ID: 978806163

View in Genome Browser
Species Human (GRCh38)
Location 4:112802830-112802852
Sequence TCCTCCCGAGGTGATATGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978806158_978806163 13 Left 978806158 4:112802794-112802816 CCTCAAACTATATGGGGCAATCT No data
Right 978806163 4:112802830-112802852 TCCTCCCGAGGTGATATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978806163 Original CRISPR TCCTCCCGAGGTGATATGTT AGG Intergenic
No off target data available for this crispr