ID: 978788204

View in Genome Browser
Species Human (GRCh38)
Location 4:112633747-112633769
Sequence TTGGATAAAACTGTTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978788201_978788204 15 Left 978788201 4:112633709-112633731 CCAACACTGTTGCAACAGTTACT 0: 1
1: 0
2: 2
3: 9
4: 132
Right 978788204 4:112633747-112633769 TTGGATAAAACTGTTTTTGTGGG 0: 1
1: 0
2: 1
3: 40
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978788204 Original CRISPR TTGGATAAAACTGTTTTTGT GGG Intronic
900849749 1:5133086-5133108 TTGGATGAAAATGATTTTCTAGG + Intergenic
901418111 1:9130885-9130907 TTGCATACAAGTTTTTTTGTGGG + Intergenic
901830640 1:11890073-11890095 TTTGTTAGAAATGTTTTTGTAGG + Intergenic
903332769 1:22604559-22604581 TAGGAAACAACTGGTTTTGTGGG - Intergenic
903430653 1:23296230-23296252 ATGGATTAAACTGTTATTTTTGG + Intergenic
904513159 1:31031303-31031325 CTGGTTGAAACTGTATTTGTAGG - Intronic
904523528 1:31114558-31114580 TTGGATAAATCTCTTCTTGATGG - Intergenic
904579119 1:31527282-31527304 TGGGAAAAGAATGTTTTTGTTGG - Intergenic
905290205 1:36916514-36916536 TAGGAGAAAAATGGTTTTGTGGG + Intronic
905534529 1:38709997-38710019 ATTGATGAAACTGTTCTTGTTGG + Intergenic
905612569 1:39367269-39367291 AGAGATAAAACTGTATTTGTAGG - Intronic
906173708 1:43750345-43750367 TTGTTTACAACTCTTTTTGTAGG - Intronic
906664999 1:47615206-47615228 TTGAATAAAACTCTTTCTCTAGG - Intergenic
908875048 1:68663734-68663756 TTGAATAAAAATGCTTTTCTGGG + Intergenic
909737960 1:78989726-78989748 TTTGACAAAATTGTTTTTGATGG - Intronic
910608345 1:89112262-89112284 TTCGATAAACCTCTTTTTGAGGG + Intronic
911869530 1:103077650-103077672 TTGGATAAAGCTGTTTTTAGAGG + Intronic
912162268 1:106999962-106999984 TTGGATGAAAATCTATTTGTAGG - Intergenic
914916756 1:151823808-151823830 TTAAAAAAAACTTTTTTTGTAGG + Intronic
915046917 1:153025300-153025322 CTGGATAAATCTGTTTCTGTGGG - Intergenic
918395411 1:184109370-184109392 TTGTATAAAATAGTTTTTATTGG + Intergenic
918645550 1:186900064-186900086 CTGGGTTAAACTGTATTTGTTGG + Intronic
918650759 1:186959899-186959921 TTAGATAAAAATCTTTTTTTTGG - Intronic
918835957 1:189467073-189467095 TTGGTTAAAAATGTATTTGCTGG + Intergenic
919203050 1:194383255-194383277 GAGGATAAAATTGTTTTTGAAGG + Intergenic
919329697 1:196155485-196155507 TTTGATAAAAATGTTTTGATGGG - Intergenic
919422278 1:197384697-197384719 TTAGGTAAAACTGCTTTTATGGG - Intronic
919534673 1:198773109-198773131 TTGTATAAAACTGTTGCTGTTGG + Intergenic
919883538 1:201916547-201916569 TTTCATAAAACAGCTTTTGTTGG - Intronic
920373262 1:205492824-205492846 TTGGATATACCTGTTCATGTGGG + Intergenic
920523850 1:206650659-206650681 TTGGAAGAGACTCTTTTTGTTGG + Intronic
921769035 1:219012060-219012082 TTGCATAAAACTGGTTGTTTTGG + Intergenic
922409510 1:225357880-225357902 TTGTATAAAACAGTTTTTATGGG + Intronic
923084302 1:230690796-230690818 ATGTATAATACAGTTTTTGTGGG + Intronic
923547927 1:234937857-234937879 TTTAACAAAACTGTTTTTGAAGG + Intergenic
924631925 1:245749045-245749067 TAGGATAAAACTTCTTGTGTTGG + Intergenic
924682310 1:246249638-246249660 TTAGGTAAAACTGTTTTGTTGGG - Intronic
1063229799 10:4053880-4053902 TTGGAAAGAACAGTTTCTGTGGG - Intergenic
1063805904 10:9640233-9640255 TTGGGTGAAACTATTTTTGAGGG - Intergenic
1064147245 10:12835307-12835329 TTGGACAAACATGTTTTTATGGG - Exonic
1066092059 10:32032591-32032613 TTGGGTATGACTGTCTTTGTGGG - Intronic
1066799780 10:39172912-39172934 TTTGGAAATACTGTTTTTGTAGG + Intergenic
1066803297 10:39214559-39214581 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1066931854 10:41771998-41772020 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1067328247 10:45290482-45290504 TTGGATAAAACTGTTGGTGATGG + Intergenic
1067936162 10:50613963-50613985 TAGCAGAAAACTGTGTTTGTAGG - Intronic
1068250482 10:54433033-54433055 TTGGATAAAACTATTTTAACTGG - Intronic
1068638096 10:59369815-59369837 TTGAATAAAAGTGTATTTATTGG - Intergenic
1068731108 10:60358831-60358853 TTTGATAAACCTTTTTTTTTTGG + Intronic
1071410873 10:85393593-85393615 TTGGATACAAGTCTATTTGTTGG - Intergenic
1074295091 10:112179128-112179150 TTGTTTAAAAATGTTTTTATTGG - Intronic
1075806209 10:125190741-125190763 TTTGAACAAACTCTTTTTGTGGG + Intergenic
1077310274 11:1885556-1885578 TTGGGTGAAACTATTTTGGTTGG - Intronic
1079878131 11:25886916-25886938 TATTATAAAACTATTTTTGTTGG - Intergenic
