
1122317580 14:100835160-100835182 GGGAAGGCAGAGAGGGAGAAGGG - Intergenic
1122354968 14:101117471-101117493 ATGCATGAAGATAGGGAGAAAGG - Intergenic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1123187573 14:106535067-106535089 GGGAATGGAGAGAGGGAGAGAGG + Intergenic
1202890854 14_KI270722v1_random:155995-156017 CTGAAAGAAGACAGGAAAAACGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124101518 15:26698621-26698643 CAGAATGAAGAGGGAGGGAAGGG + Intronic
1124427477 15:29574044-29574066 CAGAAAGAAGGGAAGGAGAAAGG + Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125972842 15:43926099-43926121 CTGAATGAATAGAAGGGAAAAGG + Intronic
1126388218 15:48116466-48116488 TTAAAAGAATAGAGGGAGAATGG + Intergenic
1126549080 15:49907534-49907556 AAGAATGAAGGAAGGGAGAAGGG + Intronic
1126567806 15:50117958-50117980 ATGAAGGTAGAGAGGGAGAATGG + Intronic
1126778486 15:52119221-52119243 ATGAATGAGGAGAGGGGGAGGGG + Exonic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1127315057 15:57787271-57787293 GGGAATGGAGAGAAGGAGAATGG + Intergenic
1127496399 15:59516486-59516508 GTTAAGGAAGAAAGGGAGAACGG + Intronic
1127586406 15:60382116-60382138 GAGAAGGAAGAAAGGGAGAAGGG + Intronic
1127672238 15:61206242-61206264 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127795164 15:62431718-62431740 CAGAAAGAAGAAAGGGAAAATGG + Intronic
1128449567 15:67797062-67797084 CACAATGAAGAAAGGGAGAATGG + Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1128928228 15:71678627-71678649 GTTCATGATGAGAGGGAGAAAGG - Intronic
1129119057 15:73384106-73384128 CTGAATGAAAACAGGGAAAGGGG - Intergenic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129245938 15:74278677-74278699 CTGGGTGAAGAGAGGGATAAAGG - Intronic
1129675184 15:77629475-77629497 CTTTAGGAAGAGAGGGAGACTGG - Intronic
1130847135 15:87758090-87758112 ATGAAGGAAGGGAGGGAGGAAGG + Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1131362466 15:91805552-91805574 AGGAAGGAAGGGAGGGAGAAAGG + Intergenic
1131601174 15:93850567-93850589 CTCAAAGAAAAGAGGGGGAATGG - Intergenic
1131693195 15:94847918-94847940 GTGAATGAAGTGAAGTAGAAAGG + Intergenic
1131793352 15:95988445-95988467 AGGAAGGAAGAGAGGGAGAAAGG + Intergenic
1131961435 15:97793670-97793692 CTGAAAGAAGAGAGGGTGTTAGG - Intergenic
1132976529 16:2713884-2713906 CAGAAGGAAGAGGGGGTGAAGGG - Intronic
1133087458 16:3375936-3375958 AGGAAGGAAGGGAGGGAGAAAGG - Intronic
1133470330 16:6069019-6069041 AAGAATGAAGGAAGGGAGAAAGG + Intronic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133678692 16:8099832-8099854 CTGAAGAGAGAGAGAGAGAAGGG - Intergenic
1133758662 16:8781108-8781130 ATGAATGAGGGGAGAGAGAAAGG + Intronic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134148791 16:11789147-11789169 TTGAAGGAAGAGGGGGTGAAGGG + Intronic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1134329002 16:13233273-13233295 ATGAAGGAAGAGAGGGAGGGAGG + Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1134887210 16:17804267-17804289 GGGAAGGAAGTGAGGGAGAAGGG - Intergenic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135592971 16:23717988-23718010 GTGTATGAAGAGAGAGAGAGAGG + Intergenic
1135637903 16:24094794-24094816 ATGAAGGAAGGGAGGGAGGAAGG + Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1136409118 16:30066158-30066180 CTGCAAGAAAAGGGGGAGAATGG - Intronic
1136935598 16:34461046-34461068 AGAAATGAAGAGAGGGAGGAGGG - Intergenic
1136964220 16:34887524-34887546 AGAAATGAAGAGAGGGAGGAGGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137404011 16:48176044-48176066 CTGAATGAATATAGGCAGTAGGG + Intronic
1137919361 16:52471622-52471644 TTGAAGGGAGAGAGGGAGAAAGG + Intronic
1138195823 16:55051458-55051480 CAGAAGGAAGACAGGGAGGAGGG + Intergenic
1138215506 16:55201561-55201583 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138682346 16:58694505-58694527 CTGTCTCAAGAGAGCGAGAAGGG - Intergenic
1138752547 16:59440885-59440907 AGGAAGGAAGAGAGAGAGAAAGG - Intergenic
1138810148 16:60139828-60139850 CTGCATGGAGAGTGGGTGAAGGG + Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1138960337 16:62021877-62021899 AAGAAGGAAGAGAGGGAGATGGG - Intronic
1138992536 16:62409184-62409206 ATAAATAAAGAGAGAGAGAACGG - Intergenic
1139066302 16:63319532-63319554 ACGAAAGAAAAGAGGGAGAAAGG - Intergenic
1139211259 16:65079629-65079651 CTGAATCAAGAAAGGTAGAGAGG - Intronic
1139273373 16:65704159-65704181 CTGAAGGCAGAGGAGGAGAAAGG - Intergenic
1139278518 16:65749994-65750016 GGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1139476365 16:67204470-67204492 ATGAAGGGAGAGAGGCAGAAGGG + Intergenic
1139690413 16:68638169-68638191 CTGAAGGAGGTGAGGGAGAGGGG + Intronic
1139999101 16:71008978-71009000 CTGACCAAAGAAAGGGAGAATGG - Intronic
1140027117 16:71300859-71300881 CTCCATGAGAAGAGGGAGAAAGG - Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140638447 16:76943898-76943920 TTGAAAGAGGAGAGAGAGAAAGG - Intergenic
1140680079 16:77376228-77376250 CAGAAGGAAGAGAGAGTGAAGGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1141734610 16:85844043-85844065 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1142533235 17:596593-596615 CTGAAGCAAGAGAGGAATAATGG + Intronic
1143258262 17:5579909-5579931 GAGAGTGAAGAGTGGGAGAAGGG + Intronic
1143888920 17:10087521-10087543 ATGAATGAAGAAAGGAAGGAAGG + Intronic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1144058449 17:11560903-11560925 AGGAATGAAGGGAGGGAGAGAGG + Exonic
1144403519 17:14929734-14929756 TGGAGTGAAGAGAGAGAGAAGGG - Intergenic
1144499719 17:15775511-15775533 AGGAAAGAAGAGAGGGAGGAAGG - Intergenic
1145269652 17:21397908-21397930 CTGAAAGAAGAAAAGGAGAAGGG - Intronic
1145930938 17:28684930-28684952 CTGCATGGAGAGAGGAAGAGCGG + Exonic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1146182526 17:30707334-30707356 ATGAATGAGGAAAGGGAAAAGGG - Intergenic
1146281511 17:31548286-31548308 CTGAAAGAAAACAGGGGGAAAGG - Intergenic
1146438615 17:32874513-32874535 CTCAATGAAGACCTGGAGAAAGG - Intronic
1146487837 17:33258502-33258524 CTAAATGAAGTGAGGGAGCGAGG + Intronic
1146488401 17:33262308-33262330 GGGAATGGGGAGAGGGAGAAAGG + Intronic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1146645491 17:34574433-34574455 CTGAATGAAGTAAAGGAGCAAGG + Exonic
1146799206 17:35805221-35805243 GTGGAAGAAGAGAGGAAGAAAGG - Intronic
1146973184 17:37089249-37089271 ATAAAGGAAGAGAAGGAGAAGGG - Intronic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147497082 17:40926912-40926934 GTGAATGAAGGGAAGAAGAAAGG - Intronic
1147511895 17:41076960-41076982 AGGAAAGAAGAGAGGGAGGAAGG + Intergenic
1147899272 17:43773354-43773376 CTAAAAGCAGAAAGGGAGAAAGG + Intronic
1148022921 17:44565558-44565580 CTGAAAGAAGGAAGGGAGTAGGG - Intergenic
1148207609 17:45789158-45789180 CTCAGTGAAAAGAGGGAGTAGGG + Intronic
1148281861 17:46354489-46354511 CCGGATGGAGAGAGGGAGAGTGG - Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148304086 17:46572428-46572450 CCGGATGGAGAGAGGGAGAGTGG - Intronic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148384725 17:47226022-47226044 AAGAAAGAAGAGAGGGAGGAGGG - Intergenic
