ID: 978788707

View in Genome Browser
Species Human (GRCh38)
Location 4:112638274-112638296
Sequence GGAGACGCAGCCTCTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978788707_978788709 8 Left 978788707 4:112638274-112638296 CCACTGAGAGAGGCTGCGTCTCC 0: 1
1: 0
2: 0
3: 20
4: 227
Right 978788709 4:112638305-112638327 ATTTTTCATATAATTTCCTCAGG 0: 1
1: 0
2: 4
3: 64
4: 668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978788707 Original CRISPR GGAGACGCAGCCTCTCTCAG TGG (reversed) Intronic
900737546 1:4308679-4308701 GCAGACGCAGCCTCTCCACGAGG + Intergenic
901047525 1:6406475-6406497 GGAGACAGAGTCTCACTCAGTGG + Intergenic
901794875 1:11674408-11674430 GGAGAAGCAGCCCCTCTCCCAGG + Intergenic
901911278 1:12460368-12460390 AGAGACACAGCCACACTCAGCGG + Exonic
903191883 1:21661272-21661294 GGAGACGCAGCCATTCTTGGTGG + Intronic
904141602 1:28357756-28357778 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
904965932 1:34372554-34372576 GGAGACGCAGCCACTCTAAATGG - Intergenic
908452468 1:64269599-64269621 GGAGAGGCAGCAGTTCTCAGTGG - Intergenic
915214134 1:154328879-154328901 GGAGCCGCAGCCGCTCAGAGGGG - Intronic
922584604 1:226724110-226724132 GGATAATGAGCCTCTCTCAGGGG - Intronic
922945849 1:229512975-229512997 GGAGACGGAGTCTCACTCTGTGG - Intergenic
923597667 1:235373461-235373483 TGAGACGCAGTCTCACTCTGTGG + Intronic
924756017 1:246941764-246941786 GGAGACAGAGTCTCTCTCTGTGG + Intergenic
1063154841 10:3369421-3369443 GGTGAGGAAGCCTCTCTAAGAGG + Intergenic
1063391478 10:5652577-5652599 CTAGACACAGGCTCTCTCAGGGG - Intronic
1064013929 10:11758530-11758552 GGAGACCCAGCCTTTCTCCCAGG - Intronic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1067686041 10:48466520-48466542 GGAGACGCAGCTTCTCTGGCGGG + Intronic
1068492197 10:57737963-57737985 TGAGACGGAGTCTCTCTCTGTGG + Intergenic
1068994602 10:63188478-63188500 AGAGACGCAGTCTCTGTCATAGG - Intronic
1070617848 10:77982607-77982629 GGAGACCCAGCATCTCCCTGTGG - Intronic
1070627477 10:78061604-78061626 AGAGCCCCAGCTTCTCTCAGAGG - Intergenic
1072429034 10:95355291-95355313 TGAGAGGCAGCCTCTCTCAATGG - Intronic
1075653583 10:124146571-124146593 TGAGAGGCAGCCTCTCTTTGTGG - Intergenic
1075830733 10:125408689-125408711 GGAGAAGCAGCCTTTGCCAGGGG + Intergenic
1075840707 10:125500088-125500110 TGAGACACAGTCTCTCTCTGTGG + Intergenic
1076689356 10:132213399-132213421 CAAGACGCAGACTCTCTCTGAGG + Intronic
1077373178 11:2193139-2193161 GGAGACGGAGTCTCACTCTGTGG - Intergenic
1078360491 11:10664144-10664166 CGAGACGCAGCCCCTCTCCGAGG + Intronic
1079077160 11:17391067-17391089 GGAGACTCAGCCTCTCAGAAGGG - Intergenic
1079350939 11:19691585-19691607 GGAGACGGAGTCTCGCTCTGTGG + Intronic
1079360112 11:19763528-19763550 GGCGACACTGCCTTTCTCAGTGG + Intronic
1079844802 11:25452049-25452071 TGAGACGGAGCCTCGCTCTGTGG + Intergenic
1080849655 11:36057197-36057219 AGAAACGCCGCCTCACTCAGTGG + Intronic
1081987057 11:47313324-47313346 GGAGACGGAGTCTCGCTCTGTGG + Intronic
1084593516 11:70104136-70104158 GGAGAAGCAGCATCTGTAAGTGG + Exonic