1080253388 11:30261744-30261766 TTTAATAAAACTGTTATTGCAGG - Intergenic
1082145855 11:48667813-48667835 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082292314 11:50391174-50391196 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082292720 11:50398579-50398601 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082292780 11:50399612-50399634 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082293105 11:50404577-50404599 TTAGGAAACACTGTTTTTGTGGG + Intergenic
1082302247 11:50521890-50521912 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1082302770 11:50530140-50530162 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082308704 11:50617629-50617651 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1082312373 11:50667621-50667643 CTTGAAAAAGCTGTTTTTGTAGG - Intergenic
1082573300 11:54769319-54769341 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082573357 11:54770176-54770198 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082583625 11:54906070-54906092 TTTGGAAACACTGTTTTTGTTGG - Intergenic
1082583789 11:54908299-54908321 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1082594794 11:55064315-55064337 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1082594818 11:55064657-55064679 TTGAAAAAAACTGTCTTGGTAGG + Intergenic
1082606649 11:55243259-55243281 TTTTGAAAAACTGTTTTTGTAGG + Intergenic
1083446744 11:62713080-62713102 TTTTACAAAACTGTTTTTCTAGG - Exonic
1083533159 11:63443790-63443812 TTGAATAAAAATGTATGTGTTGG - Intergenic
1086224949 11:84496570-84496592 CTGAATAAAAATGTTCTTGTTGG - Intronic
1086262887 11:84961892-84961914 TTGGACAAAAGTGTTTTAGGAGG - Intronic
1087053802 11:93911760-93911782 TGCAATAAAACTGTTATTGTGGG - Intergenic
1087869498 11:103274714-103274736 TTGGTTGTAACTGTTTTTGGGGG + Intronic
1089371118 11:117958692-117958714 TTGGACAACACTGTTGGTGTTGG + Intergenic
1090738382 11:129632889-129632911 TTGTATAAACATGTTTTTGATGG + Intergenic
1091181842 11:133612248-133612270 TTTGAAAAAATAGTTTTTGTTGG + Intergenic
1091477389 12:788961-788983 TTGCTTATAACAGTTTTTGTGGG + Intronic
1092185859 12:6477984-6478006 TTGGTTGAAAATGATTTTGTTGG + Intergenic
1093253974 12:16842682-16842704 TTGGATAAAGGACTTTTTGTGGG + Intergenic
1094042235 12:26130250-26130272 TTGCATAAACATGTTTTTCTTGG - Intronic
1094701993 12:32878960-32878982 TTGGTTGAAAATGATTTTGTTGG - Exonic
1094827614 12:34283900-34283922 TTTGAAAACACTCTTTTTGTAGG - Intergenic
1094857195 12:34411031-34411053 TTTGGAAAGACTGTTTTTGTAGG - Intergenic
1094859637 12:34447924-34447946 TTTGAAAACACTGTTTTTGTAGG - Intergenic
1094863005 12:34491712-34491734 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1094863567 12:34500252-34500274 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1094867334 12:34552061-34552083 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1094878602 12:34684448-34684470 TTTTGTAAAACTCTTTTTGTAGG + Intergenic
1095074700 12:37903929-37903951 TTTGGAAACACTGTTTTTGTGGG - Intergenic
1095075904 12:37924532-37924554 TTCGGAAAAACTATTTTTGTAGG - Intergenic
1095082289 12:38018342-38018364 TTTGGAAAAACTCTTTTTGTAGG + Intergenic
1097203903 12:57303825-57303847 TTGGAAGACACTGATTTTGTTGG + Intronic
1098105000 12:67060388-67060410 TTGCATATAACTGATTTTGGGGG + Intergenic
1098451684 12:70625886-70625908 TTGCATAAAGCTCTTTTTATAGG + Intronic
1099336923 12:81373535-81373557 TTGGATAAAACTGATTAAGATGG - Intronic
1099597703 12:84689050-84689072 TTGGCTAAAAATGTTTTTAATGG - Intergenic
1099673203 12:85721442-85721464 TTACTTAAAACTGTTCTTGTTGG + Intergenic
1099849766 12:88078167-88078189 TTTGATAAAATTTTGTTTGTGGG - Intronic
1099849871 12:88080007-88080029 TTAGACAATGCTGTTTTTGTGGG - Intronic
1100794637 12:98168158-98168180 TTGGGCAAAACTGTGTTTTTTGG + Intergenic
1102462471 12:113108425-113108447 TTGGCCAAATCTGCTTTTGTAGG - Intronic
1102791630 12:115651112-115651134 TTGTATACAAGTATTTTTGTGGG - Intergenic
1104236199 12:126939633-126939655 TTGGAGAAAATTGCTTTTTTTGG - Intergenic
1104888951 12:132130487-132130509 TGGGATAAAACTGTCTTTCAAGG + Intronic
1105765322 13:23553519-23553541 TAGGATCATACTGTTTTTTTTGG - Intergenic
1106144457 13:27039300-27039322 TTTGATAACATTGTTTTTATTGG - Intergenic
1106498168 13:30301481-30301503 TACGATAAAAATGTTTTTCTAGG + Intronic
1107905790 13:45060078-45060100 TTGGATAATATTATTTTAGTTGG + Intergenic