1148754717 17:49967021-49967043 ATTAAGGAAGAAAGGGAGAAAGG + Intergenic
1148774162 17:50085224-50085246 AGGAAGGAAGAGAGGGAGGAAGG + Intronic
1148979043 17:51555285-51555307 AAGAATGTAGAAAGGGAGAAAGG - Intergenic
1149125693 17:53228731-53228753 CTGAACTAAGAGTGAGAGAATGG - Intergenic
1149161616 17:53700714-53700736 AGGAAGGAAGAGAGAGAGAAAGG - Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1150011066 17:61504312-61504334 TGGAATGAAGAGAGGAAGAGAGG - Intergenic
1150281002 17:63929603-63929625 CTGAATGAAGGAAGGAAGGAAGG + Intronic
1151356639 17:73562539-73562561 CTCAAAGAAGAGAGAGAGACAGG + Intronic
1151462562 17:74263273-74263295 ATGAATGAAAAGGGGAAGAAAGG - Intergenic
1151583788 17:74995958-74995980 CTTAATCCAGAGACGGAGAAGGG - Intronic
1151739627 17:75971426-75971448 TTGAAAGGAGAGAGGAAGAAAGG - Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152358959 17:79821377-79821399 CTAAAGGAAGGGAGGAAGAAAGG - Intergenic
1153239186 18:3015253-3015275 CTGAATGATGAAAGGAAGGAAGG - Intergenic
1153337883 18:3943255-3943277 TTGAAAGAAGAAAGGGAAAAAGG + Intronic
1153445430 18:5167241-5167263 CTAACTGCAGATAGGGAGAAGGG + Intronic
1153751880 18:8240592-8240614 CTGCATGGAGAGAGAGAGAGAGG + Intronic
1153760949 18:8331448-8331470 CTAAAAGAAGATAGGCAGAATGG + Intronic
1153984945 18:10343522-10343544 CTGAGTGAAGACTGGGGGAAAGG + Intergenic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155034704 18:22016280-22016302 AGGAATGAAGAAAGGCAGAAAGG - Intergenic
1155466974 18:26146984-26147006 CAGGAAGAAGAGAGAGAGAAGGG + Intronic
1155620861 18:27777908-27777930 CTGGATGGAGAGAGAGAAAAGGG - Intergenic
1155692593 18:28644104-28644126 AGGAAAGAAGGGAGGGAGAAAGG + Intergenic
1155718479 18:28977768-28977790 GGAAATGAAGAGAGGTAGAAGGG + Intergenic
1155859418 18:30878183-30878205 CTGAATTAAGATAAGGACAAAGG + Intergenic
1156105049 18:33649652-33649674 ATGAAGCAAGAGAGGAAGAAAGG + Intronic
1156227939 18:35127513-35127535 CTGAAGAAAGAAAGGAAGAAGGG - Intronic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1156731790 18:40203256-40203278 ATGAAAGAGAAGAGGGAGAATGG + Intergenic
1156821358 18:41376845-41376867 ATGAATGTAAACAGGGAGAATGG + Intergenic
1156985054 18:43341301-43341323 TAGGATGGAGAGAGGGAGAAGGG + Intergenic
1157051969 18:44176707-44176729 CTGGGTGGAGAGAGAGAGAAGGG + Intergenic
1157220413 18:45825277-45825299 ATGGAAGAAGGGAGGGAGAAAGG + Intergenic
1157228633 18:45892044-45892066 CAGAATGAAGGGAGGTGGAAAGG + Intronic
1157330348 18:46699677-46699699 GTGAAAGAAAAGAGGGAGAAAGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157697171 18:49732170-49732192 CTGAATGATGAGAGTGAGGCTGG + Intergenic
1158037254 18:53048267-53048289 CTGAGTGGAGGGTGGGAGAAGGG - Intronic
1158134864 18:54197126-54197148 ATGAATGAATAAAGGAAGAAAGG - Intronic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158475456 18:57775436-57775458 AAGAAGGAAGAGAGGGAGGAAGG + Intronic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1159309345 18:66687428-66687450 CTCAAAGAAGGGAGGGAAAAAGG - Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160047292 18:75398784-75398806 GTGGATGAAGAGAGAGAGAGAGG - Intergenic
1160222497 18:76987494-76987516 AGGAAGGAAGAGAGGGAGGAAGG - Intronic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1161256031 19:3310199-3310221 ATGAAAGGAGGGAGGGAGAAGGG - Intergenic
1161256090 19:3310639-3310661 ATGAAAGGAGGGAGGGAGAAGGG - Intergenic
1161256154 19:3310958-3310980 ATGAAAGGAGGGAGGGAGAAGGG - Intergenic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161271740 19:3393321-3393343 CTGCCGGAGGAGAGGGAGAAGGG + Intronic
1161657184 19:5523448-5523470 CGGAGTGAAGAGTGGGAGAGAGG - Intergenic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1161943783 19:7421914-7421936 CTGGAAGAAGGAAGGGAGAAGGG - Intronic
1162134325 19:8545809-8545831 CTAAGTGATGAGATGGAGAAGGG - Intronic
1162274425 19:9641539-9641561 CTGAAAGAAGAGAGATTGAAGGG + Intronic
1162976295 19:14208471-14208493 ATGAATGAGGAAAGGGAAAAGGG + Intergenic
1163383662 19:16985765-16985787 GTGAATGAATGGAGGGAGAGAGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1165020447 19:32920010-32920032 ATGAATGAAGGAAGGGAGGAAGG - Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165981675 19:39729427-39729449 CTGCATGAAGACAGGGACAGGGG + Intergenic
1165989653 19:39802774-39802796 GTGACAGGAGAGAGGGAGAATGG - Intergenic
1166395032 19:42433407-42433429 CTGAAAGCAGAGAGGCAAAATGG - Intronic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166484806 19:43203777-43203799 CTTAATGCAGAGAGGGACACAGG + Intronic
1166963772 19:46515446-46515468 CTGGATGAAACCAGGGAGAAGGG - Intronic
1167101926 19:47409047-47409069 GGGAATGGAGAGAGGGAGAAGGG - Intronic
1167722825 19:51190600-51190622 CTGAACAGAGAGAGCGAGAAGGG - Intergenic
1168158259 19:54490761-54490783 AGGAAGGAAGGGAGGGAGAAAGG - Intergenic
1168158298 19:54491000-54491022 GAGAAGGAAGAGAGAGAGAAAGG - Intergenic
1168373754 19:55858444-55858466 CTGAAGCAAGAGATGCAGAAAGG + Exonic
1168377302 19:55891190-55891212 CGTAATGAAGAGTGGGAGATAGG + Intergenic
1168725049 19:58576396-58576418 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1168725055 19:58576420-58576442 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
925443326 2:3907098-3907120 GGGAAGGAAGAGAGGGAGGAAGG - Intergenic
925659133 2:6183986-6184008 AGAAATGAAGAGAGGGAGGAAGG + Intergenic
925667922 2:6281511-6281533 GTGAATGTAGAGATGGGGAAGGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925775970 2:7336199-7336221 CTGAAGGAGGAGAGGGGGAGTGG + Intergenic
925840260 2:7985377-7985399 GGGAATGAAGAGAAAGAGAAAGG - Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
926244636 2:11113688-11113710 AGGAAAGAAGAGAGGGAGGAAGG - Intergenic
926416508 2:12654918-12654940 GTTAAAGAAGACAGGGAGAAAGG - Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926715403 2:15920112-15920134 AGGAAGGAAGAGAGGGAGGAGGG - Intergenic
926880933 2:17542668-17542690 CTCAATGATGACAGGGAGTATGG - Intronic
926965083 2:18401103-18401125 CGGGATGAAGACAGGGAGTATGG + Intergenic
927019204 2:18999657-18999679 TAGAAGGAAGAAAGGGAGAAAGG - Intergenic
927308488 2:21600949-21600971 TTGATTGAAGAGAGAGAGAAAGG - Intergenic
927474378 2:23401299-23401321 CTGAATGGAGAGAGGGAAACCGG - Intronic
927689217 2:25195827-25195849 CTTAATGAGGCGAGGGAGCAAGG - Intergenic
927740887 2:25568821-25568843 CAGAATGAAGGGGAGGAGAACGG - Intronic
927784200 2:25961237-25961259 GGGAGTGAAGAGATGGAGAAAGG + Intronic
929903654 2:46027398-46027420 CTGAATGAGGATGGGGAGAGAGG + Intronic
929982474 2:46694550-46694572 CTGAATGAGGATAGTGAAAATGG + Intergenic
930104544 2:47629704-47629726 ATGAAGCAAGGGAGGGAGAAAGG + Intergenic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932458428 2:71864963-71864985 AGGAAGGAAGGGAGGGAGAAAGG - Intergenic
932708544 2:74046259-74046281 CTGTCTAAAGAGAGAGAGAAGGG - Exonic
933026219 2:77262851-77262873 CTAAATGATGAGAGTGATAAAGG + Intronic
933444595 2:82363694-82363716 TTGAATGAAGAAAAGAAGAAAGG - Intergenic
933583588 2:84155032-84155054 CAGAAGCAAGAGAGAGAGAATGG - Intergenic
