ID: 978819065

View in Genome Browser
Species Human (GRCh38)
Location 4:112944580-112944602
Sequence GTCCCAATGGGGAAGGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978819065_978819076 -9 Left 978819065 4:112944580-112944602 CCACCCCCCTTCCCCATTGGGAC 0: 1
1: 0
2: 0
3: 29
4: 330
Right 978819076 4:112944594-112944616 CATTGGGACCTCTAAATGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 151
978819065_978819080 14 Left 978819065 4:112944580-112944602 CCACCCCCCTTCCCCATTGGGAC 0: 1
1: 0
2: 0
3: 29
4: 330
Right 978819080 4:112944617-112944639 ATATCTAGGGTTTGATGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 87
978819065_978819079 1 Left 978819065 4:112944580-112944602 CCACCCCCCTTCCCCATTGGGAC 0: 1
1: 0
2: 0
3: 29
4: 330
Right 978819079 4:112944604-112944626 TCTAAATGGGTGGATATCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 95
978819065_978819078 0 Left 978819065 4:112944580-112944602 CCACCCCCCTTCCCCATTGGGAC 0: 1
1: 0
2: 0
3: 29
4: 330
Right 978819078 4:112944603-112944625 CTCTAAATGGGTGGATATCTAGG 0: 1
1: 0
2: 1
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978819065 Original CRISPR GTCCCAATGGGGAAGGGGGG TGG (reversed) Intronic
900102378 1:967378-967400 GTCCCACAGGGGCTGGGGGGGGG - Intronic
900654140 1:3746883-3746905 GTCCCACAGGAGAAGGGGGAGGG + Intergenic
901858120 1:12057236-12057258 GCCCCGGTGGGGAAGAGGGGAGG - Intergenic
902651014 1:17837620-17837642 GTGCCCTTGGGGGAGGGGGGCGG + Intergenic
903141787 1:21343668-21343690 GTCCCTGTGGGGAAGTGGAGGGG + Intronic
903164416 1:21510275-21510297 GGCACAATGGGGAGTGGGGGAGG - Intronic
904210966 1:28886966-28886988 GTCGCAGTTGGGAAGGGGCGGGG - Intergenic
904548399 1:31295017-31295039 GTTCCAGTGGGAAAGGGGGAAGG + Intronic
904621595 1:31778577-31778599 ATCCCTATGGGGAAGAGGAGGGG + Intergenic
905338381 1:37260833-37260855 ATCCCCATGGGGAAGGAAGGTGG - Intergenic
908728239 1:67199326-67199348 ATCGCAATGGGGTAGGGGGAAGG - Intronic
909698590 1:78494429-78494451 GTAACAATGGGGAAGTGGGAGGG + Intronic
910653082 1:89590923-89590945 GTCACAACTGGGAAGGGGAGTGG + Intronic
911348356 1:96722428-96722450 GAGCCGCTGGGGAAGGGGGGAGG + Intronic
911733078 1:101309878-101309900 GTCCGAATGAGGAAGTGGGTAGG - Intergenic
912514097 1:110207337-110207359 CTCCCAGTGGGGAAAGGGGAAGG + Intergenic
913274580 1:117124363-117124385 GTCTCAATAGGAAAGAGGGGAGG - Intergenic
913530326 1:119729459-119729481 GACCCCCTGGGGAAGGGGGCAGG - Intronic
914242071 1:145858934-145858956 GTCCAGATGGGGATGGGGGGAGG + Intronic
914815827 1:151061302-151061324 GCCACCATGGGGAAGGGGGAAGG - Intronic
914816227 1:151064685-151064707 GCCACCATGGGGAAAGGGGGAGG - Intronic
914869086 1:151458694-151458716 GGCCCGCTGGGGAAGGGGCGGGG - Intronic
914877780 1:151525104-151525126 GTCCCAAGGGGGACTGGGTGCGG + Intronic
915444301 1:155966206-155966228 GTCCGAATGGGGATGAGGGCTGG - Intronic
915529837 1:156497063-156497085 TTCCCAGTGGGGAAGCTGGGGGG - Intronic
915931147 1:160061741-160061763 GTGCAAAAGGGAAAGGGGGGTGG + Intronic
917209477 1:172616718-172616740 GCCCCAACTGGGAAGGGAGGGGG - Intergenic