1108242428 13:48479619-48479641 TTGGAGACCACTGTTTTTTTGGG + Intronic
1108542182 13:51454236-51454258 TTTGAGAAAACTGTTTTCCTCGG - Intronic
1109032724 13:57213892-57213914 CTGTATAAAACTGTTAATGTTGG + Intergenic
1109225337 13:59687437-59687459 TTCTTTAAAACTGTATTTGTTGG - Intronic
1109361081 13:61295569-61295591 TTGGATAAAGCAGTTTCTATAGG + Intergenic
1109598381 13:64589089-64589111 TTGTTTAACACTGTTTTTGGGGG + Intergenic
1109637220 13:65137419-65137441 TTGGGTAAAGCTGTTATTTTGGG + Intergenic
1109975861 13:69830696-69830718 TTTGATAAGACTTGTTTTGTGGG - Intronic
1110748823 13:79089206-79089228 ATGCATAAAACTGTTTTTGGTGG - Intergenic
1111305450 13:86407112-86407134 TTGGTTGAAAATGTTTTTGTTGG - Intergenic
1111456437 13:88490304-88490326 ATATATAAAACTGTTGTTGTTGG + Intergenic
1111758920 13:92436627-92436649 GTGGATAGAACTATTTTTATTGG - Intronic
1114874879 14:26703689-26703711 TGGGATAGAATTGTTTTTGTGGG + Intergenic
1114926100 14:27401573-27401595 TTACATAAAATTATTTTTGTTGG + Intergenic
1115250444 14:31340445-31340467 TTGGATAATTCTGTGTTGGTAGG - Intronic
1116049606 14:39787179-39787201 TTGGATTAAGCAGTTTCTGTGGG + Intergenic
1116567507 14:46468160-46468182 TTGGATAAAACTGGATCTGGTGG - Intergenic
1116589936 14:46759859-46759881 TTGGAAAAAAATGTTTGAGTTGG + Intergenic
1118460505 14:65982859-65982881 TTGAATAAAACTGTTTTGTGGGG + Intronic
1119551627 14:75518245-75518267 TTGGATATAGCTGTTTTACTTGG - Intergenic
1119565812 14:75628373-75628395 TTTTAGAAAATTGTTTTTGTTGG - Intronic
1120101517 14:80450558-80450580 TAGGAAAAAAATGTTTTTGAGGG + Intergenic
1123971426 15:25511446-25511468 TGGGATAGAAATGTCTTTGTCGG - Intergenic
1124804128 15:32863800-32863822 TTTGATAAAAGTGTGTTTGGGGG - Intronic
1125369558 15:38957631-38957653 TTTAATAAAACTTTTTTTTTTGG + Intergenic
1125440091 15:39692519-39692541 TGGGATTAAACTGTTTATTTAGG - Intronic
1126020101 15:44391712-44391734 TTGTATAGAAGTGTTTTTCTAGG - Intronic
1126628244 15:50707117-50707139 TTGCATAAATCTTTTTTTTTGGG + Exonic
1127284149 15:57517916-57517938 TTTTATAAAACTGTGTGTGTGGG + Intronic
1128624593 15:69186754-69186776 CTGGCTAAAGCTGTTTTTGAAGG + Intronic
1129818674 15:78579884-78579906 TTGTATAAAACTGCTTTTTAGGG - Intronic
1131348259 15:91671746-91671768 TTTGATATACCTGTTTTTATGGG - Intergenic
1131780744 15:95855555-95855577 TTAAATAAAACTGTTCTTGGAGG + Intergenic
1132257454 15:100388592-100388614 TGGGCTAAAACTGTGTTTGGAGG + Intergenic
1133706793 16:8362377-8362399 TTTTATAAAATTGTTTTTGGTGG - Intergenic
1134861815 16:17566893-17566915 TTTTTTAAAAATGTTTTTGTAGG - Intergenic
1135336167 16:21602957-21602979 TTCAATAAAACTTTATTTGTGGG - Intronic
1135765888 16:25177814-25177836 TTGGGTAAGACTGTGTTTATGGG - Intronic
1136741970 16:32541933-32541955 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1136745903 16:32590813-32590835 TTTGGAAACACTGTTTTTGTGGG + Intergenic
1137072474 16:35916049-35916071 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1139126203 16:64080938-64080960 TTAGAAAAAAATGTTTTAGTTGG - Intergenic
1139334991 16:66225493-66225515 TTAGATCAAAGTGATTTTGTAGG + Intergenic
1141933872 16:87223268-87223290 CTGGAGAAAACTGTTTTTGCAGG + Intronic
1203012542 16_KI270728v1_random:311278-311300 TTCGGAAACACTGTTTTTGTAGG + Intergenic
1203027633 16_KI270728v1_random:533301-533323 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1203030877 16_KI270728v1_random:584437-584459 TTCGGAAACACTGTTTTTGTAGG + Intergenic
1203040844 16_KI270728v1_random:749994-750016 TTCGGAAACACTGTTTTTGTAGG - Intergenic
1203044088 16_KI270728v1_random:801130-801152 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1203048031 16_KI270728v1_random:850018-850040 TTTGGAAACACTGTTTTTGTGGG + Intergenic
1144330604 17:14220614-14220636 TTGGAGAGAACTGTTTGTGTAGG + Intergenic
1145224741 17:21118746-21118768 TTGTATAAAACTGTATTTTAGGG - Intergenic
1149130802 17:53299229-53299251 TTTTTTAAAACTTTTTTTGTTGG - Intergenic
1150322006 17:64222709-64222731 TTGAATAGAATTGTTTTAGTTGG - Intronic
1150849634 17:68692422-68692444 TTGGATAACCCTCTTCTTGTGGG + Intergenic
1154178175 18:12102587-12102609 TTATATAAAACTGTTTGTCTGGG + Intronic
1154974947 18:21448309-21448331 TTGGAGAAAACAGTTTTTCCAGG - Intronic
1155810866 18:30233303-30233325 TTATATAAAAATGTATTTGTTGG + Intergenic
1155937308 18:31767269-31767291 TTGTATATCACTGTTTTTCTTGG - Intergenic
