ID: 978810089

View in Genome Browser
Species Human (GRCh38)
Location 4:112840097-112840119
Sequence CTGCTGTTAGAGGAAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978810089_978810095 26 Left 978810089 4:112840097-112840119 CCTTGTCCTTCCTCTAACAGCAG 0: 1
1: 0
2: 2
3: 44
4: 326
Right 978810095 4:112840146-112840168 ATTAACAGGGTTTCCCAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 104
978810089_978810093 12 Left 978810089 4:112840097-112840119 CCTTGTCCTTCCTCTAACAGCAG 0: 1
1: 0
2: 2
3: 44
4: 326
Right 978810093 4:112840132-112840154 ACATCTCTGCTTGAATTAACAGG 0: 1
1: 0
2: 2
3: 13
4: 122
978810089_978810094 13 Left 978810089 4:112840097-112840119 CCTTGTCCTTCCTCTAACAGCAG 0: 1
1: 0
2: 2
3: 44
4: 326
Right 978810094 4:112840133-112840155 CATCTCTGCTTGAATTAACAGGG 0: 1
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978810089 Original CRISPR CTGCTGTTAGAGGAAGGACA AGG (reversed) Intronic
900435847 1:2630173-2630195 CTGCTGCTGTAGGCAGGACAGGG + Intronic
900621742 1:3590719-3590741 CTGCTGGCAGGGGAGGGACAGGG - Intronic
901637325 1:10676347-10676369 CTCCTTGGAGAGGAAGGACAGGG - Intronic
901782362 1:11602419-11602441 CTGCTGTTGGAGGCAGGCCTCGG - Intergenic
903413420 1:23165755-23165777 ATGCTGTTACAGGTAGGACCCGG - Intronic
904342557 1:29846238-29846260 CTGATGTTAGAGACAGCACAAGG + Intergenic
905047888 1:35022686-35022708 CTGCTGTGAGAGAAAGGAGATGG - Intronic
906184773 1:43853526-43853548 CAGCTGTGAGAGGAAGTAGAAGG - Intronic
906509008 1:46400652-46400674 ATGAGCTTAGAGGAAGGACAGGG + Intronic
906748816 1:48240751-48240773 CTGCTGTTGAAGGGAGGAGAGGG - Intronic
907454739 1:54568059-54568081 CGGCTGTCAGAGGAAGAACAGGG - Intronic
909071978 1:71005488-71005510 CTGCAATTAGAGTAAGCACATGG - Intronic
909736774 1:78971241-78971263 CTGCTGTCAGAATAAGGATAAGG - Intronic
913103586 1:115592527-115592549 CTGCTGTTAGAATAAGGATAAGG - Intergenic
913335106 1:117702718-117702740 CTGCCATGAGTGGAAGGACAGGG - Intergenic
914439666 1:147693356-147693378 CTGCAGTTGGAGGAGGGATATGG - Intergenic
915631408 1:157155944-157155966 CTGAGGACAGAGGAAGGACAGGG - Intergenic
915641466 1:157230387-157230409 GTGCTGGTAGAGGAAGGCCAAGG + Intergenic
915667214 1:157456107-157456129 GTGCTGGTGGAGGAAGGCCAAGG - Intergenic
915939503 1:160109767-160109789 CCGCTGTGAGAGGTGGGACAGGG - Intergenic
916383620 1:164242059-164242081 CTAGTGTTGGAGGAAGGACCTGG + Intergenic
916855094 1:168741181-168741203 CTGCAGTTAGAGGGAGGCTATGG + Intergenic
917371336 1:174297575-174297597 CTGCTGTTAGATTAAGGATAAGG + Intronic
918047119 1:180948210-180948232 CTGCTGTTGGAGGATGGCCTGGG - Exonic
918174951 1:182035486-182035508 CTGCTGTTAGGATAAGGATAAGG + Intergenic
918406245 1:184214202-184214224 CTCCTGCTAGAGGAAGGTAAAGG + Intergenic
919841178 1:201610581-201610603 CTGCGGACAGAGGCAGGACATGG - Intergenic
920583400 1:207134950-207134972 CTGCTGTTTGAGGAAGAAGAAGG - Intronic
920989577 1:210923856-210923878 CTGAGGTTCTAGGAAGGACATGG - Intronic
921216965 1:212946088-212946110 TTGCAGTTTGAGCAAGGACATGG - Intergenic
924327659 1:242911869-242911891 CTGCAGATGGAGGAAGGGCACGG - Intergenic
924569041 1:245221044-245221066 CTGGTGTCAGAGGAGGCACATGG + Intronic
1063306936 10:4911119-4911141 GAGCTGTTAGAGTAAGGATAAGG - Intergenic
1064044529 10:12000317-12000339 GTGCTGTTAATGGAAGAACATGG - Intronic
1066200956 10:33142336-33142358 CTGCTGATGGAGGAGGGAGAGGG + Intergenic