933994457 2:87657647-87657669 AGGAATGAAGAGTGGGAGAAAGG + Intergenic
934020590 2:87947583-87947605 GGGAAGGGAGAGAGGGAGAAAGG - Intergenic
934150907 2:89146774-89146796 CTGAATTAAGGCAGAGAGAAAGG - Intergenic
934216367 2:90035251-90035273 CTGAATTAAGGCAGAGAGAAAGG + Intergenic
935362138 2:102254585-102254607 AAGAACGAGGAGAGGGAGAAGGG + Intergenic
935484742 2:103639740-103639762 TGGAAAGAAGAGAGGGAGGAGGG + Intergenic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936299399 2:111293266-111293288 AGGAATGAAGAGTGGGAGAAAGG - Intergenic
936591188 2:113806280-113806302 ATGAATGATGAGAGGCCGAATGG - Intergenic
936965001 2:118118689-118118711 GTGAATGAGGAGAGAGGGAAAGG - Intergenic
937293090 2:120793776-120793798 GTGAATGTAGTGAGGGAGGAGGG - Intronic
938122632 2:128644715-128644737 GGGAAGGCAGAGAGGGAGAAAGG - Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
938786933 2:134638573-134638595 CTGAATGAAGGCAGGGGTAATGG + Intronic
938928027 2:136062099-136062121 CAGAAGGAAGACAGGGAAAATGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939444856 2:142295736-142295758 AAGAAAGAAGAGAGAGAGAAAGG - Intergenic
940090194 2:149906904-149906926 TTGACTGAAGAGAAGGATAATGG - Intergenic
940126717 2:150334171-150334193 AGGAATGAAGGGAGGGAGAGAGG - Intergenic
940139032 2:150473057-150473079 CTGAAAGGAGTGAGGGAGAGAGG - Intronic
940139952 2:150483040-150483062 ATGGATGGAGAAAGGGAGAAAGG + Intronic
940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG + Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
941004897 2:160237983-160238005 ATGAATGAAGAGTGGAAGCAGGG + Intronic
941051016 2:160734313-160734335 GTTAATTAATAGAGGGAGAAGGG - Intergenic
941367480 2:164624811-164624833 AGGAAGGAAGAGAGGAAGAAAGG - Intergenic
941390674 2:164910122-164910144 CAGAATGAAGAGTAAGAGAAGGG + Intronic
941583154 2:167325420-167325442 CGGGAAGAAGAGAGAGAGAAGGG + Intergenic
941838972 2:170058190-170058212 TTCAATGAAGAAAGGAAGAAAGG - Intronic
942022494 2:171880712-171880734 ATGGATGACTAGAGGGAGAAAGG - Intronic
942616663 2:177798052-177798074 CTCAATGCAGACAGGGAAAAGGG - Intronic
942758375 2:179368538-179368560 ATAAAGGAAGGGAGGGAGAAAGG + Intergenic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
942911617 2:181251274-181251296 CTGAATGAAGAGAGGAATGCAGG + Intergenic
942945904 2:181672698-181672720 CTGAATGAAGAAAGGAAGACAGG + Intronic
943012479 2:182467129-182467151 ATGAAAGAAGGGAGGGAGAGAGG + Intronic
943079656 2:183242966-183242988 CTGAATGACTAAAGGGAGCACGG + Intergenic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944118426 2:196213661-196213683 CATAGTGAAGACAGGGAGAAAGG + Intronic
944541608 2:200758786-200758808 TTGAATAAAGAGTGGGAGAATGG + Intergenic
944591844 2:201225202-201225224 CTGAATGAAGAGGGAGTGAGGGG - Intronic
944738433 2:202589363-202589385 CTCCATGTAGAGAGGGAGAGGGG + Intergenic
944867010 2:203872173-203872195 AAGAAGGGAGAGAGGGAGAAGGG - Intronic
944993487 2:205266645-205266667 CAGAGTGAAGCAAGGGAGAAAGG - Intronic
945035016 2:205697172-205697194 TTGAATGAGGAGAGGAAGATGGG + Intronic
945505641 2:210637148-210637170 CTAAATTTAGAGAGGGAGAGAGG + Intronic
945653047 2:212588845-212588867 ATGAAGGAAGAAAGGGAGAAAGG + Intergenic
946383825 2:219369281-219369303 GTCAATGAAGAGAGAAAGAAGGG + Intergenic
946640164 2:221775370-221775392 GAGAATGCAGAGAGGGAGAGAGG - Intergenic
946747847 2:222862881-222862903 TTGAAGGAAGAAAGGAAGAATGG + Intronic
946991073 2:225330292-225330314 CTGACTCCAGAGAGGGAGCATGG + Intergenic
948428070 2:237901203-237901225 CTGAAGGAAGACAGCGAGAGAGG - Intronic
948751820 2:240137487-240137509 TTGGAGGAAGAGAGGGAGAGAGG + Intergenic
1169096341 20:2902373-2902395 CTCAATTAAGAAAGGGAGTAGGG - Intronic
1169575686 20:6958200-6958222 CTGACTGAAAAGAAGTAGAAAGG - Intergenic
1169740218 20:8885164-8885186 GTCAAGGAAGACAGGGAGAAAGG - Intronic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170261774 20:14416654-14416676 ATGAAGGAAGAAAGGGAGGAAGG - Intronic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171151941 20:22835014-22835036 GAGAAAGAAGAGAGGAAGAAAGG - Intergenic
1171325280 20:24285872-24285894 ATGAAATAAGAGAGAGAGAAAGG - Intergenic
1171901801 20:30865390-30865412 ATGAAGGAAGAGAGGAAGGAAGG + Intergenic
1172261752 20:33573022-33573044 TTGAATGTTGAGAGGGAGAGGGG + Intronic
1172628559 20:36363087-36363109 CTGAAAGAAGTGAGGGGGTAAGG + Intronic
1172781255 20:37438167-37438189 CTGAATGAAGAGAGGAGCAGGGG - Intergenic
1173140561 20:40478278-40478300 CTGAACACAGAGTGGGAGAATGG - Intergenic
1173201298 20:40957190-40957212 CTGAAGGAAGCGGGAGAGAAGGG + Intergenic
1173431641 20:42992827-42992849 CTACATGAAGAGAGTGAGAGAGG - Intronic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174589463 20:51633853-51633875 GGGAAGGAAGGGAGGGAGAAAGG + Intronic
1174689180 20:52486274-52486296 AAGAAGGAAGAGAGGAAGAAAGG + Intergenic
1174793657 20:53503696-53503718 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1175239779 20:57538547-57538569 CAGAAGGAAGTGAGGGAGCAGGG + Intergenic
1176219261 20:63962295-63962317 AAGAATGAAGTGAAGGAGAAAGG - Exonic
1176292317 21:5052715-5052737 ATGAATGGAGGGAGGGAGAGAGG - Intergenic
1176551059 21:8221972-8221994 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1176569968 21:8404971-8404993 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1176577879 21:8449178-8449200 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1176738827 21:10578737-10578759 CTGAAAGAAGGGAAGGAGAAAGG + Intronic
1177261894 21:18740156-18740178 ATGAATAAAGACAGGAAGAATGG + Intergenic
1177529329 21:22339992-22340014 CTGAAGGAAGAGAGAGACAGTGG + Intergenic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1178340533 21:31782301-31782323 GTGAATGAAGAAAGAGAGAATGG - Intergenic
1178397137 21:32252638-32252660 CTTAGTTAAGTGAGGGAGAAAGG - Intergenic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179864943 21:44210943-44210965 ATGAATGGAGGGAGGGAGAGAGG + Intergenic
1180204942 21:46253992-46254014 CAGGAGGAAGAGAGAGAGAAGGG - Intronic
1180255085 21:46621432-46621454 CTGAATGGATGAAGGGAGAAGGG - Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181368553 22:22398603-22398625 GTGAATGAGAAGGGGGAGAAAGG - Intergenic
1181526909 22:23495076-23495098 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1181686735 22:24534351-24534373 CTGAATGAAGAGGTGTAGGAAGG - Intergenic
1181908733 22:26220829-26220851 ATGAATTGAGAGAAGGAGAAAGG + Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182026553 22:27123707-27123729 CTGAAGAAAGGGAGGCAGAAAGG + Intergenic
1182056239 22:27357434-27357456 CAGGAGGAAGAGAGGGAGAGAGG - Intergenic
1182086701 22:27565778-27565800 CAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182528587 22:30937750-30937772 CTGAATGTAGGGAGAGAGAGAGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182746126 22:32606765-32606787 CTGAATGAAGAGGAGCAGAGAGG - Intronic
1183485382 22:38085376-38085398 CTGTAGGAGGAGAGAGAGAATGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
1183789696 22:40056381-40056403 CTAAGTGATGATAGGGAGAATGG + Intronic
1183951429 22:41355122-41355144 CTGGATGAAGAGTGGAGGAAGGG + Intronic