1156019401 18:32582545-32582567 TGTGATATAACTGTTTTTCTTGG + Intergenic
1156376667 18:36521086-36521108 TGGATTAAAACTTTTTTTGTGGG + Intronic
1157382632 18:47233360-47233382 TTAGATAACAGTGTTTTTCTAGG - Intronic
1158806553 18:60980467-60980489 TTGATTAATGCTGTTTTTGTGGG - Intergenic
1159685984 18:71421366-71421388 TTGGATAATCTTGTTTTTATTGG - Intergenic
1159790004 18:72766344-72766366 TTGGAAAAAAATTGTTTTGTGGG - Intronic
1162234561 19:9297847-9297869 TTGGGAGAAACTGTTTTGGTTGG - Intronic
1164327472 19:24210047-24210069 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1164327533 19:24211071-24211093 TTTGGAAACACTGTTTTTGTTGG - Intergenic
1164327923 19:24217388-24217410 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1164335533 19:24315382-24315404 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1164336461 19:24325992-24326014 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1164336504 19:24326674-24326696 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1164338684 19:24362642-24362664 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1164339142 19:24369511-24369533 TTTCAAACAACTGTTTTTGTAGG + Intergenic
1164340409 19:24390194-24390216 TTTGGAAAAACTCTTTTTGTAGG + Intergenic
1164359319 19:27484932-27484954 TTAGGAAACACTGTTTTTGTAGG + Intergenic
1164366905 19:27594863-27594885 TTTGGAAAAACTGTTTTTGTAGG + Intergenic
1164368140 19:27610840-27610862 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1166907329 19:46120419-46120441 TTTGTTAAAATTGCTTTTGTAGG - Intronic
1167978372 19:53251873-53251895 TTGGACACAACAGTTTTTCTTGG - Intronic
1168174114 19:54610486-54610508 TTGAATAGGCCTGTTTTTGTTGG - Intronic
926604696 2:14885883-14885905 TTCGGTAAAACTGTTTTTTTAGG - Intergenic
926645018 2:15281295-15281317 TTTCTTAAAACTGTTTTTGTTGG - Intronic
928348960 2:30529229-30529251 GTGGATTAAAATGATTTTGTTGG + Intronic
928741705 2:34362132-34362154 GTTGAGGAAACTGTTTTTGTAGG + Intergenic
929981073 2:46680943-46680965 TTGGTGAAAAGTATTTTTGTAGG - Intergenic
930594816 2:53374206-53374228 TTGAATAAAAGTCTTTTTTTAGG + Intergenic
931730472 2:65148684-65148706 TTGAAAAACACTGTTTTAGTGGG + Intergenic
933175844 2:79172111-79172133 TTGGATAAAACTGTTTTAACTGG - Intergenic
933353642 2:81188846-81188868 TTGGAAATAACTGTCTTTTTTGG + Intergenic
933376335 2:81484088-81484110 TTTGTTAAAACTTGTTTTGTAGG + Intergenic
933506882 2:83187916-83187938 TTACATAAGACTGTATTTGTGGG - Intergenic
936449259 2:112621180-112621202 TTGGGTAAGACTGTTCCTGTGGG + Intergenic
938445300 2:131372273-131372295 TTTGATTAAACTGTATTTGTAGG + Intergenic
938712279 2:133985508-133985530 TAGGATAAAACTGTGTCTTTGGG - Intergenic
938919643 2:135983454-135983476 ATGCAAAAAACTTTTTTTGTAGG - Exonic
939334936 2:140814276-140814298 TCGGTTGAAACTGTTTATGTTGG - Intronic
940890392 2:159030053-159030075 GTGAATAAAAGGGTTTTTGTGGG - Intronic
940918094 2:159280327-159280349 TAAGATAAAACTATTTTTATTGG + Intronic
941247077 2:163112295-163112317 TTGGATCTAAATGTTTTTCTTGG - Intergenic
942979280 2:182059794-182059816 TGGGAAAACACTGTTTTAGTGGG + Intronic
943055074 2:182967044-182967066 TTGGTTAAACTTCTTTTTGTTGG + Intronic
943272513 2:185825289-185825311 TTGTATGAAACGGTTTCTGTTGG - Intronic
943283836 2:185972035-185972057 TGGGGGAAAACTGCTTTTGTGGG + Intergenic
944072312 2:195685765-195685787 TTGAATTAATCTGTTTTTGTTGG + Intronic
944270179 2:197774174-197774196 TTGAATAAAACTGATTCTGTAGG - Exonic
944356827 2:198800022-198800044 TTGGATAAAAGTGGGATTGTTGG + Intergenic
945762221 2:213927995-213928017 GTGGCAAAAACAGTTTTTGTTGG + Intronic
946099544 2:217307697-217307719 TTGGATCATACTGAATTTGTGGG + Intronic
1169285870 20:4306645-4306667 TTGGTTAAAACCCTTCTTGTTGG + Intergenic
1169404227 20:5310015-5310037 TTGGATAAATCACTTTTGGTTGG + Intronic
1169554542 20:6735611-6735633 TTGGTTAAAACTGGTTGAGTTGG - Intergenic
1169559212 20:6781351-6781373 TTGGTTAAAACTGTTTTCAATGG + Intergenic
1169704995 20:8493357-8493379 TTGGTTAAAATTTTTTGTGTAGG + Intronic
1171048800 20:21836640-21836662 TTGGATACCACTGATGTTGTTGG + Intergenic
1171304024 20:24089389-24089411 GTAGGTAAAACTGTTTTTCTTGG + Intergenic
1173998015 20:47354310-47354332 TTGCATAATACTGTGTTTGTTGG - Intronic
1174220815 20:48953685-48953707 TTGGTTAAATCTGTTTTTTCGGG - Exonic
1174918224 20:54675617-54675639 TTGTATAAAACCTTTTCTGTAGG + Intergenic