1066438575 10:35416001-35416023 CTGCTCTTTCAGGAAGGATAGGG - Intronic
1067829736 10:49604324-49604346 ATGCTGTTTGTGGGAGGACAAGG + Intergenic
1068409253 10:56633996-56634018 CTGCTGTTACAGAAATGCCAGGG + Intergenic
1070083947 10:73216695-73216717 CACCTGGTAGAGGAGGGACAGGG - Intronic
1071012251 10:80952776-80952798 CTGCTGTTAGATTAAGAATAAGG + Intergenic
1071544904 10:86521757-86521779 CGGCTGTTGGAGGAAGGAGGTGG - Exonic
1073387452 10:103138165-103138187 CTGCAGTTAGATGGAGGACTGGG - Intronic
1073574715 10:104612813-104612835 CTGCTGTTAGATTAAGGATAAGG - Intergenic
1074008561 10:109454063-109454085 CTGCTGTGATAGTCAGGACAAGG - Intergenic
1074705122 10:116123362-116123384 CTGCTGTATGAGGAAGGACTCGG - Intronic
1074836056 10:117295283-117295305 CTGCTGTTAGAGGTAAAACTTGG + Intronic
1075302098 10:121334062-121334084 CTGCTGTTAGATGAAGTTCAGGG + Intergenic
1076023780 10:127095456-127095478 CTACTGTTAGAGAAGGGATATGG + Intronic
1076221595 10:128738036-128738058 CTGCTGGTGGAGGAAGAACGTGG - Intergenic
1076240178 10:128899153-128899175 CTGGTGTTAGAGGAGGGACCTGG + Intergenic
1076883699 10:133251883-133251905 CTGCTGATGGGGGAAGGACCAGG - Intergenic
1078056573 11:8014128-8014150 CTGCTGCCAGAGGAAGGAGCAGG - Intergenic
1079986315 11:27204169-27204191 CTGCGATTAGAGGAAGGACTTGG - Intergenic
1079986422 11:27205060-27205082 CTGTTGTTAGGGGAAGGTCTTGG - Intergenic
1080066375 11:28019937-28019959 TTGCTGCTATAGGAAGTACATGG - Intergenic
1080119832 11:28664466-28664488 TTCCTGTTAGAGGAAGAAAAGGG + Intergenic
1080458215 11:32433823-32433845 CTGGGGTTAGAACAAGGACAGGG - Intronic
1080619070 11:33971509-33971531 CTTCTTTAAGAGGAAGGAGAAGG - Intergenic
1080653889 11:34243485-34243507 CTGTTGTTGGAGGAGGGGCAGGG - Intronic
1080686391 11:34518850-34518872 CTGTTGTTAGAGGACGGACTGGG + Intergenic
1080941290 11:36921480-36921502 TTGCTGTTAGATTAAGGATAAGG + Intergenic
1084442105 11:69180450-69180472 TGGCTGTTAGAGGAAGGAAAAGG - Intergenic
1084498118 11:69517189-69517211 CTGCTGTAGGAAGAAGCACAGGG - Intergenic
1084879859 11:72163200-72163222 CTACTGTTAGAACAAGGATAGGG + Intergenic
1086296487 11:85373458-85373480 CTGATGTTAGATTAAGGATAAGG - Intronic
1088825515 11:113490503-113490525 CTGCTGGAAGAGGAAGAACCAGG + Intergenic
1089807908 11:121107965-121107987 CTGCACTCAGAGCAAGGACAAGG - Intronic
1090025127 11:123161050-123161072 CTGCTGTCAAAGGAAGGCCAAGG - Intronic
1091019109 11:132082670-132082692 CTGCTGTTAGAATAAGGACAAGG + Intronic
1092563065 12:9636943-9636965 CTGCCGTTAGAATAAGGATAAGG + Intergenic
1092892081 12:12978562-12978584 CTGCTGGCAGTGGAGGGACAGGG + Intronic
1095211953 12:39504755-39504777 CTGCAGTTAGGGAAAGGGCAAGG - Intergenic
1095820230 12:46470379-46470401 CTGCTCCTAGAGGAAAGTCAGGG - Intergenic
1096628097 12:52907419-52907441 CTGCTGTTAGAGGGAGCAGGGGG + Intronic
1097856556 12:64469618-64469640 CTGCTCTAAGAGAAAAGACAAGG - Intronic
1097967791 12:65599322-65599344 CTGCTCCTAGAGAAAAGACAGGG + Intergenic
1098560861 12:71870256-71870278 ATAATGTTAGAGGAAGGAGAAGG - Intronic
1100401899 12:94238776-94238798 CTGCTATGAGGGGAAGGGCATGG - Intronic
1100552480 12:95658510-95658532 CTGCTGTTGAAAGAAGGAAAAGG - Exonic
1101138702 12:101772727-101772749 GTGCTGTGAGAGGGAGGAAAGGG - Intronic
1101534044 12:105601118-105601140 CTGTTGATAGAGGAAAAACATGG - Intergenic
1104388955 12:128375246-128375268 CTGTTGTCACAGGAAGGCCACGG + Intronic
1105951778 13:25235507-25235529 CTGCTATGAAAGGAAGGACAGGG - Intergenic