1184068381 22:42133278-42133300 AGGAAAGAAGACAGGGAGAAAGG - Intergenic
1184409830 22:44320052-44320074 CTGAATGATGGAAGGAAGAAAGG - Intergenic
1184451630 22:44586064-44586086 CAGGATGGAGGGAGGGAGAATGG - Intergenic
1184602642 22:45552685-45552707 CTGAGTGGAGAGAGAGAGAAAGG - Intronic
1184982737 22:48105762-48105784 ATGAAAGGAGGGAGGGAGAAAGG - Intergenic
1184983409 22:48112808-48112830 CGGAAGAGAGAGAGGGAGAAAGG + Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
1185114277 22:48922510-48922532 CTCACTGAAGAGGGGAAGAAAGG + Intergenic
1185151611 22:49167130-49167152 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1203256066 22_KI270733v1_random:138902-138924 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950129029 3:10529138-10529160 GTGACTGATGAGAGGGAGTAGGG + Intronic
950422701 3:12908078-12908100 CTGGAAGAAGAAAGGGAAAATGG + Intronic
950635538 3:14311758-14311780 ATGAAGGAAGGGAGGGAGGAAGG - Intergenic
950903846 3:16520058-16520080 CAGACTGCAGGGAGGGAGAAAGG + Intergenic
951041663 3:17994665-17994687 AGGAATGAAGAGAGTGAGACTGG - Intronic
951111016 3:18804362-18804384 AAGAAGGAAGAGAGAGAGAAAGG - Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951443361 3:22748058-22748080 GTGAATGAACAGAGGATGAAAGG - Intergenic
951482513 3:23176592-23176614 CTAAATGAAAAGAGAAAGAAAGG - Intergenic
951544839 3:23814001-23814023 CTGACTGAAGAAAGGAAGTATGG - Intronic
951650738 3:24948787-24948809 GGGAAGCAAGAGAGGGAGAAGGG - Intergenic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952513050 3:34076332-34076354 CTGAAGGAAGTGAGGGAGTCAGG + Intergenic
952661458 3:35854616-35854638 CTGAATGAAGAGAGAGAAATAGG + Intergenic
952667830 3:35928687-35928709 TTCAATGAATAGAGGGAGACTGG + Intergenic
952752307 3:36834719-36834741 TGGGAGGAAGAGAGGGAGAAAGG + Intronic
952893865 3:38063811-38063833 ATGAAAAAAGAGGGGGAGAAAGG - Intronic
952967538 3:38630544-38630566 CTGAGGGAGGAGAGGGGGAAGGG + Intronic
953020978 3:39112904-39112926 ATAAAAGAAGAAAGGGAGAAGGG - Intronic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
953812498 3:46125512-46125534 CTAAATGAAAAAAGGGGGAATGG - Intergenic
954441346 3:50523956-50523978 CTGATGGCAGAGAGGGAGACAGG - Intergenic
954860225 3:53681941-53681963 CTGAATGAAGCTAGGGTGACAGG + Intronic
954993738 3:54863402-54863424 CTGAAAGCAGGGAGGGAGAGTGG - Intronic
955326879 3:58015458-58015480 TTGAATGAGGAAAGGAAGAAAGG - Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
955506956 3:59641914-59641936 TGGGATGAAGAGACGGAGAAAGG + Intergenic
955519316 3:59759587-59759609 ATGATAGAAGAGAGGCAGAATGG - Intronic
955829386 3:62985075-62985097 CTGAGTGATGAGAGAGAGAGTGG + Intergenic
956166720 3:66402923-66402945 TTGAATGAAGGGAGGGACAGAGG - Intronic
956526071 3:70163490-70163512 ATGAATGAGGAGAGGGGGAAGGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956756532 3:72393406-72393428 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957010052 3:74993986-74994008 TCTAATGAAGAAAGGGAGAAAGG - Intergenic
957253452 3:77805396-77805418 GTGAATAAAGAGAGACAGAAGGG + Intergenic
957416951 3:79917517-79917539 AAGAATGGAGGGAGGGAGAAAGG + Intergenic
957419360 3:79949322-79949344 GTGAATGAAGAGAAGTAGATTGG + Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
958144921 3:89612260-89612282 AGGAAGGAAGAGAGGGAGAGAGG - Intergenic
958175613 3:89992052-89992074 CAGAAGGAAGAGAGAGAGAAAGG - Intergenic
958601360 3:96300012-96300034 CTTAAGTCAGAGAGGGAGAAAGG - Intergenic
958735701 3:98007231-98007253 CTGACTGAAATGAGGGAGAAGGG + Intronic
958955666 3:100463655-100463677 ATGAATGAAATGAGGGAAAAGGG + Intergenic
959168332 3:102810834-102810856 CTGAATGAATATTTGGAGAAGGG + Intergenic
959183961 3:103020183-103020205 CTGAATTAAGTCAGGGAAAAAGG + Intergenic
959216641 3:103458565-103458587 CTCAATGAAGACAGAGAGAGAGG - Intergenic
959282206 3:104358680-104358702 AAGAAGGAAGAGAGGGAGAGAGG - Intergenic
959568985 3:107861761-107861783 GGGAAGGAAGAAAGGGAGAAAGG - Intergenic
960155430 3:114293202-114293224 ATGAATGAAGGGAGGGAGGGAGG + Intronic
960315749 3:116174609-116174631 CTGGTTGAAGTGAAGGAGAAGGG - Intronic
960443826 3:117722763-117722785 AGGAAAGAAGAGAGGGAGACAGG - Intergenic
960633339 3:119755509-119755531 ATGGAGGAAGAGAGGGAGAAAGG - Intronic
960656518 3:120010404-120010426 CTAAATGAAGAGATCCAGAAAGG + Intronic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
961261632 3:125606592-125606614 TTTAAAGCAGAGAGGGAGAAAGG - Intergenic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
961722612 3:128906729-128906751 GTGAATGAAGAGAGAGTGAAGGG + Intronic
962042660 3:131723367-131723389 ATGAAGGAAGAGAGGGAAAGGGG + Intronic
962206330 3:133437631-133437653 AAGAAAGAAGAGAGAGAGAAAGG + Intronic
962229418 3:133648467-133648489 ATGAGTGGAGAGAGGGAGCAGGG + Intronic
962230735 3:133663247-133663269 CTGAATTAGGAGAGAGAGAGTGG - Intergenic
962304852 3:134277004-134277026 CTGAAGGAATACAGTGAGAATGG + Intergenic
962309886 3:134317922-134317944 TTAAAAAAAGAGAGGGAGAAAGG - Intergenic
962451866 3:135526051-135526073 ATGAATGGAGAGAGAGAGACTGG + Intergenic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
962710755 3:138083765-138083787 TCGAATGAAGATGGGGAGAAGGG + Intronic
963115247 3:141723390-141723412 CTGAATGGAGTGAGCTAGAATGG + Intergenic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963386979 3:144610002-144610024 TTAAAGGAAGAGAGGGAGGAAGG - Intergenic
963390912 3:144663110-144663132 AGGAATGAAGAAAGGAAGAAAGG - Intergenic
963844026 3:150136766-150136788 TTGAAAGAAGAAAGGCAGAAAGG - Intergenic
963923333 3:150926032-150926054 CTGCGAGAAGAGAGGGAGACCGG + Intronic
964003589 3:151806187-151806209 AGGAAAGGAGAGAGGGAGAAAGG - Intergenic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
964322439 3:155512203-155512225 CTACATAAAGAGAGTGAGAATGG - Intronic
964953115 3:162322069-162322091 ATGAAAGAGGAGAGGGAGACAGG + Intergenic
965978504 3:174656978-174657000 AGGAAGGAAGGGAGGGAGAAGGG - Intronic
966063336 3:175786426-175786448 ATGAATGAAATGAAGGAGAAGGG - Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966221233 3:177553169-177553191 AGGAATGAAGGGAGGCAGAATGG - Intergenic
966336764 3:178876730-178876752 ATGAATGGAGGGAGGAAGAAAGG + Intergenic
966385144 3:179388218-179388240 CTGAATGAATAGAGGTAGCCTGG + Intronic
966462948 3:180197825-180197847 ATGAAGGAAGAAAGGAAGAAGGG + Intergenic
966547358 3:181165514-181165536 CAGAAGGAAAAGAGAGAGAAAGG - Intergenic
966585908 3:181624227-181624249 GAGAAGGAAGAGAGGGAGAGCGG - Intergenic
967021012 3:185522532-185522554 AGGAAGGAAGAGAGGAAGAAAGG + Intronic
967038259 3:185664496-185664518 GTGAATTAATGGAGGGAGAAGGG + Intronic
967135859 3:186512107-186512129 CCAGATGAAGAGAGGGAGAGAGG + Intergenic
967343087 3:188422727-188422749 CTGAATGAAGACAGAGAAAAGGG - Intronic
967391611 3:188961735-188961757 TGGAAGGAAGGGAGGGAGAAGGG - Intronic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968190376 3:196662900-196662922 GTCATTGAACAGAGGGAGAAGGG - Intronic
968241396 3:197089935-197089957 CAGAAAGAAGAAAGTGAGAAAGG + Intronic
968446888 4:656710-656732 CCAAATGCAGAGAGGGAGAGAGG + Intronic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