1175280068 20:57797798-57797820 TTGTTTAAAACTGTGTGTGTTGG - Intergenic
1175326623 20:58133715-58133737 TTGGTTATAAATGTTTTTCTTGG + Intergenic
1176880912 21:14191979-14192001 TTAGGTAACACTGTTTTTCTTGG - Intronic
1176907695 21:14523094-14523116 TTGGAGAAAACTGTTTTTGGAGG + Intronic
1177150707 21:17452747-17452769 CTGGATAAAACATTTTTTGGTGG - Intergenic
1177390202 21:20459503-20459525 ATGGATAAAAGTGTCTTCGTGGG + Intergenic
1177886315 21:26750125-26750147 TTGGTCAGAACTGTCTTTGTAGG + Intergenic
1178449230 21:32678537-32678559 TTGGTTAAAATAGTTTTTGAAGG - Intronic
1178490918 21:33051091-33051113 TTAAAGAAAACTATTTTTGTTGG + Intergenic
1178885494 21:36481752-36481774 TTGGATAAAACAGTGTTTCCTGG + Intronic
1179225956 21:39453397-39453419 TTGGATAAAAAAATTTTTTTGGG + Intronic
1180397942 22:12375359-12375381 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1181890211 22:26056135-26056157 TTGGATAAATCTATATTTGTTGG - Intergenic
1183826835 22:40395163-40395185 TTGCAAAAAATTTTTTTTGTTGG + Intronic
949394631 3:3601802-3601824 TTGGACAATACTGTTATTCTTGG - Intergenic
949913098 3:8931069-8931091 ATAAATAAAACTGTTTTTATTGG + Intronic
950087195 3:10268325-10268347 TGGAACAAAACTGTTTATGTTGG - Intronic
952069166 3:29612487-29612509 TTTTATAAAACTGTATGTGTAGG + Intronic
957357923 3:79115883-79115905 TTGGAAAATAATTTTTTTGTTGG - Intronic
958855508 3:99379843-99379865 TTGGATAAATCTTATTTTTTAGG + Intergenic
959161306 3:102728126-102728148 TTGGAGAAATCTGTTGTTGGAGG + Intergenic
960097888 3:113705426-113705448 TTGGAGACCCCTGTTTTTGTTGG + Intergenic
960250953 3:115452747-115452769 ATGGATAAAACATTTTTTGGGGG - Intergenic
961704249 3:128772447-128772469 TTGCTTAAAAATGTTTTTGATGG + Intronic
961923995 3:130456818-130456840 TGGGATAAAATTTTTTTTCTTGG + Intronic
962214189 3:133505970-133505992 TTGGCTAAAAATATTTGTGTTGG - Intergenic
963508537 3:146218911-146218933 GTGGATAAAATTATTTTTGTGGG + Intronic
963869800 3:150403204-150403226 TTGAATATATGTGTTTTTGTGGG + Intergenic
964788352 3:160424845-160424867 TTAGAGAAAACTTTCTTTGTAGG + Exonic
965862700 3:173166411-173166433 TTGAAGACAACTGTTTTTGTGGG - Intergenic
966233437 3:177673991-177674013 TTAGATAAAACTGCTGTTGCTGG - Intergenic
966256354 3:177920218-177920240 TTAGATAAAACTATATGTGTTGG + Intergenic
967332669 3:188307325-188307347 TTGGACAACACTGTTTTTAAGGG - Intronic
970516122 4:16832063-16832085 TTGTTTAAAACTGTTATTTTGGG + Intronic
971081203 4:23213604-23213626 TTGGATAGCACTGTTCTTCTAGG + Intergenic
971297120 4:25405427-25405449 TGGAAGAAAAATGTTTTTGTTGG + Intronic
971901227 4:32660730-32660752 CTTGAAAAAATTGTTTTTGTTGG + Intergenic
971906760 4:32736187-32736209 TTTGAGAAAACAGTTTTGGTTGG - Intergenic
972195300 4:36646669-36646691 TGGGATCAATCTGTCTTTGTAGG - Intergenic
972472495 4:39420498-39420520 TTGGTTGAAACTGTTCCTGTTGG - Intronic
972635735 4:40882530-40882552 TGGGATAAAGCTGTGTTTCTAGG + Intronic
972987302 4:44780149-44780171 TTGGACATAACTTTTTTTGGGGG + Intergenic
973180273 4:47258550-47258572 ATGTAGAAAACAGTTTTTGTAGG + Intronic
974355081 4:60801865-60801887 TTAGAAAAAAATGTATTTGTAGG - Intergenic
976651214 4:87436945-87436967 CTGTTTAAAAATGTTTTTGTTGG + Intronic
976667897 4:87619707-87619729 TTAAAAAATACTGTTTTTGTGGG - Intergenic
976866432 4:89733048-89733070 TTGGAAAAAACAGTATATGTAGG + Intronic
977114496 4:93006162-93006184 TATGCTAAAAATGTTTTTGTGGG - Intronic
977941659 4:102866249-102866271 ATGGATAAAACTTTTTTGGGAGG - Intronic
978008423 4:103648964-103648986 TTGGATAAAGCCATTTTAGTTGG + Intronic
978738484 4:112111444-112111466 CTGGACTGAACTGTTTTTGTGGG + Intergenic
978788204 4:112633747-112633769 TTGGATAAAACTGTTTTTGTGGG + Intronic
979114417 4:116803919-116803941 TTGAATAAAACAGGCTTTGTAGG - Intergenic
980023449 4:127736515-127736537 CTGGATAAAACAGTATTTTTTGG - Intronic
981261203 4:142721353-142721375 TTGCACAAAAATGCTTTTGTTGG + Intronic
982200446 4:152955322-152955344 TTTTATACAACTGTTTTTCTGGG - Intronic
982393291 4:154889418-154889440 TTGGTTAAAACATATTTTGTAGG + Intergenic
983123601 4:163920338-163920360 TTGTATAAAACTCTCTTGGTTGG + Intronic
983548446 4:168988970-168988992 TTGCATTAAACTCTTTTTATCGG - Exonic
983864984 4:172755489-172755511 TTGGATAATATTGTTTCTTTAGG - Intronic
984601516 4:181732306-181732328 GTGGGTGAAACTGTTTTGGTGGG - Intergenic
985639871 5:1058602-1058624 CTGGATAAAACTGTTTAACTTGG + Intronic