1106192262 13:27463892-27463914 CTTGTCTTAGAGGCAGGACAAGG - Intergenic
1106653376 13:31716335-31716357 CAGCTGGGAGGGGAAGGACATGG + Intergenic
1106846419 13:33742452-33742474 CTGGTGAGAGAGGAAGCACAGGG - Intergenic
1107722837 13:43267129-43267151 CTGCAGCTCGAGGAAGGAGAGGG - Intronic
1107773164 13:43810320-43810342 CTGCTGCCACAGCAAGGACAAGG + Intergenic
1108204277 13:48072302-48072324 CTGCTTTTAGAATAAGGATAAGG - Intronic
1109388740 13:61666772-61666794 CTGCCGTTAGATTAAGGATAAGG + Intergenic
1109561208 13:64052628-64052650 CTGCTCTTAGATTAAGGATAAGG + Intergenic
1110776903 13:79418373-79418395 CTGGAGTTAGATGAAGGATAGGG - Intergenic
1111377556 13:87400436-87400458 GTGCTTATTGAGGAAGGACATGG + Intergenic
1111807783 13:93059438-93059460 CTAATGTTAGAGGTAGGACCTGG + Intergenic
1112939111 13:104839476-104839498 CAGCTGTAAGAAGAAGGAGAGGG - Intergenic
1113973399 13:114207890-114207912 CTTCTCTTAGAGGAAGAGCATGG - Intergenic
1114401693 14:22416132-22416154 CTGGTCATAGAGAAAGGACAAGG + Intergenic
1116590698 14:46768219-46768241 TTACTGTGAGAGGAAGGTCAGGG - Intergenic
1116609107 14:47044402-47044424 CTGCTGATTGAGGAAAGTCATGG - Intronic
1116957229 14:50936892-50936914 CTGATATTAGGGGAAGGAGAGGG + Intronic
1118821963 14:69351557-69351579 CTGGTGTTAGAGGCAGGATGGGG + Intronic
1118905633 14:70021235-70021257 CTGCTGTTTGGGGAAAGGCAGGG + Intronic
1119193025 14:72697173-72697195 CTGGTGATAGAAGAATGACATGG - Intronic
1119661331 14:76454135-76454157 CTGCTGCTTCAGGAAGGACCAGG + Intronic
1120398733 14:84001517-84001539 CTGCTGGCAGAGGCAGGACAAGG + Intergenic
1120705632 14:87742712-87742734 CTGTTGTAAGAGGAAGGGAAGGG - Intergenic
1120889503 14:89479074-89479096 CAGCTGAAAGAGGAAGGACTGGG + Intronic
1121716265 14:96078263-96078285 CTGCTTTGAGAGGCAGGACCAGG + Intronic
1121835211 14:97086222-97086244 CTGCTGAGAGAGCAAGTACATGG - Intergenic
1126018041 15:44372389-44372411 CTGCTGTTAGAGTAAGAAAATGG + Intronic
1126243456 15:46473668-46473690 CTGCTCCTAGAGGAAATACAGGG + Intergenic
1126396497 15:48223941-48223963 CTGCTGTTAGAGACAGGGTATGG + Intronic
1126454164 15:48843101-48843123 GTCCTGTAAGAGGAAGGAGAGGG + Intronic
1126531612 15:49716711-49716733 CTGTAGCAAGAGGAAGGACAAGG + Intergenic
1126783255 15:52156303-52156325 CTGATTTTAGAGCAAGGACAGGG - Intronic
1128029463 15:64466941-64466963 CTGCTGCTAGAGCAAGGGGAGGG - Intronic
1128612352 15:69084267-69084289 CTGCTGGGAGTGGAAGGGCAAGG - Intergenic
1130948465 15:88567240-88567262 CTGCTCTCAGGGGCAGGACAGGG + Intergenic
1130965587 15:88695366-88695388 ATGGTGTTAGAGGAAGGGCGGGG - Intergenic
1131347684 15:91665923-91665945 CTGCTGCCAGAGCCAGGACAAGG - Intergenic
1131381969 15:91971788-91971810 CTGCTGCTAGGGGAAATACAGGG - Intronic
1131408893 15:92189441-92189463 CTTGTGTGGGAGGAAGGACATGG + Intergenic
1132647029 16:1003853-1003875 CTGTCCTTAGAGGAGGGACACGG + Intergenic
1132681136 16:1142205-1142227 CTGCTGTCAGTGGCAGGAGAGGG + Intergenic
1132888570 16:2193558-2193580 CAGCTGTGGGAGGGAGGACAGGG - Intronic
1133293278 16:4736670-4736692 CTGCTCTGGTAGGAAGGACAAGG - Intronic
1133386347 16:5373328-5373350 CTGATGTTGGAGGAGGGACCCGG + Intergenic
1134301856 16:12998926-12998948 TTGCTCTTAGAGGAAATACAGGG + Intronic
1134785140 16:16935376-16935398 CAGCTCTTAGAGGAAATACAAGG + Intergenic
1136047642 16:27627550-27627572 CTGCTTCTAGAGGAAATACAGGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1141730872 16:85822038-85822060 CTTCTGCTAGGGGAAGGACAGGG + Intergenic