1085772357 11:79336924-79336946 TGAGACCCAGCCCCACTCAGGGG + Intronic
1086586348 11:88456970-88456992 GGAGAAGCAACATCTCTCAATGG - Intergenic
1089593436 11:119559778-119559800 GGAAACTCAGCCACTCTCATGGG - Intergenic
1092386134 12:8037067-8037089 GGAGACGAAGCCTTGCTCTGTGG - Intronic
1094119183 12:26951168-26951190 TGAGATGCAGCCTCACTCTGAGG + Intronic
1098353219 12:69585332-69585354 GGAAACGCAGCCTTTCACACTGG - Exonic
1099284507 12:80700474-80700496 GTACAGGCAGCCTGTCTCAGAGG - Intergenic
1100308657 12:93374719-93374741 TGAGACGGAGTCTCTCTCTGTGG + Intergenic
1102071437 12:110023215-110023237 GGAAACGCTCCCTCTCACAGGGG - Intronic
1102197088 12:111033825-111033847 GGGGAGGCAGCCTCTCCGAGAGG - Intergenic
1103402462 12:120652575-120652597 AGAGAGGCAGCCTCTCGTAGAGG - Intronic
1103775234 12:123362414-123362436 TGAGACGGAGTCTCGCTCAGTGG - Intronic
1104056554 12:125235140-125235162 GCAAATGCAGCCTCTCCCAGGGG - Intronic
1104655069 12:130568232-130568254 GGAGACCCAGGATATCTCAGGGG + Intronic
1105012925 12:132767593-132767615 GGAGACGGAGTCTCACTCTGTGG - Intergenic
1105732893 13:23236656-23236678 GGAGACGGAGTCTCACTCTGTGG - Intronic
1106716367 13:32392568-32392590 TGAGACGCAGTCTCACTCTGTGG - Intronic
1111639247 13:90947010-90947032 AAAGAAGCAGTCTCTCTCAGGGG - Intergenic
1112309908 13:98309184-98309206 GGAGACGGAGTCTCGCTCTGTGG + Intronic
1114451004 14:22825506-22825528 TGAGACGGAGCCTCGCTCTGTGG + Intronic
1114663753 14:24367006-24367028 GGAGACGCGGCCTCTAAGAGAGG + Exonic
1118771939 14:68948074-68948096 TCACACGCAGCCTCTCCCAGGGG + Intronic
1122249924 14:100430681-100430703 CGAGATGCAGCCTCCCTCACTGG - Intronic
1122712016 14:103665821-103665843 GCAGACACAGCCTTTCTGAGTGG - Intronic
1123626079 15:22227693-22227715 GGAGCAGAAGCCACTCTCAGGGG - Intergenic
1124264162 15:28218849-28218871 GGAGACAGAGCCTGTCTCAAAGG - Intronic
1127649967 15:60997548-60997570 TGAGAAGCAGCCATTCTCAGGGG - Intronic
1127764965 15:62176379-62176401 GGAGAGGCAGCCTAGGTCAGTGG + Intergenic
1129655618 15:77523516-77523538 TGAGACACAGTCTCTCTCTGTGG + Intergenic
1130083536 15:80756713-80756735 GGAGACGCATCCTCACTTAGTGG - Intergenic
1131521130 15:93116542-93116564 AGAGATGCAGCATCTCTCAGAGG - Intergenic
1133817702 16:9210721-9210743 GCAGAAGCAGCCCATCTCAGAGG + Intergenic
1133998484 16:10764991-10765013 GGAGATGCAGCCCCTCTGATGGG - Intronic
1134169027 16:11953733-11953755 TGAGACGGAGCCTTTCTCTGTGG + Intronic
1134443427 16:14312981-14313003 GGAAATGCGGCCACTCTCAGGGG + Intergenic
1138238928 16:55410884-55410906 GGAGAGGAAGCCTCTGGCAGGGG + Intronic
1139448663 16:67014033-67014055 GGAGACGCGGCCCCTCTGCGGGG + Intergenic
1140070248 16:71642850-71642872 GGAGAGGCAGCTCCTCTCAAGGG + Intronic
1141067618 16:80926931-80926953 GGAGACGGAGTCTCACTCTGTGG + Intergenic
1141182869 16:81766268-81766290 GGAAACACAGCCTCTCCTAGGGG + Intronic
1141534027 16:84666459-84666481 AGAAACGCAGACCCTCTCAGGGG - Intronic
1142330730 16:89451429-89451451 TGAGACGAAGCCTCACTCTGAGG + Intronic
1142812958 17:2404311-2404333 GGAGACGGAGTCTCTCTCTGTGG - Intergenic