970566206 4:17334724-17334746 CGGGAGGAAGAGAGAGAGAATGG - Intergenic
970770038 4:19601489-19601511 CAGAAGGAAGGGAGGGTGAAAGG - Intergenic
971954867 4:33403557-33403579 CTGGAGAAAGAGAGGAAGAAAGG - Intergenic
972004527 4:34083160-34083182 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
972054926 4:34789556-34789578 TGTAATGAAGAGAGTGAGAAGGG + Intergenic
972736242 4:41844431-41844453 CTAAAGCAAGACAGGGAGAATGG - Intergenic
972785915 4:42326714-42326736 ATGAATGAAGGAAGGAAGAAAGG + Intergenic
972910335 4:43808434-43808456 ATGAATGTAGAGAGGGAGGGAGG + Intergenic
972996872 4:44891313-44891335 CTAAAGGAAGACAGGGAGGAAGG - Intergenic
973213581 4:47643763-47643785 CTTAAAGAAAGGAGGGAGAAAGG - Intronic
973831896 4:54769908-54769930 CTAGATGGAGAGTGGGAGAATGG - Intergenic
973865034 4:55104107-55104129 CTGCATGAAGAGTGGGATGATGG - Intronic
974022984 4:56708017-56708039 GAGAAGGAAGAGAGGAAGAAGGG + Intergenic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
974682709 4:65183771-65183793 CTAAAGGAAGGGAGGGAGAGAGG - Intergenic
975110152 4:70614362-70614384 ATGAAGTAAGAGAGGGAGAAGGG + Intergenic
975455460 4:74585119-74585141 GGGAGAGAAGAGAGGGAGAATGG + Intergenic
975955095 4:79827404-79827426 CTGATTGAAGATAAGGAGATTGG + Intergenic
975962178 4:79924139-79924161 CCAAAAGAAGAGAGGGAGAGAGG - Intronic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976341455 4:83950086-83950108 CTAAATGAAGATAGGAGGAAAGG + Intergenic
976874191 4:89834689-89834711 GAGAAAGAAGAGAGGAAGAATGG + Intronic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
976909256 4:90280315-90280337 AAGAAGGAAGGGAGGGAGAAAGG - Intronic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977970308 4:103205596-103205618 ATCAATGAAGAAAAGGAGAAAGG - Intergenic
978056326 4:104272511-104272533 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
978165011 4:105596482-105596504 CTGAAAGGAGACAGGGAGGAGGG + Intronic
978181985 4:105809429-105809451 CTGAATAAAGTGAGAGAGTAAGG - Intronic
978231867 4:106409608-106409630 GGGAAGGAAGAGAGGGAGAGAGG - Intergenic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
978601612 4:110434005-110434027 CTAAAAGGAGAGAGGGAGAGGGG - Intronic
978607805 4:110501427-110501449 TTGAAAGTAGAGAGGGAGGAGGG - Intronic
978747139 4:112207685-112207707 TTTAATTCAGAGAGGGAGAAGGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978792570 4:112678046-112678068 CTAAATGAAGTGATGGAGCAAGG - Intergenic
979101094 4:116615462-116615484 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
979211036 4:118103392-118103414 CAGAATTGAGAGAGGAAGAAGGG + Intronic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979531146 4:121770232-121770254 AGGAAGGGAGAGAGGGAGAAAGG + Intergenic
979588287 4:122446706-122446728 AAGAATGAAGAGAGGAATAAAGG - Intergenic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
979819216 4:125150461-125150483 CTGAAGGTTGACAGGGAGAATGG - Intergenic
979982931 4:127278377-127278399 CTGAATGAAGAAAGGAAATAAGG - Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
980884057 4:138743014-138743036 ATGAAAGAGGTGAGGGAGAAGGG - Intergenic
981015475 4:139969442-139969464 CTGAAAGAAGAAAGAGAGAGAGG - Intronic
981111911 4:140944458-140944480 CTGGATGAAGAAAGGATGAAGGG + Intronic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
981912259 4:149995422-149995444 CGGAAGGAAGGGAGGGAGGAAGG + Intergenic
982083435 4:151811929-151811951 AGGAAGGAAGAGAGGGAGAGAGG - Intergenic
982113853 4:152080647-152080669 CTAAATAAAGAAAGAGAGAAAGG + Intergenic
982118499 4:152117174-152117196 CTGAGTGAAGCCAGGGAGCACGG - Intergenic
982718519 4:158835440-158835462 CAGAATGAAGACAGGGACAGTGG + Exonic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982785967 4:159537389-159537411 CTGAAGCAAGTCAGGGAGAAAGG + Intergenic
982929303 4:161382269-161382291 CAGAATGAAGACATGGATAAGGG - Intergenic
983156851 4:164358570-164358592 CAGAATGAAGAGAAAGTGAAAGG + Intronic
983481642 4:168281418-168281440 CTCAATCAAGAGAGGAGGAATGG - Intronic
983732697 4:171015675-171015697 ATGGACGAAGAAAGGGAGAAAGG + Intergenic
983794107 4:171838501-171838523 CTGGATGGAGAGAGAGTGAAGGG - Intronic
983830332 4:172318755-172318777 CTGAATGAGGACAAGGATAAGGG + Intronic
983932612 4:173469729-173469751 CTGAAGGATGAGTGGGAGGATGG - Intergenic
984315868 4:178130377-178130399 TAGAATGAAGACATGGAGAAGGG + Intergenic
985637093 5:1041447-1041469 GTGAATGATGAGTGGGTGAATGG + Intergenic
985850338 5:2383899-2383921 CTGAACGCAGACAGGGAGAGAGG - Intergenic
985869659 5:2544255-2544277 CTTAATGAAGGGTGGGATAATGG + Intergenic
986014446 5:3745940-3745962 CAGAAAGAAGAGTGCGAGAAGGG + Intergenic
986203005 5:5596292-5596314 CAGAAGGCAAAGAGGGAGAAAGG - Intergenic
986659676 5:10047780-10047802 CTGAATGATGAGCTGGATAATGG + Intergenic
986932176 5:12839318-12839340 ATGAAGGAAGATAGGAAGAAAGG + Intergenic
987347861 5:16994567-16994589 CTGACAGCTGAGAGGGAGAAAGG + Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
987779370 5:22413903-22413925 ATGTATAAAGAGAGAGAGAAAGG - Intronic
987854702 5:23405157-23405179 ATATATGAAGAGAGAGAGAAAGG + Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988941971 5:36156074-36156096 CTGAAGGGAGAGAGAAAGAATGG + Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
989270471 5:39527084-39527106 CTGAAGGAAGTGGCGGAGAAAGG + Intergenic
990096464 5:52120425-52120447 AGGAAGGAAGAGAGGGAGAGAGG - Intergenic
990454873 5:55975318-55975340 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
990578695 5:57148376-57148398 GAGAAGGAAGAGAGAGAGAAGGG - Intergenic
990864807 5:60368773-60368795 CAGGAAGAAGAGAGAGAGAAGGG - Intronic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
991405419 5:66296462-66296484 AGGAATGAAGAGATGGAGCATGG - Intergenic
991429577 5:66530368-66530390 AGGAAGGATGAGAGGGAGAAAGG - Intergenic
991457324 5:66818260-66818282 TTGAACTAAGAGACGGAGAAAGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991925342 5:71699861-71699883 CTGAAAGAATAGAATGAGAAGGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
992613788 5:78530973-78530995 GTTAATGAAGAAGGGGAGAATGG - Intronic
992687041 5:79209215-79209237 CTGAAATGAGAGAGAGAGAAGGG + Intronic
993184509 5:84600428-84600450 CTGAATGAAGAGCTGGAAATGGG + Intergenic
993312786 5:86357669-86357691 CTGCATGAAAAGAGGGAGAGTGG - Intergenic
993364398 5:87018969-87018991 CTCCATGTAGAGAGGGAGAAGGG + Intergenic
993832094 5:92772580-92772602 GTAAATCAAGAGAGGGAAAAAGG + Intergenic
994030471 5:95136158-95136180 AAGGTTGAAGAGAGGGAGAAGGG - Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994143900 5:96371473-96371495 CTGGAAGAAGAAAGGAAGAAAGG - Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
995195955 5:109368722-109368744 CTGAATGCAGTGATGGGGAATGG - Exonic
995559579 5:113365817-113365839 CAGAAGGAAGAGAGAGAGCAGGG + Intronic
996606643 5:125330618-125330640 CTGGATGTAAAGTGGGAGAAGGG + Intergenic
997150783 5:131492655-131492677 CTTAATGGAGGGAGTGAGAAGGG - Exonic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997577654 5:134994986-134995008 ATGAAGGAAGGGAGGGAGGAAGG - Intronic