1141948917 16:87328290-87328312 ATGTGGCTAGAGGAAGGACATGG + Exonic
1142643684 17:1299240-1299262 CTGCTGTTTGTGGATGGCCAGGG - Exonic
1143533744 17:7523204-7523226 CTGCTGTTAGAACAAGGATAAGG + Intergenic
1143782504 17:9236642-9236664 CTGCTGGGGGTGGAAGGACAAGG + Intronic
1146174971 17:30660051-30660073 CTGGTGTTGGAGGAAGGGCCAGG + Intergenic
1146348427 17:32076075-32076097 CTGGTGTTGGAGGAAGGGCCAGG + Intergenic
1146683551 17:34825347-34825369 GTGCTGTTGGAGGAAGGAAGTGG - Intergenic
1146928575 17:36762094-36762116 CTGCTCTGAGAGGAAGGCCCAGG + Intergenic
1147553895 17:41464204-41464226 CTGCAGTTGGGGGAAGGAGAAGG + Intronic
1149025656 17:52024668-52024690 CTGCTTTTAGAGGGAGGCCTGGG - Intronic
1149425683 17:56552089-56552111 CTGGTGTTGGAGGAGGGACCTGG - Intergenic
1149816657 17:59732195-59732217 CTACTTTTAGAGGAAGTGCAAGG + Intronic
1150271894 17:63872191-63872213 CTACTGCTTCAGGAAGGACATGG - Exonic
1150273259 17:63880386-63880408 CTACTGCTTCAGGAAGGACATGG - Exonic
1150275442 17:63895087-63895109 CTACTGCTTCAGGAAGGACATGG - Exonic
1150278867 17:63917374-63917396 CTACTGCTTCAGGAAGGACATGG - Exonic
1151222878 17:72626353-72626375 CTGCTGTTAGGTAAAGAACAAGG - Intergenic
1152331087 17:79673435-79673457 ATGCTTCTAGAGGAAGCACAGGG + Intergenic
1153870001 18:9309552-9309574 CAGTGGTTAGAGGAAGGAGAGGG + Intergenic
1155761460 18:29573682-29573704 CAGCTGTTAGAGGAAAAAAAAGG + Intergenic
1155784475 18:29879907-29879929 CTGCTGTTAGAATAAGGATAAGG + Intergenic
1156971971 18:43167460-43167482 CTGCAGTTAGAGTAAGGATAAGG - Intergenic
1158151801 18:54382443-54382465 TTGCCGTTAGAAGAAGGATAAGG + Intronic
1158641486 18:59207568-59207590 CTGCTGTTAAACTAAGGATAAGG - Intergenic
1158648386 18:59266908-59266930 CTGCGGTAAGAAGGAGGACAGGG + Intergenic
1159036870 18:63285958-63285980 CTGCTGTTGCAGAAAGGACAGGG - Intronic
1159077521 18:63698689-63698711 CTGCTGTTATAGGTAAGAAATGG - Intronic
1159563140 18:70017092-70017114 CTGGAGTTAGAGGAAGAGCAAGG + Intronic
1159714254 18:71801799-71801821 CTGATGTTGGAGGAGGGACCTGG - Intergenic
1160211290 18:76882312-76882334 GTGCTGTGGGAGGTAGGACAAGG - Intronic
1160863435 19:1247459-1247481 CTGCGGTTTGAGGAATGACTAGG - Intergenic
1160872516 19:1283644-1283666 CCGCTCCTAGAGGAAGGACCTGG - Intergenic
1162983753 19:14256175-14256197 CTGGTGTTGGAGGAAGGGCCTGG - Intergenic
1163713247 19:18859529-18859551 CTGCTGTTACAGCGAGCACAGGG - Intronic
1164505436 19:28856784-28856806 CTGGTGTTAGAGAAAGAACCAGG - Intergenic
1164566567 19:29330034-29330056 CCATTGTGAGAGGAAGGACAAGG - Intergenic
1165010224 19:32840636-32840658 CTGCTGGGAGAGAAAGGACATGG - Intronic
1167237994 19:48326446-48326468 CTCCTGATGGAGGAAGGGCATGG - Intronic
1167557693 19:50206042-50206064 CTGCTGGTTGAGGAAGGGTAGGG + Intronic
1167646220 19:50706559-50706581 GTGCTGTCAGAGGAAGGAGGTGG - Intronic
925948377 2:8887915-8887937 CTGCTATTAGAGTAAGGAAATGG - Intronic
925952428 2:8927658-8927680 CTGGTGTTCCAGGAAGGGCAGGG + Intronic
926764817 2:16314956-16314978 CAGCTGTTTGAGGAAAGCCAAGG - Intergenic
927060363 2:19412900-19412922 CTGCAGTGAGAGGAAGGGCATGG - Intergenic
927702125 2:25275444-25275466 CTGATTCTAGAAGAAGGACACGG - Intronic
928289654 2:30026201-30026223 CAGCTGTTGGAGGAAGCGCACGG + Intergenic
928578630 2:32682560-32682582 CTGCTGCTAGAGCAGGGAAATGG - Intronic
928846283 2:35676916-35676938 CTGCTGTCAGGGGATGGAAAAGG + Intergenic