987295925 5:16551330-16551352 TTGTATAAAAATGTTTTTGGAGG - Intronic
987308825 5:16663542-16663564 TTTGAAAAAACTTTTTTTGGTGG + Intronic
987918591 5:24248926-24248948 GAGGAAAAAACTGGTTTTGTGGG - Intergenic
988013853 5:25527923-25527945 TTGAATAAAACAGTATATGTGGG + Intergenic
988049115 5:26000732-26000754 TTGGAAAATACTCTTTCTGTGGG + Intergenic
988194044 5:27978187-27978209 TTAAATAAAAGTGTTCTTGTTGG + Intergenic
988938381 5:36114819-36114841 TATGATAAAAATGTTTTTTTTGG - Intronic
989147184 5:38260418-38260440 TTGTATAAAACTGCTCATGTGGG + Intronic
989529715 5:42493903-42493925 TTATATAAAACTGTATTAGTTGG - Intronic
989574560 5:42978357-42978379 TTGAAAAAAATTGTTTATGTGGG - Intergenic
989835479 5:45983505-45983527 TTTGGAAACACTGTTTTTGTTGG + Intergenic
989835540 5:45984511-45984533 TTTGGAAACACTGTTTTTGTAGG + Intergenic
989835579 5:45985198-45985220 TTTGGAAACACTGTTTTTGTAGG + Intergenic
989835622 5:45985883-45985905 TTTGGAAACACTGTTTTTGTAGG + Intergenic
989836077 5:45993493-45993515 TTTGAAAAAACTGTATTTGTAGG + Intergenic
989838459 5:46027540-46027562 TTTGGAAACACTGTTTTTGTAGG + Intergenic
989838856 5:46033356-46033378 TTTGGAAACACTGTTTTTGTAGG + Intergenic
989839375 5:46042751-46042773 GTTGGAAAAACTGTTTTTGTAGG + Intergenic
989840760 5:46065115-46065137 TTGGGAAACACTGTTTTTATAGG + Intergenic
989847428 5:46162885-46162907 TTTGGAAAAACTGTTGTTGTAGG + Intergenic
989847562 5:46164431-46164453 TTTGGAAACACTGTTTTTGTAGG + Intergenic
989853584 5:46248731-46248753 TTTGGAAACACTGTTTTTGTGGG - Intergenic
989854003 5:46255793-46255815 TTTGGAAACACTGTTTTTGTAGG - Intergenic
989854345 5:46262073-46262095 TTTGGAAACACTGTTTTTGTAGG - Intergenic
989855148 5:46276656-46276678 TTTGGGAACACTGTTTTTGTAGG - Intergenic
993857733 5:93096951-93096973 TTGGATAACACTCTTTTAATGGG - Intergenic
993968361 5:94386589-94386611 TTAGGTAAACCTGTTTTTGATGG - Intronic
993985404 5:94591572-94591594 TTGGATAACACTGATTTTACTGG - Intronic
994617459 5:102123066-102123088 TTGGATGAATAAGTTTTTGTAGG + Intergenic
994672959 5:102784318-102784340 TTGGGTCAAGCTGTTTTGGTGGG + Intronic
995606616 5:113863448-113863470 TTTGATAAAACAATTTTTTTAGG + Intergenic
995678089 5:114685868-114685890 TTGGATAACAATGAATTTGTTGG + Intergenic
996196669 5:120615400-120615422 TTTGATAAAATTTTTTTTTTGGG + Intronic
998854977 5:146385943-146385965 TTGGATAAATCCTTTTTTTTGGG + Intergenic
998890934 5:146744913-146744935 TTTGATAAAAGTATTTTTGTTGG - Intronic
998986075 5:147758744-147758766 TTGTATAAAACTCTTTTAGCTGG - Intronic
999498513 5:152124013-152124035 GAGGAGAAAATTGTTTTTGTGGG + Intergenic
1000057961 5:157625671-157625693 ATAGATAAAATTGTTCTTGTTGG - Exonic
1000667332 5:164014945-164014967 TTGGAGAAAATTGTATTTGCTGG - Intergenic
1001018989 5:168166863-168166885 TTGGCATAAACTGTTTTGGTGGG - Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003227469 6:4219078-4219100 TAGGAAAAAAATGGTTTTGTGGG - Intergenic
1004093428 6:12528870-12528892 TTGGAGGAAATTGCTTTTGTGGG - Intergenic
1004983516 6:21053851-21053873 TTGGATACAAGTCTTTTTATTGG + Intronic
1005177811 6:23067864-23067886 TTGGATAAAAATGGTGTTGAGGG + Intergenic
1005180545 6:23100132-23100154 TTTGATAAGACTTTTTTTTTTGG + Intergenic
1006289369 6:33122704-33122726 TTTGTTAAAAATGTGTTTGTAGG - Intergenic
1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG + Intergenic
1007816549 6:44529196-44529218 TGGGGTAAAGCTGGTTTTGTGGG + Intergenic
1009065125 6:58450897-58450919 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009068256 6:58594563-58594585 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009074821 6:58686231-58686253 TTTTAAAACACTGTTTTTGTAGG + Intergenic
1009084653 6:58823250-58823272 TTTTGAAAAACTGTTTTTGTAGG + Intergenic
1009085317 6:58832423-58832445 TTTTGAAAAACTGTTTTTGTAGG + Intergenic
1009097587 6:59003537-59003559 TTTTAAAACACTGTTTTTGTAGG + Intergenic
1009105255 6:59109981-59110003 TTTTGAAAAACTGTTTTTGTAGG + Intergenic
1009105687 6:59116095-59116117 TTTTAAAACACTGTTTTTGTAGG + Intergenic