997652234 5:135530929-135530951 CTGGATGAAGACAGGGAGTGGGG - Intergenic
997721843 5:136084330-136084352 GTGAAAGGAGAGAGGGAGCAAGG + Intergenic
997817561 5:137033587-137033609 GTGAATGAGGTGAGGGAGAGGGG - Intronic
998378189 5:141705256-141705278 CTGAAAGAAGTGAGGGAGTGAGG - Intergenic
998389833 5:141780349-141780371 AGGAAGGAAGGGAGGGAGAAGGG - Intergenic
998444691 5:142189482-142189504 CTGAATGAAGTGACAGAGGAAGG - Intergenic
998472791 5:142396326-142396348 CTGAAATAGGAGAGGCAGAAGGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999050234 5:148515907-148515929 TTGAATTCAGAGAGAGAGAATGG - Intronic
999090519 5:148931990-148932012 CAGAAAGAAGAGAGAGTGAAAGG - Intronic
999131333 5:149285654-149285676 CTGAACTAAGAGAGGCAGATAGG - Intronic
999360064 5:150976695-150976717 CAGAATTAAGAAAGTGAGAAGGG + Intergenic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999866401 5:155705103-155705125 GTGGAAGAAGAAAGGGAGAATGG - Intergenic
999960747 5:156753269-156753291 CTCACTGAAGAGATGCAGAAAGG - Intronic
1000038349 5:157466044-157466066 GGGAAGGAAGAGAGAGAGAAAGG + Intronic
1000115351 5:158148866-158148888 AGGAATGGAGGGAGGGAGAAAGG - Intergenic
1000222896 5:159231221-159231243 CTGAATGAGGAGTTGGGGAAAGG - Intergenic
1000254173 5:159521893-159521915 CTGAAACAAGAGTGGGAGGAAGG - Intergenic
1000684064 5:164224949-164224971 CTGATTGGAGAGATGCAGAAAGG - Intergenic
1001284562 5:170413086-170413108 GTGAATGAAGGAAGGGAGGAAGG + Intronic
1001633303 5:173192482-173192504 ATGAATGAAGGGAGGGGGAAGGG + Intergenic
1001708367 5:173758478-173758500 TTTAACTAAGAGAGGGAGAAGGG + Intergenic
1001711682 5:173783974-173783996 AGGAAGGAAGAGAGAGAGAAAGG + Intergenic
1001948453 5:175798973-175798995 CAGAATGAATTGAGGTAGAAAGG - Intronic
1002035635 5:176467221-176467243 CTGAAAGATTAGAGAGAGAAGGG + Intronic
1003270569 6:4604195-4604217 AAGAAAGAAGAGAGAGAGAAAGG - Intergenic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1003403364 6:5809100-5809122 CTGATGGAAGGGAAGGAGAAGGG - Intergenic
1003435926 6:6088021-6088043 GAGAAGAAAGAGAGGGAGAAGGG + Intergenic
1003464224 6:6363046-6363068 CTGCATGAAGAGTTTGAGAAAGG - Intergenic
1003667013 6:8120883-8120905 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1003704122 6:8505438-8505460 TTAAAAGAAGAGATGGAGAATGG + Intergenic
1003790886 6:9546179-9546201 CTGTATGAAGAGAATGTGAAAGG + Intergenic
1003888229 6:10540134-10540156 AGGAAGGAAGAGAGGGAGAGAGG + Intronic
1003891748 6:10569920-10569942 AGGAAGGAAGAGAGAGAGAAAGG - Intronic
1003973413 6:11321059-11321081 GAGAATGAAGGGAGGGAGATAGG + Intronic
1004311421 6:14549283-14549305 CTGAATGAAGACAAGGAACAGGG + Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004751294 6:18565428-18565450 AGGAAGGAAGAAAGGGAGAAAGG - Intergenic
1004903924 6:20218948-20218970 GTGACTGAGGAGAGAGAGAAAGG + Intergenic
1005078149 6:21928774-21928796 CAGAATGAGGAGAGGTAAAATGG - Intergenic
1005205097 6:23393746-23393768 GGGAGGGAAGAGAGGGAGAAAGG + Intergenic
1005217123 6:23543490-23543512 CAGAAGGAAGAGAGAGTGAAGGG - Intergenic
1006236614 6:32638889-32638911 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006246581 6:32742464-32742486 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006443669 6:34067337-34067359 AGGAAGGAAGAGAGGAAGAAAGG - Intronic
1006865195 6:37203747-37203769 ATGAATGATGTGATGGAGAATGG - Intergenic
1007377426 6:41466458-41466480 GGGGATGAAGAGAGGGAGATAGG + Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1007717136 6:43863969-43863991 CAGAAGGGAGGGAGGGAGAAGGG - Intergenic
1007916905 6:45569531-45569553 CTGGATGGAGGGAGGGAGACTGG + Intronic
1008418629 6:51271797-51271819 AGGAAAGAAGAGAGGAAGAAAGG + Intergenic
1009447824 6:63763990-63764012 GGGAAGGAAGAAAGGGAGAAAGG - Intronic
1009593641 6:65708428-65708450 AGAAAGGAAGAGAGGGAGAAAGG - Intergenic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1009726340 6:67540575-67540597 ATGAAAGAGGAGAGAGAGAATGG + Intergenic
1009880388 6:69559946-69559968 AGGAATGAAAAGAGGAAGAAAGG - Intergenic
1009882376 6:69584388-69584410 AAGAAAGAAGGGAGGGAGAAAGG + Intergenic
1010136114 6:72555255-72555277 CCGACTGAAGAGAGGGAGAAAGG - Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1011255557 6:85417267-85417289 GAGAAAGAACAGAGGGAGAAGGG + Intergenic
1011847461 6:91584199-91584221 AAGAAGGAAGAGAGGGAGGAAGG + Intergenic
1012512745 6:100023046-100023068 CTGAGTGAAGAGGGAGGGAAGGG + Intergenic
1013503760 6:110778670-110778692 CCTAAGGAAGAAAGGGAGAATGG - Intronic
1013763372 6:113545088-113545110 CAAGATGAAGAGAGCGAGAAGGG - Intergenic
1014177768 6:118349012-118349034 CAGAAGGAAGAGAGGGAGAGAGG - Intergenic
1014218867 6:118780194-118780216 CTAAATGAAGAAGGGGAGGATGG - Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014905323 6:127019521-127019543 CTAAAAGAAGAGAGAGAGATGGG - Intergenic
1014911402 6:127097791-127097813 CGGAGTGGAGAGAGGAAGAATGG + Intergenic
1015208654 6:130671030-130671052 ATGAAAGAAGGGAGGGAGGAAGG + Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015214241 6:130731699-130731721 GTGGATGAAGAGTGAGAGAAAGG - Intergenic
1015270177 6:131329661-131329683 AAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1015367518 6:132413787-132413809 TTGGAGGAAGAGAGGGAGAGAGG - Intergenic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1015902891 6:138085604-138085626 CTGCTTGAAGACAGGGAGACTGG - Intergenic
1015972684 6:138758579-138758601 CAGAAGGGAGAGAGGGAGCAGGG - Intronic
1016082663 6:139875129-139875151 AGGAATGGAAAGAGGGAGAAAGG - Intergenic
1016223054 6:141699318-141699340 CTGAAGGAGGAGAGTGGGAAGGG + Intergenic
1016279494 6:142399150-142399172 CTGAGTGTAGAGAAGGCGAAGGG - Intronic
1016598200 6:145825386-145825408 GTGCATGAAGAGAAGAAGAACGG + Intergenic
1016747922 6:147600615-147600637 CTAAATGAGGAGAGGGAGAGTGG - Intronic
1016925761 6:149346104-149346126 ATAGATGAAGAGAGGGAGGAAGG + Intronic
1017488493 6:154923866-154923888 CTGAACAAAGGGAGGGGGAAGGG - Intronic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1017996755 6:159538296-159538318 AAGAAAGAAGAGAGAGAGAAAGG + Intergenic
1018334857 6:162776333-162776355 CTGAATGAGGACAGGCAGATGGG - Intronic
1018911486 6:168102843-168102865 CAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1019207465 6:170374684-170374706 CTGAGTGAAGGGAAGAAGAAAGG - Intronic
1019789629 7:3002660-3002682 CGGGAGGAAGAGAGAGAGAAGGG + Intronic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1020484716 7:8706895-8706917 CAGAATGGTGAGAGTGAGAAGGG + Intronic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1021968844 7:25948743-25948765 CTGATGGAAAAGTGGGAGAATGG + Intergenic
1022036691 7:26541410-26541432 CTGATTGAAAAGAGGGGAAAAGG + Intergenic
1022202034 7:28126408-28126430 CTTAATGAGGAGAGGGGGATGGG + Intronic
1022221770 7:28320913-28320935 CGTAATGCAGAGAGGCAGAATGG + Intronic
1022384989 7:29891501-29891523 CTGAGTTGAGAGAGAGAGAAAGG + Intronic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1022516515 7:30978192-30978214 AGGAATAAAGAGAGGGAGAGTGG - Intronic
1022636814 7:32144006-32144028 CTGAATTGAGAGATGGAGATGGG + Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023194726 7:37622594-37622616 CTGACTGAAGACAGGCAGAGTGG - Intergenic