929094426 2:38249993-38250015 CAGCTGTCAGAAGAAGGAAAGGG + Intergenic
929335805 2:40743755-40743777 ATGCTGTTGGAAGAAGGAGAGGG + Intergenic
930749321 2:54917706-54917728 CGGCTGTTAGAGGAATGGAATGG - Intronic
930802382 2:55456518-55456540 CTGTTGTGAGAAGAAGGATAAGG - Intergenic
931993957 2:67822341-67822363 TTGCTTCTAGAGGAAAGACAAGG + Intergenic
932818804 2:74882202-74882224 CTGCTGGCAGGGGAAGGAGAAGG - Exonic
933576262 2:84072013-84072035 CAGCTGTTAGAGAAAGAATAAGG + Intergenic
934119021 2:88822554-88822576 CTGTTGTGAAAGGTAGGACAGGG - Intergenic
934932353 2:98436836-98436858 CTGCTGTTAGAATAAGAATAAGG - Intergenic
936003203 2:108856027-108856049 CTGCTGTAAGAGTAGGGACTTGG + Intronic
936162473 2:110094906-110094928 CTGTTGTGAAAGGTAGGACAAGG - Intronic
936182187 2:110276460-110276482 CTGTTGTGAAAGGTAGGACAAGG + Intergenic
936440342 2:112546315-112546337 CTGCTAATAGAGCAAGGATACGG - Intronic
937519258 2:122691621-122691643 ATGAGGCTAGAGGAAGGACATGG - Intergenic
937727578 2:125186027-125186049 CTGCTGTTAGATTAAGGAAAAGG + Intergenic
940006519 2:149013516-149013538 ATGCTTTTAGAGCAAGGACAGGG + Intronic
940028627 2:149236361-149236383 CTCCTGTGAGAGGAAGGGCAGGG + Intergenic
941308294 2:163897894-163897916 CTGCTGTGACAGCCAGGACAGGG + Intergenic
943079762 2:183244632-183244654 CTGCTGATAGAGAAAGCAGATGG + Intergenic
943227774 2:185203217-185203239 CTGTTGTGTGATGAAGGACATGG + Intergenic
943360367 2:186911757-186911779 CTGCTGGCTGAGGAGGGACAAGG - Intergenic
944339373 2:198578013-198578035 CTGCTGTCAGATGGAGGATAGGG + Intergenic
945827086 2:214734963-214734985 CTGCTGTTAAAGGAAATACAGGG + Intronic
946094107 2:217257582-217257604 CCAGTGTTAGAGGAGGGACATGG - Intergenic
947062217 2:226179696-226179718 CTGCTGTTAGAGGGAGGATAAGG + Intergenic
1170222323 20:13953469-13953491 CTGCTGTTAAAATAAGGATAAGG - Intronic
1172311864 20:33924640-33924662 CTTGTTTTAGGGGAAGGACAAGG + Intergenic
1173662388 20:44743758-44743780 CTGATCTTAGGGGAAGGGCAGGG - Intergenic
1175874480 20:62222892-62222914 CTCCTGTTTGGGCAAGGACAGGG - Intergenic
1177400754 21:20602073-20602095 ATAGTGTTAGAGAAAGGACATGG + Intergenic
1177414421 21:20776050-20776072 CTTCTGTTAGAATAAGGATAAGG + Intergenic
1177543117 21:22521049-22521071 CTGCTGTTAGAATAAGGATAAGG - Intergenic
1177567405 21:22843274-22843296 CTGCTGTTAGAATAAAGATAAGG + Intergenic
1178901092 21:36599336-36599358 CTCCTCTTAGAGGAAACACAGGG + Intergenic
1179934769 21:44595347-44595369 CTGCTCCTACAGGAAGCACAGGG + Intronic
1180959888 22:19757730-19757752 CTGCTCAGAGAGGAAGGAAAGGG + Intronic
1181915882 22:26279498-26279520 CTCCAGTTAGAGGAAGAACATGG + Intronic
1182519451 22:30877045-30877067 CTGCCCTTGCAGGAAGGACAGGG - Intronic
1182841062 22:33390464-33390486 CTGCTGGCACAGGAAGCACAGGG - Intronic
1184342973 22:43896226-43896248 CTCCTGTTGGGGGAGGGACATGG + Intergenic
949690944 3:6638378-6638400 CTGATGTTTGAGGGAGGAAATGG + Intergenic
949943239 3:9170924-9170946 CTGCTGGCAGAGCAAGGCCATGG + Intronic
952193416 3:31047366-31047388 CTGCCGTTAGATTAAGGATAAGG - Intergenic
953198437 3:40755301-40755323 CTGCAGTCAGAGGCAGGACAGGG - Intergenic
955025906 3:55167195-55167217 CAGCTCTTGCAGGAAGGACAAGG + Intergenic
955107931 3:55917629-55917651 CTGGGGTTTGAGGAAGGGCAGGG + Intronic
955830551 3:62997548-62997570 AAGCTGTCAGAGGAAAGACAGGG + Intergenic
957288698 3:78249378-78249400 CTGCCGTTAGACTAAGGATAAGG - Intergenic
