ID: 978806158

View in Genome Browser
Species Human (GRCh38)
Location 4:112802794-112802816
Sequence AGATTGCCCCATATAGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978806158_978806163 13 Left 978806158 4:112802794-112802816 CCTCAAACTATATGGGGCAATCT No data
Right 978806163 4:112802830-112802852 TCCTCCCGAGGTGATATGTTAGG No data
978806158_978806160 1 Left 978806158 4:112802794-112802816 CCTCAAACTATATGGGGCAATCT No data
Right 978806160 4:112802818-112802840 CCTGCCCATGATTCCTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978806158 Original CRISPR AGATTGCCCCATATAGTTTG AGG (reversed) Intergenic
No off target data available for this crispr