1023475782 7:40576356-40576378 GTGAAAGAAGAAAGGGAAAAAGG + Intronic
1024011943 7:45274750-45274772 AGGAAAGAAGAGAGGAAGAAAGG - Intergenic
1024369428 7:48563346-48563368 CTGAAGAAAGAGAGGGTTAAAGG + Intronic
1024657008 7:51459425-51459447 CTGAATGAACAGACGCAGACTGG - Intergenic
1025115665 7:56255910-56255932 CTGAATGACAAGAGTGAAAAGGG + Intergenic
1025625143 7:63214541-63214563 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1026064016 7:67053345-67053367 CCAAATGAAAAGAGGGAGAGAGG - Intronic
1026177713 7:68012602-68012624 CTCAAAGAAGAAGGGGAGAATGG + Intergenic
1026714332 7:72774099-72774121 CCAAATGAAAAGAGGGAGAGAGG + Intronic
1028215831 7:88132098-88132120 TGGAAGGAAGGGAGGGAGAATGG - Intronic
1028266894 7:88736830-88736852 ATGAAGGAAGAGAGAAAGAAAGG + Intergenic
1029042742 7:97594803-97594825 CAGAAAGAAGAGGAGGAGAAAGG - Intergenic
1029633764 7:101770067-101770089 AGGAAGGAAGAGAGAGAGAAAGG - Intergenic
1029704460 7:102268786-102268808 CAGGAGGAAGAGAGAGAGAATGG + Intronic
1029856024 7:103517789-103517811 AGGAAGGAAGAAAGGGAGAATGG - Intronic
1030085749 7:105813995-105814017 ATGGAGGAAGAGAGGAAGAAAGG - Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1030488413 7:110200931-110200953 CTGAATGAATAGTGAGTGAATGG - Intergenic
1030623883 7:111822309-111822331 CTCAATGTATAGAGGAAGAAGGG - Intronic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1031982853 7:128139970-128139992 GTGGTAGAAGAGAGGGAGAAGGG - Intergenic
1032034950 7:128514788-128514810 CTTAAGGAAGAAAGGAAGAAAGG - Intergenic
1032625124 7:133583689-133583711 CTGAAGGGAGAGATGGGGAAAGG + Intronic
1032685723 7:134231711-134231733 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1032685732 7:134231743-134231765 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1032983904 7:137316292-137316314 ATGAATGGAGAGACTGAGAATGG - Intronic
1033441137 7:141379792-141379814 CATAATGAAGAAAGGAAGAAAGG - Intronic
1033584461 7:142763749-142763771 CTGTATGAAGAGAGAGAAAGAGG - Intronic
1033585353 7:142770758-142770780 CTGAGAGCAGAGAGGGAGACCGG - Intergenic
1033810817 7:145008717-145008739 GTGAGTGAAGAGAGGTAGACAGG - Intergenic
1033883428 7:145915929-145915951 CTAAAGGAAGAAAGGGAGAATGG + Intergenic
1034434314 7:151055849-151055871 CTGGGAGGAGAGAGGGAGAAGGG + Intronic
1034727695 7:153354246-153354268 CGGGAAGAAGAGAGGGTGAAAGG - Intergenic
1035110787 7:156479912-156479934 AAGAAGGAAGAGAGAGAGAAGGG + Intergenic
1035218004 7:157384613-157384635 CTGCATGAGGAGAGGGGGAGGGG + Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1037152340 8:15652855-15652877 CTAAATGAAGACAGGGAGTTGGG + Intronic
1037385328 8:18333819-18333841 CTGTAGGACGAGAGAGAGAATGG + Intergenic
1037434695 8:18850323-18850345 CTGAAAGGAGCCAGGGAGAAAGG - Intronic
1037480886 8:19304074-19304096 CAGGATGAAGAGAGAGAGAGTGG + Intergenic
1037672661 8:21028623-21028645 CAGAAAGGAAAGAGGGAGAAGGG + Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037747924 8:21661577-21661599 CAGAAGGAAGAAAGGAAGAAAGG + Intergenic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1038662766 8:29511468-29511490 CAGAATGAAGGGAAAGAGAAAGG + Intergenic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1039118565 8:34119967-34119989 GAGAAAGAAGAGAAGGAGAAGGG - Intergenic
1039314561 8:36356828-36356850 ATGAATGAAGGAAGGGAGGAAGG + Intergenic
1039343998 8:36683965-36683987 CTTTAGGAAGAGTGGGAGAAAGG - Intergenic
1039373064 8:37006147-37006169 TTGAATGAAGAGAGGTAAGAAGG + Intergenic
1039466064 8:37786309-37786331 CTGGATGTGGAGAGGGGGAAAGG + Intronic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039777097 8:40747500-40747522 GAGAAAGAAGGGAGGGAGAAAGG - Intronic
1040349456 8:46549675-46549697 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1040680275 8:49800877-49800899 CAGAAAGAGGAGTGGGAGAAAGG - Intergenic
1040790636 8:51224977-51224999 CCGGAAGAAGAGAGAGAGAAAGG + Intergenic
1040877091 8:52165336-52165358 CTGAATAGAGAGAGAGAGCATGG - Intronic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041630926 8:60086187-60086209 GTGAATGAAGGGAGGAAGAAGGG + Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042421003 8:68589550-68589572 ATGAAGGAAGGGAGAGAGAAAGG + Intronic
1042725749 8:71874814-71874836 CAGAAGGAAGAAAGAGAGAAGGG - Intronic
1043094248 8:75946435-75946457 AGGAAGGAAGAGAGGGAGAGAGG - Intergenic
1043247417 8:78022474-78022496 GTTAATGAAGAGAGGAAGAATGG - Intergenic
1043331399 8:79122221-79122243 CTGACTGAGGAAAGGGTGAAGGG - Intergenic
1043465241 8:80499581-80499603 CTAAATGAACAGAGAAAGAAAGG + Exonic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1044265724 8:90179051-90179073 CTACATTAAGAGAGGTAGAAAGG - Intergenic
1044342308 8:91060591-91060613 AGGAAGGAAGAGAGGGAGAGAGG - Intergenic
1044822156 8:96161667-96161689 GGGAAAGAAGAGAGGGAAAATGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045487133 8:102640458-102640480 CCGAATGAAGGGAGGAAGGAAGG + Intergenic
1045511800 8:102817367-102817389 ATGAAGGAAGGGAGGGAGAGAGG + Intergenic
1046150218 8:110213741-110213763 CAAAATGAAGACAGGAAGAAAGG + Intergenic
1046600377 8:116310001-116310023 CTTCATGAAGAGAGTAAGAAGGG - Intergenic
1046783761 8:118243869-118243891 CTGCATGAAGAGAGAGAAAATGG + Intronic
1046792455 8:118336414-118336436 CTTAATGAATTGAGGAAGAAAGG + Intronic
1047023613 8:120804227-120804249 AGGAATAAAGGGAGGGAGAAAGG - Intronic
1047030644 8:120875828-120875850 GGGAAAGGAGAGAGGGAGAAAGG - Intergenic
1047184535 8:122620056-122620078 CAGAATGAAAGAAGGGAGAAGGG - Intergenic
1047222725 8:122931397-122931419 CGGAAAGAAGAGAGAGAGAGAGG + Intronic
1047322261 8:123797808-123797830 CTGGATGGAGAGAGGAAGTACGG + Intronic
1047411851 8:124630402-124630424 CTGAAAGAGGAGGTGGAGAAAGG + Intronic
1047614948 8:126556376-126556398 AGGGAGGAAGAGAGGGAGAAAGG + Exonic
1047622999 8:126627180-126627202 CTAAAGGAAGAGGGGAAGAATGG + Intergenic
1047691590 8:127360379-127360401 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1047785566 8:128151024-128151046 CAGAATGAAAAGAGAGGGAAAGG - Intergenic
1047873069 8:129106446-129106468 CTGACTGAAGTGAGGGAACAAGG - Intergenic
1047904521 8:129459185-129459207 ATGAATGAAGGAAGGAAGAAAGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048053956 8:130846487-130846509 AAGAAGGAAGAGAGGGAGGAAGG - Intronic
1048236486 8:132695842-132695864 ATGAATGAAGAGAGATACAAGGG + Intronic
1048332475 8:133480079-133480101 GAGAAAGAAGAGAGGGAGCAGGG + Intronic
1048366370 8:133742350-133742372 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049870719 8:144973370-144973392 CTGTATGAAAAGAGGGGCAAAGG - Intergenic
1050273403 9:3970951-3970973 TGGAAGGAAAAGAGGGAGAAAGG + Intronic
1050390152 9:5134224-5134246 CTGAAAGTTGACAGGGAGAATGG + Intronic
1050535442 9:6626785-6626807 GTGACTGAAGGGAGGGAGATGGG - Intronic
1050731887 9:8718092-8718114 GTGAAGTAAGAAAGGGAGAAGGG + Intronic
1050876205 9:10640065-10640087 CAGAAGGAAGAGAGAGAGAAGGG + Intergenic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1052193080 9:25680062-25680084 AGGGATGAAGAGAGGGAGAAAGG + Intergenic