957711203 3:83861225-83861247 CAGTTGTTAGAGGAAGGGCCCGG - Intergenic
957847438 3:85755804-85755826 CTGGTGTTGGAGGAGGGACCTGG - Intronic
958800134 3:98745365-98745387 CTGGTGTTAGGGGAATCACAAGG + Intronic
958945370 3:100355828-100355850 CTGGTCTTAGAGGAAGGACTGGG + Exonic
959360723 3:105387761-105387783 CTGCTGGTAAAGGCAGGACTGGG - Intronic
959638920 3:108609146-108609168 CTAGTGTTAGAGGAGGGACCTGG - Intronic
959913780 3:111793915-111793937 CTTCTGCTTGAGGAAGGATAGGG - Intronic
960052900 3:113254591-113254613 CTGCATTTAGAGGAAAGACTGGG + Intronic
961197080 3:125011779-125011801 CTGCTGTTGGAGGAGTGAAATGG - Intronic
961350829 3:126300831-126300853 CACCTGGTAGAGGAAGCACAAGG + Intergenic
961988033 3:131158243-131158265 CTGCAGTTAGGGGAAGGAGCAGG - Intronic
962732549 3:138296960-138296982 ATGCTGTTTCAGGAAGCACAAGG - Intronic
962761071 3:138515154-138515176 CTGCTCCTAGAGGAAATACAGGG + Intronic
964579221 3:158212716-158212738 CTACTGTTAGAGGAACGTAAAGG + Intronic
966523785 3:180899798-180899820 CTGCTCTTAGATTAAGGATAAGG - Intronic
966648919 3:182276903-182276925 CTGCTGAGAGAGGAAGGCCAAGG - Intergenic
966869369 3:184280067-184280089 CGGATGTTAGAGGAGGGAAAAGG + Intronic
967377538 3:188822176-188822198 CTTCTGATACAGGAAGAACAGGG + Intronic
969796599 4:9532384-9532406 CTTGGGTTAGAGGAAGGACCCGG - Intergenic
969874010 4:10122734-10122756 CTGATGTAAGATGAAGGGCAAGG - Intergenic
970250827 4:14114174-14114196 CTGCAGTTTAAGGAATGACAGGG - Intergenic
970677834 4:18472858-18472880 TTACTTTTAGAGGAAGTACAGGG - Intergenic
972502101 4:39687785-39687807 CAGGTGTAAGAGGAAAGACAAGG - Intergenic
973247598 4:48026001-48026023 CTGCTGTGAGAGGATGGTCAAGG - Intronic
973621892 4:52735169-52735191 CTGCTGGTAGAGGTTGGGCATGG - Intronic
975650696 4:76589768-76589790 CTGCTGTGAGAGTAAAGATAAGG - Intronic
977076885 4:92464856-92464878 CCGATGTTAGGGGAAGGACCTGG + Intronic
977520771 4:98081017-98081039 CAGCTTTGAGAGGCAGGACAAGG - Intronic
977572688 4:98646008-98646030 CAGCTCTGAGAGGAAGGCCAGGG - Intronic
978300846 4:107268725-107268747 GTTCTCTTTGAGGAAGGACATGG - Intronic
978810089 4:112840097-112840119 CTGCTGTTAGAGGAAGGACAAGG - Intronic
978952290 4:114575461-114575483 ATGCTGTTATAGGCAGGGCATGG - Intergenic
980475880 4:133315732-133315754 CTGGTGTTAGAGAAAGCACCAGG + Intergenic
982477576 4:155872367-155872389 CTGCTGTTGGAATAAGGATAAGG + Intronic
982537728 4:156627635-156627657 CAGATGTTAGAGGAAGTTCAGGG - Intergenic
982787788 4:159556643-159556665 CTGTTCTTAGAGAAAGGAGAGGG + Intergenic
983385096 4:167051485-167051507 GTGCTATTTCAGGAAGGACATGG + Intronic
984327886 4:178275916-178275938 CTGCTATTAGAATAAGGATAAGG - Intergenic
984663695 4:182402396-182402418 CTGCTGTTACAGTAAAAACAAGG + Intronic
986040757 5:3992140-3992162 CTGCTTTCAGAGGTAGGCCATGG + Intergenic
986775120 5:11007214-11007236 CTGCTCTAAGAGGAATCACATGG + Intronic
987193000 5:15498548-15498570 CTGCTGGTGGAGGCAGCACACGG - Intergenic
987866090 5:23541290-23541312 CAGCTGTTAGAGAATGAACATGG - Intergenic
988899560 5:35717851-35717873 CTGTTGTTAGATTAAGGATAAGG + Intronic
989337503 5:40336077-40336099 CTCCTCATAGAGGAAGCACAAGG + Intergenic
990288035 5:54320037-54320059 TTCCTGTTAGAGGAAGGAACAGG - Intergenic
991367616 5:65885602-65885624 CAGGTGTTTGAGGAAGAACATGG + Intergenic
993692476 5:91019240-91019262 CTGCTGTTACCAGAAGAACAGGG + Intronic
994733655 5:103524796-103524818 CCGCTGGGAGAGGTAGGACAGGG + Intergenic