1142966231 17:3583522-3583544 GGAGGCACAGCCTCCATCAGGGG + Intronic
1143011559 17:3868986-3869008 TGAGACGCAGTCTCGCTCTGTGG + Intronic
1145031876 17:19510610-19510632 TGAGACGGAGTCTCGCTCAGTGG + Intronic
1145031970 17:19511154-19511176 GGAGGGGCAGCCTCCCTCAGCGG + Intronic
1145152652 17:20519890-20519912 GGAGAAGCAGGCCCTGTCAGAGG + Intergenic
1147635777 17:41962976-41962998 GGAGACAGAGCCCCTCTGAGGGG - Intronic
1148699586 17:49579575-49579597 GGGGACCCAGCATCTCTCTGTGG - Exonic
1151460221 17:74249864-74249886 GGAGACGGAGCCTCACTGTGGGG + Intronic
1151460229 17:74249893-74249915 GGAGACGGAGCCTCACTGTGGGG + Intronic
1151621928 17:75251059-75251081 GGAGATGGAGCCTCACTCTGTGG - Intronic
1152366627 17:79860239-79860261 GAAGAAGCAGCCTCCCCCAGAGG - Intergenic
1154458130 18:14549427-14549449 TGAGACGGAGTCTCTCTCTGTGG + Intergenic
1154974417 18:21443220-21443242 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1156631613 18:38975938-38975960 GGAGACGAAGCAGCTCTCAAGGG + Intergenic
1158881623 18:61784368-61784390 GGGGACTCTGCCTCTCTTAGGGG - Intergenic
1161028402 19:2047135-2047157 GGGGACGCAGAGTCTCTTAGGGG + Intronic
1161590695 19:5127902-5127924 GGAGTCCCCGCCTCTCTAAGGGG - Intronic
1162139043 19:8574773-8574795 TGAGATGGAGCCTCTCTCTGTGG + Intronic
1162940132 19:14004485-14004507 GGAGACGGAGTCTCACTCTGTGG - Intronic
1163282621 19:16326456-16326478 TGAGACGCAGCATCTCCCCGGGG - Intronic
1164738051 19:30556444-30556466 GGAGAGGCAGCCTCTCTGGATGG + Intronic
1167027426 19:46931170-46931192 TGAGACGCAGACTATCTCTGTGG - Intronic
1167261136 19:48458914-48458936 TGAGACGGAGTCTCACTCAGTGG - Intronic
1167360854 19:49029696-49029718 GGAGCGGGAGCATCTCTCAGAGG - Intronic
1168094491 19:54106909-54106931 GGAGGGGCCGCCTCTGTCAGTGG - Exonic
925288716 2:2732222-2732244 CAAGACGCAGCCACTCACAGTGG + Intergenic
925918616 2:8624512-8624534 AGAGACGCAGCTTGACTCAGAGG - Intergenic
928151993 2:28839519-28839541 TGAGACGGAGTCTCTCTCTGTGG + Intronic
931188271 2:59974674-59974696 GAAAAGGCAGCCTTTCTCAGGGG - Intergenic
933761925 2:85678532-85678554 GGAGACCCAGCCCCTGCCAGAGG - Intergenic
935975904 2:108578611-108578633 GGAGACGGAGTCTCTCACTGTGG + Intronic
940548004 2:155114790-155114812 TGAGACGGAGCCTCGCTCTGTGG - Intergenic
940549980 2:155141610-155141632 GAAGACGAAGCCTCTTTCAGGGG + Intergenic
941485227 2:166071868-166071890 TGAGACGCAGTCTCGCTCTGTGG - Intronic
941633474 2:167909552-167909574 AGATACACAGCCTCTCTCACTGG + Intergenic
942314334 2:174683482-174683504 GGAGAGGCAGCATCTTTCCGAGG - Intergenic
943649497 2:190441743-190441765 TGAGACGCAGCAGCTCACAGAGG - Intronic
944781320 2:203020938-203020960 GGAGACGGAGTCTCACTCTGTGG + Intronic
946404846 2:219486786-219486808 AGAGAGGCCACCTCTCTCAGAGG - Intronic
946566738 2:220973628-220973650 ATACACGCAGCCTATCTCAGAGG - Intergenic
947759092 2:232590170-232590192 TGAGACGGAGTCTCTCTCTGTGG - Intergenic
947972751 2:234337628-234337650 GGAGAAGCAGCTTCTCGCAGGGG - Intergenic
948591637 2:239054253-239054275 TGGCACGCAGCCTATCTCAGAGG - Intronic