1052231047 9:26153365-26153387 AGGAAAGAAGAGAGGGAGGAAGG + Intergenic
1052584157 9:30403168-30403190 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1052901055 9:33795342-33795364 CTGAGAGCAGAGAGGGAGACTGG - Intronic
1053036487 9:34831158-34831180 CACAATGAAGAGATGTAGAAGGG + Intergenic
1053051315 9:34963022-34963044 CTGAATGAAGAGAGGTGGGGAGG + Intronic
1053284294 9:36840411-36840433 CTGGAGGAAGAGAGGAAGAGGGG + Exonic
1053442150 9:38125504-38125526 TGGAAAGAAAAGAGGGAGAAGGG - Intergenic
1053450714 9:38192094-38192116 CTGGATGAAGAGAGTGAGTGTGG + Intergenic
1053730826 9:41055155-41055177 CTGAAGGAAGAAAGGAAGGAAGG + Intergenic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1054885194 9:70189678-70189700 CAAAAGGAAGAGAGAGAGAAAGG - Intronic
1054966835 9:71038475-71038497 AGGAAAGAAGAGAGGGAGAAAGG - Intronic
1055149919 9:72984568-72984590 CCAAATGAAGAGAGAGAGAGAGG - Intronic
1056075171 9:83030917-83030939 GAGAGTGAAAAGAGGGAGAAAGG - Intronic
1056108541 9:83371856-83371878 AGGGAGGAAGAGAGGGAGAAAGG + Intronic
1056189824 9:84173805-84173827 AGGAAGGAAGAGAGGGAGAGGGG + Intergenic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1056545317 9:87608013-87608035 CAGGAGGAAGAGAGAGAGAAGGG + Intronic
1056634233 9:88318380-88318402 AAGGATGAAGAGAGGGAAAAAGG + Intergenic
1057009937 9:91591725-91591747 AGGAAGGAAGAAAGGGAGAAGGG - Intronic
1057189724 9:93079953-93079975 GTGTATTAAGAGAGAGAGAAAGG - Intronic
1057697045 9:97330615-97330637 CTGAATGAGGAGAATGTGAAGGG + Exonic
1057868798 9:98702364-98702386 CTGAATGGAGACAGGGAGGCAGG - Intronic
1058167817 9:101640103-101640125 CTGAAGGAGGCGGGGGAGAAGGG - Intronic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1058927020 9:109676386-109676408 CTTAATGAAGATAGGGAACATGG + Intronic
1059262896 9:112995536-112995558 AGGAATGGAGAGAGAGAGAAAGG - Intergenic
1059295922 9:113270626-113270648 TTGAATGAAGACTGGAAGAAAGG + Intronic
1059444682 9:114330823-114330845 CTGAATGTCCAGCGGGAGAATGG + Exonic
1059582460 9:115566663-115566685 ATGAATGAAGGAAGGAAGAAAGG - Intergenic
1059960627 9:119560846-119560868 TTGAAACAAGAGAGGAAGAAAGG - Intergenic
1060150275 9:121284039-121284061 CTGAAAGAAGTGAGGGAGGCTGG + Intronic
1060400465 9:123345955-123345977 AGGAAGGAAGAGAGGGAGAGAGG + Intergenic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1062437226 9:136551649-136551671 ACGAAAGAAGAGAGGGAGAGAGG - Intergenic
1203472226 Un_GL000220v1:120615-120637 ATGAATGAAGGAAGGGAGGAAGG - Intergenic
1185574932 X:1163750-1163772 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1185632793 X:1527737-1527759 GTGAATGAAGAGTGGATGAATGG - Intronic
1185774087 X:2788077-2788099 CTGTCTCAAGAGAGAGAGAAAGG + Intronic
1186011184 X:5134923-5134945 GTGAAGGAAAAGAAGGAGAATGG + Intergenic
1186084683 X:5974147-5974169 CTGAATGAAGGGGTGGGGAATGG + Intronic
1186096014 X:6102609-6102631 CTGAACTAAGAGAGAGAGAGAGG + Intronic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1186239989 X:7555409-7555431 AGGAAGGAAGAGAGGAAGAAGGG + Intergenic
1186363965 X:8872496-8872518 CTTTGTGAAGAGAGGCAGAAGGG + Intergenic
1187094490 X:16132118-16132140 ATGCATGAAGAGAGGAATAAAGG + Intronic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187228007 X:17392659-17392681 ATATATGAAGAGAGAGAGAAAGG - Intronic
1187444219 X:19346198-19346220 CTCCATGAAGGGAGGGAGAAGGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1187543592 X:20224820-20224842 CGGCATGAAGAGAGGGTGAGAGG + Intronic
1187547350 X:20266903-20266925 CGGAAGGAGGAGAGGAAGAAAGG - Intronic
1187696141 X:21922986-21923008 ATGAAGGAAGGAAGGGAGAAAGG + Intergenic
1188050850 X:25483944-25483966 TTTAATGATGAGAGGGAGGAGGG + Intergenic
1188402424 X:29762531-29762553 CAAAAGGAAGAGAGGGAGAGAGG + Intronic
1188963861 X:36526809-36526831 CAGAAGGAAGAGAGAGAGAGAGG + Intergenic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189220106 X:39364271-39364293 CAGGAGGAAGAGAGAGAGAATGG - Intergenic
1189429345 X:40933152-40933174 CTGAAGGGAAAGGGGGAGAAGGG - Intergenic
1189432376 X:40959057-40959079 TAGAATGCTGAGAGGGAGAATGG - Intergenic
1190503560 X:51102862-51102884 CTTCATAATGAGAGGGAGAATGG + Intergenic
1191056503 X:56246746-56246768 CTGGCTGAAGATAGGGAGAGAGG + Intronic
1191734550 X:64375474-64375496 AGGAATGAAGAGAGGTGGAATGG + Intronic
1191873468 X:65770046-65770068 CAGGATGAAGAAAGGGTGAAGGG - Intergenic
1192399587 X:70821473-70821495 CAGAAGGAAGAGAGAGTGAAGGG - Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1193732490 X:85117564-85117586 AGGAAGGAAGAGAGAGAGAAAGG + Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1193763980 X:85503171-85503193 GGAAATGAAGAAAGGGAGAAAGG - Intergenic
1194100497 X:89697336-89697358 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1194771960 X:97916780-97916802 CTGAATAATGACAGGGAGAATGG + Intergenic
1195405724 X:104511087-104511109 TTGAATGATGAGAAGGAGACAGG - Intergenic
1195686208 X:107588685-107588707 CTGCAAGGAGACAGGGAGAATGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196027961 X:111062630-111062652 TTGCAAGAAGAGAGGAAGAAAGG + Intronic
1196047083 X:111267710-111267732 CTTAATGGGGAGAGGGAGAGAGG + Intronic
1196207221 X:112954648-112954670 CTGAAAGAAGGAAGGAAGAAAGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196325790 X:114400734-114400756 CCCAAGGAAGGGAGGGAGAAAGG + Intergenic
1196457200 X:115898993-115899015 CTCAGTGAAGAGAAGGAGATTGG + Intergenic
1196573967 X:117296935-117296957 GAGAATGAAGAGTGGGAGGAGGG - Intergenic
1196695969 X:118612097-118612119 AGAAATGAAGAGAGGGAGAATGG - Intronic
1196852328 X:119949188-119949210 CTACAGGAAGAGAGGGGGAAGGG - Intergenic
1197024004 X:121725148-121725170 TTGAGTGGAGAGTGGGAGAAGGG + Intergenic
1197271012 X:124424810-124424832 CAGGAGGAAGAGAGAGAGAAGGG - Intronic
1197284527 X:124580863-124580885 GGGGAGGAAGAGAGGGAGAAGGG - Intronic
1198116474 X:133549665-133549687 GAGAAAGAAGAGAGGGAGAAGGG - Intronic
1198219662 X:134587752-134587774 TTGAATGAAGTGAGAGAAAAAGG - Intronic
1198666168 X:139025601-139025623 CTGAAAGAAAAGGGAGAGAATGG - Intronic
1198717658 X:139577478-139577500 GTCAATGAAGAGAGAGAGAGAGG - Intergenic
1199123932 X:144091546-144091568 GGGAAGGGAGAGAGGGAGAAAGG + Intergenic
1199895647 X:152125113-152125135 GTGCATGGAGAGAGGGAGAAAGG - Intergenic
1199943682 X:152648986-152649008 CTGAATGCAGAGACGGAAAGGGG - Intronic
1200329568 X:155282184-155282206 CTGAAAGAAAAGTGGGAGCAAGG - Intronic
1200360810 X:155604367-155604389 ATGAATGGGGAGGGGGAGAAGGG - Intronic
1200453452 Y:3358398-3358420 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201049887 Y:9922044-9922066 CTGGATGAAGCCAGAGAGAATGG - Intergenic
1201927365 Y:19302156-19302178 AGGAATGAAGAAAGGAAGAAAGG + Intergenic
1201981424 Y:19914154-19914176 GGGAAGGAAGAGAGGGAGAAAGG + Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202101282 Y:21310306-21310328 CTGAATGAACTGAGGTGGAACGG - Intergenic
1202182049 Y:22147982-22148004 CAGAATGAAGAGAGGCAGTGAGG - Intergenic
1202209311 Y:22438420-22438442 CAGAATGAAGAGAGGCAGTGAGG + Intergenic
1202597565 Y:26558267-26558289 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic