ID: 978817603

View in Genome Browser
Species Human (GRCh38)
Location 4:112926919-112926941
Sequence GACTCACAGTTCCACAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20276
Summary {0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978817599_978817603 16 Left 978817599 4:112926880-112926902 CCTGAAACTGGGTAATTTATTAA 0: 14
1: 752
2: 9049
3: 14839
4: 14497
Right 978817603 4:112926919-112926941 GACTCACAGTTCCACAGGACTGG 0: 14
1: 381
2: 3819
3: 7199
4: 8863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978817603 Original CRISPR GACTCACAGTTCCACAGGAC TGG Intronic
Too many off-targets to display for this crispr