948813209 2:240495873-240495895 GGAGAGGCAGCCTCTCTGGCTGG - Intronic
1169997816 20:11577993-11578015 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
1171343301 20:24447000-24447022 GGAGAGGCAGCCTGCCTGAGTGG - Intergenic
1171795231 20:29561260-29561282 GGAAAGGCAGCCTCTCTCCTGGG - Intergenic
1171847153 20:30284135-30284157 GGGGACGCAGCCTATCTCTCAGG + Intergenic
1171853225 20:30323005-30323027 GGAAAGGCAGCCTCTCTCCTGGG + Intergenic
1173617531 20:44412868-44412890 GCAATCGCAGCCTCTCTCTGGGG - Intronic
1174596125 20:51684989-51685011 GGAGATGGAGTCTCGCTCAGTGG - Intronic
1175419171 20:58820535-58820557 GGAGAGGCTGCCTTTCTCTGAGG - Intergenic
1175662340 20:60824478-60824500 AGAAACGAAGCCTCTTTCAGAGG - Intergenic
1176612424 21:8996017-8996039 TGAGACGCAGTCTCACTCTGTGG - Intergenic
1176816025 21:13603880-13603902 TGAGACGGAGTCTCTCTCTGTGG - Intergenic
1177164528 21:17584802-17584824 TGAGACGGAGTCTCTCTCTGTGG - Intronic
1177903422 21:26946016-26946038 GGAGAGGCATGCTCTCTCAAGGG + Intronic
1179072016 21:38080598-38080620 TGAGTCGCAGCCACTCTCAGAGG + Intronic
1179397834 21:41057448-41057470 AGAAACGAAGCCTCTGTCAGTGG - Intergenic
1179800225 21:43808267-43808289 GGAGGCACCGCCTCTCCCAGAGG - Intergenic
1180883989 22:19226646-19226668 GGAGCCTCAGCCTTTCTCACAGG - Intronic
1182412983 22:30202832-30202854 GGAGAGGCCTCCACTCTCAGCGG + Intergenic
1183092235 22:35530492-35530514 GGAGACGGAGTCTCGCTCTGTGG + Intergenic
1184153645 22:42652859-42652881 TGAGATGGAGTCTCTCTCAGTGG - Intergenic
1185063579 22:48619862-48619884 GGAGCAGAAGCCGCTCTCAGGGG - Intronic
950827665 3:15842408-15842430 TGAGACCCATCCTTTCTCAGAGG + Intronic
953072430 3:39534700-39534722 GTAGAAACAGCCTCTCTCAGAGG - Intergenic
953215558 3:40914689-40914711 GGAGACACAGCCTGGCTCACAGG - Intergenic
954544739 3:51423480-51423502 GGAGACAGAGTCTCTCTCTGTGG - Intronic
956054021 3:65279380-65279402 GGTGAGGCAGCTTCTCCCAGTGG - Intergenic
956977604 3:74599788-74599810 GAAGATGCACCCTCTCCCAGAGG + Intergenic
957164717 3:76657403-76657425 TGAGACGGAGTCTCTCTCTGTGG - Intronic
957293715 3:78310062-78310084 GGAGATGCAGCATCTCACAGAGG + Intergenic
961258439 3:125578749-125578771 TGAGACGGAGTCTCTCTCTGTGG - Intronic
962103572 3:132367854-132367876 TGTGACACAGCATCTCTCAGTGG + Exonic
963120198 3:141769761-141769783 GGAGATGCAGCCACTCCCAGAGG - Intergenic
963265455 3:143235630-143235652 GGAGACTTGGCCTTTCTCAGAGG - Intergenic
964109120 3:153071056-153071078 GGAGATGAAGTCTCTCTCTGTGG + Intergenic
966151157 3:176868902-176868924 GCAGAAGGAGCCTCTCTCAATGG - Intergenic
966780501 3:183580123-183580145 GCAGATGCAGCCTCCCTCAAGGG + Intergenic
968096203 3:195932487-195932509 GGAGAAGGAGCCTCTTTCTGTGG - Intergenic
968772279 4:2514995-2515017 GGAGCCTCAGGTTCTCTCAGGGG + Exonic
978788707 4:112638274-112638296 GGAGACGCAGCCTCTCTCAGTGG - Intronic
982094755 4:151911731-151911753 GGAGAAGGAGCATCACTCAGGGG + Intergenic
982158958 4:152548144-152548166 GGACTCTCAGGCTCTCTCAGTGG + Intergenic
983658829 4:170111296-170111318 GTGGACGAAGCCTCCCTCAGAGG - Intergenic
985606576 5:861310-861332 GGAGGCTCAGCCACACTCAGAGG + Intronic
988064700 5:26219081-26219103 GGAGAAGGAGCCTCTCTCTGTGG - Intergenic
992554592 5:77891233-77891255 TGAGACGGAGTCTCGCTCAGTGG + Intergenic
995083084 5:108076801-108076823 GTAGATGAAGCCTCCCTCAGAGG - Intronic
996569588 5:124917883-124917905 TGAGACGCAGTCTCACTCTGTGG - Intergenic
996893727 5:128455529-128455551 CTAGAAGCAGCGTCTCTCAGAGG + Intronic
997235072 5:132267980-132268002 TGAGGCCCAGCCTCCCTCAGAGG + Intronic
997338584 5:133124813-133124835 GGTCAAGCAGCCTTTCTCAGAGG - Intergenic
997996504 5:138590952-138590974 GGAGACGGAGTCTCACTCTGTGG + Intergenic
1000652733 5:163837300-163837322 GGAGAAACTGCCTCTCCCAGGGG + Intergenic
1003347268 6:5282318-5282340 TGAGAGGCAGCCTATTTCAGGGG + Intronic
1003402196 6:5799819-5799841 GCCCACGCAGCCACTCTCAGGGG + Intergenic
1003568372 6:7239578-7239600 GGGGACTGTGCCTCTCTCAGTGG + Intronic
1006876244 6:37299634-37299656 GGAGAAGCTGCTTCCCTCAGAGG - Intronic
1007711161 6:43825355-43825377 CGAGATGCAGCCTTTCTCAGGGG + Intergenic
1008838898 6:55874501-55874523 GGATACCCAGCCTCTCCCAATGG - Exonic
1011639666 6:89407122-89407144 GGAGCCGAAGTCTTTCTCAGAGG + Intronic
1013399494 6:109778616-109778638 GGAGACAGAGCCTCACTCTGTGG + Intronic
1015221929 6:130813870-130813892 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
1017618148 6:156266818-156266840 GGAGACCCAGCCTATCTTACAGG - Intergenic
1017923105 6:158888185-158888207 TGAGACGCAGTCTCACTCTGTGG - Intronic
1018021253 6:159763657-159763679 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1018181627 6:161228244-161228266 GGTGACGCAGCCTGTAGCAGGGG + Intronic
1018386456 6:163308644-163308666 TGAGACGGAGCCTCACTCTGTGG - Intronic
1018639419 6:165892644-165892666 GGAGACACGGCCACTCACAGGGG - Intronic
1019156725 6:170044231-170044253 GGAGATCCAGGCTCTCTCACAGG - Intergenic
1020162246 7:5781470-5781492 GGCGACGCGGCCTCTCTGAGGGG - Intronic
1020653591 7:10904188-10904210 GGAAAGGAAGACTCTCTCAGAGG - Intergenic
1021689806 7:23221068-23221090 GAAGCCGAAGCCTCTGTCAGTGG + Intergenic
1022516929 7:30980873-30980895 GGAGACCCAGGCTCTGTCCGTGG + Intronic
1022667787 7:32428117-32428139 GGAGACCGAGCCCATCTCAGCGG + Intergenic
1024270828 7:47640127-47640149 GGAGAGGCACCCTCTCACCGCGG + Intergenic
1025020134 7:55474139-55474161 GGCGAGGCAGCCTCTCACACAGG - Intronic
1027535760 7:79399112-79399134 GGAGATGGAGCCTCACTCTGTGG + Intronic
1029646755 7:101861782-101861804 TGAGACGGAGCCTCACTCTGTGG + Intronic
1034466633 7:151233533-151233555 GGAGCCGGAGCCTGCCTCAGTGG - Exonic
1035744146 8:1949786-1949808 GGAGCCACAGCCTTTCTCGGTGG + Intronic
1035757595 8:2045777-2045799 GAAGGCACAGCCTCTATCAGCGG - Intronic
1036618301 8:10405198-10405220 GGAGAGGCACTCTCTCCCAGAGG - Intronic
1037177025 8:15959642-15959664 GGCCACACAGCCTCTCTCAGTGG - Intergenic
1038066486 8:23968647-23968669 GGAGAATCTGCCTCTCCCAGAGG - Intergenic
1038261949 8:26003291-26003313 GAAGAAGCAGCAGCTCTCAGGGG - Intronic
1038892349 8:31739945-31739967 GGTCACACAGACTCTCTCAGAGG - Intronic
1039387132 8:37146047-37146069 GGAGCTGCAGTCTCTCCCAGGGG - Intergenic
1040025992 8:42783184-42783206 TGAGACGAAGTCTCTCTCTGTGG + Intronic
1040596301 8:48840733-48840755 GGAAAGGCTGTCTCTCTCAGAGG - Intergenic
1041219139 8:55631773-55631795 GGAGGGGCAGCCTCTCTCCATGG + Intergenic
1041263063 8:56038379-56038401 AGAGAAGCAGCCTCACTCAGTGG - Intergenic
1042737179 8:72002527-72002549 GCAGGCCTAGCCTCTCTCAGTGG - Intronic
1047377444 8:124315339-124315361 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1048014409 8:130484531-130484553 GGAGACCTAGTCTCTCTCTGGGG - Intergenic
1048359815 8:133688237-133688259 GGAGAGGGAGCCAGTCTCAGTGG + Intergenic
1050991823 9:12165449-12165471 GGAGACGGAGTTTCTCTCTGTGG - Intergenic
1051172232 9:14330105-14330127 TGAGACGGAGTCTCTCTCTGTGG - Intronic
1052377452 9:27733031-27733053 GGAGTGGCAGTCTCTCCCAGGGG + Intergenic
1054154131 9:61628468-61628490 GGAAAGGCAGCCTCTCTCCTGGG - Intergenic
1054704925 9:68452521-68452543 TGAGACCGATCCTCTCTCAGAGG - Intronic
1055919981 9:81450002-81450024 GGAGAGGCTGCCTCTACCAGGGG - Intergenic
1059488820 9:114649660-114649682 GGAGACGGAGTCTCCCTCTGTGG + Intergenic
1061401677 9:130371888-130371910 GGAGAGACAGCTCCTCTCAGAGG - Intronic
1061858144 9:133454376-133454398 GGAGACCTAGCCTCTCTCTGGGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062139338 9:134947310-134947332 GGACACGCAGCATCGCTCTGCGG - Intergenic
1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG + Intronic
1062580124 9:137225741-137225763 GGAGATGCAGCCCCTGCCAGTGG + Exonic
1203531334 Un_GL000213v1:145580-145602 TGAGACGGAGTCTCTCTCTGTGG + Intergenic
1190344575 X:49325859-49325881 GAAGACGGAGTCTCTCTCTGTGG + Intronic
1190345668 X:49335416-49335438 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190346773 X:49344966-49344988 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190348022 X:49535993-49536015 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190349123 X:49545549-49545571 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190350227 X:49555105-49555127 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190351329 X:49564664-49564686 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190352429 X:49574217-49574239 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190353530 X:49583765-49583787 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190354632 X:49593287-49593309 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1190355736 X:49602837-49602859 TGAGACGGAGTCTCTCTCTGTGG + Intronic
1195271421 X:103234838-103234860 TGAGACGGAGTCTCGCTCAGTGG - Intergenic
1198482903 X:137057105-137057127 GGAGACGGAGACTCTGACAGGGG - Intergenic
1198885621 X:141332911-141332933 GGAGACGGAGTCTCGCTCTGTGG - Intergenic
1199210061 X:145197730-145197752 TGAGACGGAGTCTCTCTCTGTGG + Intergenic
1201179307 Y:11331230-11331252 TGAGACGGAGTCTCGCTCAGTGG + Intergenic
1201179393 Y:11331711-11331733 GGAGAGGCATCTTCTCTCTGGGG + Intergenic