1009108112 6:59149703-59149725 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009110739 6:59186386-59186408 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009121648 6:59338295-59338317 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009122096 6:59344411-59344433 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009137767 6:59562509-59562531 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009143441 6:59641086-59641108 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009144330 6:59653315-59653337 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009156200 6:59818366-59818388 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009259548 6:61467125-61467147 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009259649 6:61468662-61468684 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1009262048 6:61504081-61504103 TTTGGAAATACTGTTTTTGTAGG - Intergenic
1009679699 6:66875620-66875642 TTGGATATAACTGGTGCTGTTGG + Intergenic
1010804619 6:80220663-80220685 TAGGATAAGCCTGTCTTTGTAGG + Intronic
1010924055 6:81721885-81721907 TTGATAAAAAATGTTTTTGTAGG - Intronic
1011164085 6:84426255-84426277 TTAGATAAAACTCCTTTTCTGGG + Intergenic
1011517610 6:88169158-88169180 TTGGCAAATACTGTTCTTGTGGG + Intergenic
1011893605 6:92197007-92197029 ATGGATGCAACTGTATTTGTGGG - Intergenic
1012161363 6:95888969-95888991 TAGGAAAAAAATGGTTTTGTGGG - Intergenic
1012848111 6:104415008-104415030 TGGGATAAATCTGCTTTTGAAGG - Intergenic
1013075152 6:106764607-106764629 TTGGAAAAAGCTATTTTTCTTGG - Intergenic
1013413773 6:109906013-109906035 TAGGAGAAGACTGTTTTTATGGG + Intergenic
1013486629 6:110602647-110602669 TTCGATAAAAGTTTTTTGGTCGG - Intergenic
1014576900 6:123084782-123084804 GTAGATAAAACTGTTTTTATGGG - Intergenic
1014722340 6:124932652-124932674 TAGGATAAAATTGTATTTTTTGG + Intergenic
1015235589 6:130967220-130967242 TTGAAAATAACTGTGTTTGTAGG - Intronic
1017148168 6:151253520-151253542 TTGAATAAGACTGTTTTGGCCGG - Intronic
1017661756 6:156681481-156681503 TTGAATAAGACTGTTTCAGTTGG + Intergenic
1018965916 6:168488792-168488814 TTGGATCACACTGTTTTAGAGGG + Intronic
1018965944 6:168489034-168489056 TTGGATCACACTGTTTTAGAGGG + Intronic
1018965973 6:168489277-168489299 TTGGATCACACTGTTTTAGAGGG + Intronic
1018966049 6:168489959-168489981 TTGGATCACACTGTTTTAGAGGG + Intronic
1018966057 6:168490008-168490030 TTGGATCACACTGTTTTAGAGGG + Intronic
1019040282 6:169098205-169098227 TTGGTTAAAAGTGTTGTTGGGGG + Intergenic
1020373025 7:7455244-7455266 TAGCATAAAACTGAATTTGTGGG + Intronic
1021161777 7:17282446-17282468 TTGTATAAAAATGTCTTTGAAGG - Intergenic
1021515362 7:21478325-21478347 TTGTGTAGAACTGTTTGTGTGGG + Intronic
1022344133 7:29497452-29497474 TGGGATAAAAGCGTTTTTGTGGG + Intronic
1022791454 7:33693326-33693348 CTGAAGAAAACAGTTTTTGTTGG - Intergenic
1023748177 7:43342634-43342656 TTGGTTAAAATTGCTTTTCTTGG + Intronic
1024712266 7:52029446-52029468 TTGGATATTTCTGTTTGTGTGGG - Intergenic
1024948825 7:54837634-54837656 ATAGATAATACTGTTTTTGCTGG + Intergenic
1024967972 7:55041720-55041742 TTGGACATAACTGTTTTTCTAGG - Intronic
1025528552 7:61846333-61846355 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1025529380 7:61859016-61859038 TTTGGAAAAACTGTTTTTGTAGG - Intergenic
1025531820 7:61896521-61896543 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1025569484 7:62541234-62541256 TTGCAGAACACTCTTTTTGTAGG + Intergenic
1025577001 7:62658388-62658410 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1025580288 7:62705711-62705733 TTTGAAAACACTGTTTTGGTGGG + Intergenic
1025580759 7:62713163-62713185 GTTGGAAAAACTGTTTTTGTAGG - Intergenic
1025580782 7:62713533-62713555 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1025587114 7:62804362-62804384 TTTGGAAACACTGTTTTTGTAGG - Intergenic
1026561323 7:71452613-71452635 TTGGATAAAAAAGTATTTATTGG + Intronic
1029004816 7:97198044-97198066 TTGTCTAGAACTGGTTTTGTGGG - Intergenic
1029012244 7:97274078-97274100 TTGGCTAAATGTGTTTTTTTGGG + Intergenic
1030461850 7:109848125-109848147 TTTCATAAAAATGTTCTTGTTGG + Intergenic
1030516240 7:110541898-110541920 TTGGATAAAACTCTTTAATTTGG + Intergenic
1030760942 7:113350476-113350498 ATGCATAAAACTTTTTTTTTAGG + Intergenic
1030942294 7:115668223-115668245 TTTAAAAAAGCTGTTTTTGTTGG + Intergenic
1031419736 7:121537026-121537048 TTGGAAAAAATCGTTTTTGAAGG + Intergenic
1032214538 7:129947742-129947764 TTAGTTAAAACTTTTTTAGTCGG - Intronic
1033031282 7:137829736-137829758 TTGGCTAAAACTATATTTGGTGG - Intronic
1034333070 7:150299984-150300006 TTGAATTAAACTTTTTTTTTTGG - Intronic
1034664974 7:152809905-152809927 TTGAATTAAACTTTTTTTTTTGG + Intronic