919814974 1:201431459-201431481 TTCACAATGGGGCAGGGGGAGGG + Intergenic
920039312 1:203085455-203085477 GTCCCCTTGGGGCAGGGGGATGG + Intronic
921619665 1:217311777-217311799 GTCCCATTGGGGAAGAATGGGGG - Intergenic
922020663 1:221700973-221700995 GTGACAATGGGGTGGGGGGGTGG + Intergenic
1062832730 10:616951-616973 GTCTCAGTGGGGATGGGGGGTGG - Intronic
1066235429 10:33480553-33480575 GAGCCCATGGGGGAGGGGGGAGG + Intergenic
1067015617 10:42754896-42754918 GCCCCAGTGGGGAAGGGGCAAGG - Intergenic
1067075265 10:43175589-43175611 GTACCAATCAGGAAGGGGGTTGG + Intronic
1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG + Intergenic
1069707397 10:70467395-70467417 GTCCCAGTGGTGGAGGTGGGGGG + Intergenic
1069840147 10:71334755-71334777 GTATGAATGGGGATGGGGGGAGG - Intronic
1070671555 10:78380999-78381021 TTCCGGATTGGGAAGGGGGGAGG - Intergenic
1072293432 10:93987785-93987807 GTCTCAATATGGAAGGGGGCAGG + Intergenic
1074145101 10:110710638-110710660 CCCCCAAAGGGGAAGGGGGAGGG - Intronic
1074427947 10:113368708-113368730 GGCCCAATGGAGAAGAGGGCAGG - Intergenic
1075598025 10:123746603-123746625 GTCCCAAAAGGGAAGGCTGGAGG - Exonic
1075710850 10:124529888-124529910 GCCCCAGCGGGGAAGGGGTGTGG + Intronic
1075963391 10:126588212-126588234 GTCCCCAGGGGGAAGGGTGACGG + Intronic
1076305330 10:129462073-129462095 ATCCCAGTGGGGCAGGGGAGGGG + Intergenic
1076704285 10:132292902-132292924 GTCTGCATGGGGAAGGGAGGGGG - Intronic
1076843880 10:133059714-133059736 GTGCCAAGGGGGCAGGGCGGGGG + Intergenic
1077044376 11:537925-537947 GCCCCCATGGTGAAGGGGCGAGG + Intronic
1077192426 11:1260986-1261008 GTCCCCCTGGGGAGGGTGGGTGG + Intronic
1077589143 11:3478359-3478381 GTCACAAAGGGGTGGGGGGGGGG - Intergenic
1077634747 11:3834764-3834786 GTCCCAACTGGGAGTGGGGGAGG + Intronic
1078426302 11:11253796-11253818 GACTCAATGGGAAAGGAGGGTGG + Intergenic
1078715891 11:13838564-13838586 GTCCCAGTGAGGAGTGGGGGTGG - Intergenic
1079362075 11:19777577-19777599 TTCCTAAAGGGGATGGGGGGCGG - Intronic
1083292210 11:61696489-61696511 CTCCCACAGGGGAAGGGGAGGGG - Intronic
1084285615 11:68128660-68128682 GTCCCAAGGGGGGGCGGGGGTGG - Intergenic
1084956127 11:72692618-72692640 GTGCCAACGGGCAAGGGGGCAGG + Intronic
1085297910 11:75441307-75441329 GTCCCTGTGGGGCAGGGGAGAGG + Exonic
1088641644 11:111878893-111878915 GTCCCAAAGTGGAAAGGGTGGGG - Intronic
1089010823 11:115130261-115130283 TCCCCAAAGGGGAAGTGGGGAGG - Intergenic
1089116458 11:116099171-116099193 CTCCTACTGGGGTAGGGGGGAGG - Intergenic
1090239319 11:125170955-125170977 TGCCCAGTGGGGGAGGGGGGAGG + Intronic
1091408919 12:226511-226533 GTCCCTGTGGGGCAGGGGTGAGG + Exonic
1092203957 12:6604472-6604494 TTCCCAAGGGGGAATGGGAGGGG - Intronic
1093959221 12:25253995-25254017 ATCACAATGGGAAAGGGGGGAGG + Intergenic
1096110655 12:49027199-49027221 GTGCCAAGGGGGAAGGGGGCGGG + Exonic
1097017019 12:55994383-55994405 GTTCCTATGGGGGTGGGGGGAGG - Exonic
1097468242 12:59954134-59954156 GTGCCATGGGGGAAGGGGGGAGG + Intergenic
1099808977 12:87556648-87556670 GTCAGTATGGGGAAGGTGGGAGG + Intergenic
1100056742 12:90520856-90520878 GTCCCAAGGGGAAATGGGTGGGG + Intergenic