995591785 5:113707070-113707092 CTGCTGCTTGAGGAATGACAGGG + Intergenic
995829904 5:116344190-116344212 CTGCTGTTAGATTCAGGATAAGG + Intronic
995830367 5:116348397-116348419 CTCCTGAAAGAGGAAGGAAAAGG + Intronic
996435214 5:123426522-123426544 ATTCTGTTAGAGGAAGCACCAGG - Intergenic
998887093 5:146706121-146706143 CTGCTGTGCAAGGAAGCACAGGG - Intronic
999088446 5:148913664-148913686 CTGCTTCTGAAGGAAGGACATGG - Intergenic
999280873 5:150364781-150364803 CTGCTGTTGGGGAAAGTACAAGG - Intronic
999920346 5:156311651-156311673 CTGCTGGTAGAGGAGGGTAATGG - Intronic
999953826 5:156678768-156678790 CTGCAGTTAGAGGACAGAGAGGG - Intronic
1000229842 5:159305372-159305394 CTGCTGTCATAGGAAGCCCAAGG - Intergenic
1001356254 5:171026498-171026520 CTTCTGTTAAAGGAATGAAAAGG - Intronic
1002078818 5:176725892-176725914 CTGCAGCCAGAGGAAGGACCTGG + Intergenic
1005294619 6:24413212-24413234 ATGCTGTTAGGAGAAAGACAGGG + Intronic
1007138200 6:39543300-39543322 ATGGTGTAAGAGGAAGGAAAAGG + Intronic
1007789114 6:44298803-44298825 CTGTTGCTAGATGAAGGAAAGGG - Intronic
1008533799 6:52490813-52490835 CAGCTGATGGAGGAAGGGCATGG + Intronic
1008880842 6:56378654-56378676 CTGCCCTTAAGGGAAGGACATGG + Intronic
1011841902 6:91511257-91511279 TTGCTTTTGGAGTAAGGACAGGG - Intergenic
1012987146 6:105887280-105887302 CTGCTGTCAGAGGGAGGGAAAGG - Intergenic
1013386413 6:109636159-109636181 GTGCAGTAGGAGGAAGGACAGGG - Intronic
1013704073 6:112811809-112811831 CCGCTGTTATTGCAAGGACAGGG - Intergenic
1013788868 6:113813317-113813339 CTCCTCTTAGGGGAAGTACATGG + Intergenic
1014577298 6:123089458-123089480 CTGATGTTAGAATAAGGCCATGG - Intergenic
1015540566 6:134309487-134309509 CTGCTCTTAGACCAAGGACCAGG + Intronic
1016982916 6:149869255-149869277 CCGTTCTTAGAGGAAGGACGTGG + Intergenic
1017559342 6:155610132-155610154 CTGCTGTTAGAATAAGGATAAGG + Intergenic
1018873573 6:167801477-167801499 TTGTTGGTAGAGGAAGGAGAGGG - Intergenic
1019013004 6:168857634-168857656 CTGGGGATAGAGGGAGGACAAGG + Intergenic
1020643156 7:10780286-10780308 CGCCTGTTAGGAGAAGGACAGGG + Intergenic
1021723314 7:23525932-23525954 CTGCTGTTGGTTGAAGGAAATGG + Intronic
1022161309 7:27713846-27713868 CTAATGTTAGAGGAAGAACCTGG - Intergenic
1022759283 7:33329754-33329776 CAGCTGTTAGAGAAGGTACACGG - Intronic
1026510871 7:71026524-71026546 CAGCAGGTAGAGGAAGAACATGG - Intergenic
1029892118 7:103941381-103941403 CTGCTTTAAGAGGAAAGAAATGG - Intronic
1031301019 7:120060778-120060800 GTGCTGTAACAGGGAGGACATGG - Intergenic
1031564299 7:123276226-123276248 CTGCTGTTAAAGGTAAGGCATGG + Intergenic
1032373699 7:131386996-131387018 CTGCTAGTACAGGATGGACAAGG + Intronic
1032650118 7:133868965-133868987 CTGCTGGGAGAGGCAGGGCAGGG - Intronic
1032803535 7:135335320-135335342 CTGCTCCTGGAGGAAGCACAGGG - Intergenic
1033457941 7:141519205-141519227 GTGATGTTAGAGGAAGAGCAAGG - Intergenic
1034384606 7:150729742-150729764 CTAATGTTAGAGGCAGGACCTGG + Intronic
1034526797 7:151669222-151669244 CTGATGTGAGAGAGAGGACAGGG - Intronic
1034981777 7:155483715-155483737 CTCCTCATAGAGGAAGGACCGGG + Intronic
1036681308 8:10876450-10876472 CTGCTGGTGGAGGAAGAACATGG + Intergenic
1037739210 8:21591932-21591954 CTGGAGATAGAGGAAGAACAGGG + Intergenic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1039354706 8:36802275-36802297 CTGCTGTTGGAGAAATGTCAGGG + Intronic
1039992709 8:42503342-42503364 TTGGTGGTAGAGGAGGGACAGGG + Intronic