1036113775 8:5935347-5935369 TTTCATAAAACTGTGTCTGTAGG - Intergenic
1036718801 8:11153110-11153132 TTGGATTAAACTGTGAATGTTGG - Intronic
1037004641 8:13761853-13761875 TTTGAAAAAACTTTTCTTGTAGG - Intergenic
1037194513 8:16171684-16171706 TTTGATAAAATTGTTTATTTGGG - Intronic
1038039084 8:23709227-23709249 TACGATAATACTGTTTTTCTAGG - Intergenic
1038383781 8:27121597-27121619 GTGGCTAAAACTGTTTGTGATGG - Intergenic
1039659202 8:39445142-39445164 TTGAATAAAAGTGTTTTTGATGG - Intergenic
1040321411 8:46308672-46308694 TTTGAAAACACTCTTTTTGTAGG - Intergenic
1040346667 8:46507475-46507497 TTTGGAAACACTGTTTTTGTGGG - Intergenic
1040347448 8:46520146-46520168 TTTGAAAACACTGTTTTTGTAGG + Intergenic
1040359768 8:46654145-46654167 GTGGATTGAACTATTTTTGTAGG - Intergenic
1040678188 8:49776654-49776676 TTGTATACAAGTTTTTTTGTAGG + Intergenic
1041240187 8:55842543-55842565 CTGGATAAAACTGTGTGGGTTGG + Intergenic
1041882857 8:62772511-62772533 TTGGATAAAACTATTTTAACTGG + Intronic
1042397164 8:68306204-68306226 TTGGATAAAACTGTATGGGATGG + Intronic
1042691566 8:71505430-71505452 TTTCACAAAAGTGTTTTTGTTGG - Intronic
1042741117 8:72048160-72048182 GTGGGAACAACTGTTTTTGTGGG + Intronic
1042855006 8:73257920-73257942 TTGGAAAAAATAGTTTCTGTTGG + Intronic
1043578383 8:81683830-81683852 TTGGATCATACTGATTTTGTGGG - Intronic
1043635873 8:82381090-82381112 TTGGTTCAAAATGTTGTTGTTGG - Intergenic
1043953462 8:86336150-86336172 TTGGTTAAAAGTATTTTTCTTGG - Intergenic
1045812237 8:106235574-106235596 TTGGAAAAAAATTTTTTTGAAGG - Intergenic
1046037047 8:108855058-108855080 TGGGATAACAGTGTATTTGTTGG - Intergenic
1046123124 8:109869789-109869811 TTAGTAAAAACTGTTTATGTGGG + Intergenic
1046358325 8:113117189-113117211 TAGGAAAAAAATGGTTTTGTGGG + Intronic
1047048268 8:121079446-121079468 TTGGAGAAAACTATTTTTAAAGG + Intergenic
1050943052 9:11484918-11484940 TTGGATAAAGTTTTTTTTGTGGG + Intergenic
1050999326 9:12260651-12260673 TTGGATAAAAATGCTTGTTTAGG + Intergenic
1051044434 9:12856467-12856489 ATGGGTAAAACTGTTCTTGTTGG + Intergenic
1051246834 9:15120234-15120256 TTGGATAAAGCTGGAGTTGTGGG - Intergenic
1051554418 9:18366579-18366601 TTAAATAATAGTGTTTTTGTTGG - Intergenic
1052307920 9:27031875-27031897 TTGTTGAAAACTTTTTTTGTAGG + Intronic
1052377027 9:27729190-27729212 TTGGAAGAAAAAGTTTTTGTAGG + Intergenic
1052696080 9:31880565-31880587 TTTAATAAAACTGTTTTTTGTGG + Intergenic
1054362958 9:64196016-64196038 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1054363059 9:64197555-64197577 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1055420581 9:76136958-76136980 TTGGATAAAATGGATTTGGTAGG - Intronic
1056398749 9:86206417-86206439 TTGGAAAAAACTACTTTTTTTGG + Intergenic
1057736841 9:97670312-97670334 TTGGATAACACTGGCTTTTTAGG - Intronic
1058568493 9:106313251-106313273 ATGGAAAAAACTGTTTTTGATGG + Intergenic
1059229033 9:112700651-112700673 TCTTATAAAATTGTTTTTGTAGG - Intronic
1060433604 9:123572683-123572705 TTGGATAAAAGTCCTTTTTTAGG + Intronic
1060849743 9:126864532-126864554 TTGGATAAAAATGTTCTTTCAGG + Intronic
1061211927 9:129198644-129198666 TGGGAAAAACTTGTTTTTGTCGG + Intergenic
1061388113 9:130302389-130302411 TTCGATAAAACTGATGTTCTAGG + Intronic
1203379151 Un_KI270435v1:14048-14070 TTTGGAAACACTGTTTTTGTAGG + Intergenic
1187164471 X:16791974-16791996 TGACATAAAACTGCTTTTGTGGG + Intronic
1188158091 X:26766836-26766858 TTTGATAAACATATTTTTGTGGG - Intergenic
1188591934 X:31847878-31847900 TTAGATAAAACTTTCTTTGTAGG - Intronic
1191274880 X:58532239-58532261 TTGTGTAATACTCTTTTTGTAGG + Intergenic
1191572927 X:62655779-62655801 TTTTAAAACACTGTTTTTGTAGG + Intergenic
1191573783 X:62669926-62669948 TTGGAAAAAAGTCTTTTTGTAGG + Intergenic
1192985032 X:76389120-76389142 TTGGATATTAGTTTTTTTGTTGG + Intergenic
1193407078 X:81114298-81114320 TTGGATGAAACTCTTTTTTTGGG + Exonic
1193632928 X:83911948-83911970 ATGCATAAAAGTGCTTTTGTAGG + Intergenic
1194710326 X:97228389-97228411 TTTGAAAATACTATTTTTGTGGG + Intronic
1194992367 X:100558308-100558330 TTGGATATTACTGTTTTTTAAGG - Intergenic
1198577553 X:138026440-138026462 TTGAATTAATCTGTTTTTGTTGG - Intergenic
1198804814 X:140483784-140483806 GTGGATAAAAATGCTTTTTTGGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1200671928 Y:6103632-6103654 TTGGAAAAAACTGTGTTTTAGGG - Intergenic
1201723186 Y:17125568-17125590 TTGCATAAAAGTGTATTTATGGG + Intergenic