1040758484 8:50809087-50809109 CTGCTGTTAGAATAAGGATAAGG - Intergenic
1041222127 8:55662511-55662533 CTGAGGTTGGAGGAAGGAAAGGG - Intergenic
1042192062 8:66197037-66197059 CTGTTCTTAGAGGAAGCACTAGG + Intergenic
1042415002 8:68509106-68509128 CTGCTGTTAAAATAAGGATAAGG + Intronic
1042606994 8:70555493-70555515 TTGCTGTGACAGCAAGGACATGG - Intergenic
1042723433 8:71847900-71847922 ATGCTGTTGGAGGAAGGAAGTGG - Intronic
1043098917 8:76014764-76014786 CTGCTCCTAGAGGAAACACAGGG + Intergenic
1044615044 8:94131299-94131321 TTGCTCCTAGAGGAAAGACAGGG + Intronic
1045974105 8:108111670-108111692 TTGGTTTTAGAGGAAGGAAAAGG + Intergenic
1046329664 8:112698505-112698527 CTGATTTTAGGGGATGGACAAGG + Intronic
1048180715 8:132192090-132192112 CTGCTTTTAGAGCCAGGAGAAGG + Intronic
1049030245 8:140030838-140030860 CTGGAGTTAGAGGCAGGAGAGGG + Intronic
1049190574 8:141285192-141285214 CTGCTGTTGCAGGCAGGGCAGGG - Intronic
1049233483 8:141496224-141496246 CTGCTTTTGGTGGAGGGACATGG + Intergenic
1049271116 8:141696804-141696826 CTTCTTTTAGAGGATGTACAAGG + Intergenic
1049655082 8:143793727-143793749 CTCCTGTGTGAGGAAGGCCAGGG - Intronic
1050235597 9:3575986-3576008 CTTCTGCTAGAGGAAGGAAAAGG - Intergenic
1050247261 9:3703691-3703713 GTGTTGTTAGAGGAAAGTCAGGG + Intergenic
1051637374 9:19193105-19193127 CTGCTGTGAGAGGTAGGATGTGG - Intergenic
1052617142 9:30855403-30855425 CTGCTCTTAGAATAAGGATAAGG - Intergenic
1052699831 9:31924250-31924272 TGGATGTAAGAGGAAGGACATGG + Intergenic
1055587396 9:77769459-77769481 CAGCTGCTGGAGGAAGGAAATGG + Intronic
1056695283 9:88844883-88844905 TTGCTCTTAGGGGAAAGACAAGG + Intergenic
1056872670 9:90299064-90299086 CTTCTGTTAGCAGAAGAACATGG - Intergenic
1057698427 9:97344410-97344432 CCTCTGGTAGAGGAAGGAGAGGG - Intronic
1059167947 9:112096979-112097001 CTGCTGATACAGACAGGACAAGG + Intronic
1059255100 9:112922991-112923013 CTGGTGATAGAGGGAGGAAATGG - Intergenic
1059473981 9:114529109-114529131 CTGCTGATAGAGGTTCGACAAGG + Intergenic
1061804311 9:133129453-133129475 CTGCTGTGACAGGCAGGACCAGG + Intronic
1062572043 9:137190235-137190257 CTGCTGGCTGAGGAGGGACAAGG - Exonic
1062694612 9:137866990-137867012 CAGCTGGTAGAGGAAGGAATGGG - Intronic
1188773760 X:34187970-34187992 CAGATCTTAGAGGAAGGACTAGG + Intergenic
1188803496 X:34559745-34559767 CTGCTGTTAGAGTAAAGATAAGG + Intergenic
1189006502 X:37000201-37000223 CTCCTGTTAGAATAAGGAAAAGG - Intergenic
1189042136 X:37553808-37553830 CTGCTGTTAGAATAAGGATAAGG + Intronic
1190071895 X:47286521-47286543 CGGCCGTTAAAGGAATGACATGG + Intergenic
1190650432 X:52563570-52563592 CGCCTGTTAGTAGAAGGACAGGG + Intergenic
1190997143 X:55620894-55620916 CCAATGTTGGAGGAAGGACATGG - Intergenic
1192849770 X:74942606-74942628 CTGCTGTCACAGGAAGCACATGG - Intergenic
1193360294 X:80572784-80572806 CTGCTGGCAGGGGAAGGAGAAGG + Intergenic
1193561441 X:83022469-83022491 CTGCATTAAAAGGAAGGACATGG + Intergenic
1193631124 X:83889543-83889565 CTGCTGTGACAAGAAGCACATGG + Intergenic
1197062905 X:122202741-122202763 CTGCTGTTAAAAGAAAAACAAGG - Intergenic
1201225072 Y:11810782-11810804 CTGCAGATGGAGGAAGGGCACGG - Intergenic
1202270319 Y:23065929-23065951 CTGCCATTAGAAGAAGGATAAGG + Intergenic
1202295708 Y:23354753-23354775 CTGCCATTAGAAGAAGGATAAGG - Intergenic
1202423313 Y:24699674-24699696 CTGCCATTAGAAGAAGGATAAGG + Intergenic
1202447476 Y:24970412-24970434 CTGCCATTAGAAGAAGGATAAGG - Intergenic