1101648885 12:106656699-106656721 GTCTCAAGGAGGAAGGGGAGAGG - Intronic
1102198512 12:111041665-111041687 GGTCCAATGGAGAAGGGGAGTGG + Intronic
1102426463 12:112847986-112848008 CTGCCAGTGGGGAAGGGGGTGGG - Intronic
1102899642 12:116626364-116626386 GCCCTAATGGGGTAGGTGGGTGG - Intergenic
1103794955 12:123496954-123496976 GTCCGAATGGGGCTGGGGGAGGG - Intronic
1104786915 12:131455855-131455877 GGCCCAGTGGGGAGGGGAGGTGG + Intergenic
1108240472 13:48458084-48458106 GTCCCAACTCGGAAGGGGCGGGG + Intronic
1112297412 13:98200389-98200411 ATCACAAAGGGGAGGGGGGGGGG - Intronic
1113614222 13:111669607-111669629 GTCCCGAGGGGGCAGGGGGCAGG - Intronic
1113619690 13:111754521-111754543 GTCCCGAGGGGGCAGGGGGCAGG - Intergenic
1113793913 13:113045754-113045776 ATCCCACTGGGGAAGGGAGGCGG - Intronic
1114370315 14:22079506-22079528 GACCAAAAGGGGATGGGGGGTGG + Intergenic
1115302252 14:31897642-31897664 GCACCAGTGGGGATGGGGGGAGG + Intergenic
1115426768 14:33269793-33269815 GTCCTAATAGGGAAGCAGGGAGG + Intronic
1116281181 14:42910195-42910217 GGCCCCATGGGGTAGGGGGAGGG - Intergenic
1118614936 14:67568829-67568851 GCCCCAAAGGTGAAGGGTGGAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118766077 14:68910039-68910061 GTCTCTATGGGGAAGGGGATGGG + Exonic
1119131921 14:72180846-72180868 GTCCCATGGTGGAAGGGGGAAGG - Intronic
1121011163 14:90521081-90521103 CTCCAAATGGGGAAGGGGTGTGG - Intergenic
1122289828 14:100674590-100674612 GTCCCAGTGGAGAAGGAGTGGGG + Intergenic
1122486012 14:102080533-102080555 GTCCCTCTGGGGACTGGGGGTGG - Intergenic
1202849875 14_GL000225v1_random:9673-9695 GTCAGGATGGGGAAGGGCGGTGG + Intergenic
1125522843 15:40357831-40357853 GCCCCACTGGGGAGGGGAGGAGG + Intergenic
1125555666 15:40582688-40582710 GTCCCAAAGGGGTGGGGGTGAGG + Intergenic
1126034996 15:44537347-44537369 GACCCAGTGCGGAAGGTGGGGGG + Exonic
1127906584 15:63380680-63380702 GTGCCCATGGGGAAGGGCAGGGG - Intronic
1128332687 15:66766177-66766199 GTGCCCATAGGGAAGGGAGGTGG + Intronic
1129068673 15:72932780-72932802 GTCCTGATGGGGCAGGGGGTGGG - Intergenic
1129333389 15:74838977-74838999 GTCCCCATGAGGAAGTGGGGGGG - Intronic
1129515373 15:76153971-76153993 GTCCCGAAGGGGCAGGAGGGAGG - Intronic
1129520485 15:76183026-76183048 GTTGCAATGGGGCAGGGTGGAGG + Intronic
1130981754 15:88816973-88816995 GTCTCAGTGGGGAAGGGAGTAGG - Intronic
1132701579 16:1224494-1224516 GTCCCAATGGGGGCCCGGGGAGG - Intronic
1132854393 16:2038418-2038440 GTCCCAAGGGGGAGGGGAAGGGG - Exonic
1133924590 16:10182599-10182621 GGCCCCCTTGGGAAGGGGGGAGG - Intronic
1135800393 16:25488918-25488940 GCAGCAATGGGGAAGGGGTGAGG + Intergenic
1136033315 16:27519229-27519251 GGCCTACTGGGGAAGGGGAGGGG + Intronic
1136140260 16:28283829-28283851 GTCGGAGTGGGGAAGGGGTGGGG - Intergenic
1137445528 16:48529612-48529634 GTCCCCATGGTGGAGGGGAGGGG - Intergenic
1137614017 16:49836351-49836373 GGCCCAGTGGGGGAGGGGGTTGG + Intronic
1138427166 16:56943008-56943030 GTGCCTATGGGGCAGGGGGCAGG + Intronic
1139589530 16:67925866-67925888 GTGGCAGTGGGGAAGGGGGTAGG + Intronic
1140128344 16:72136400-72136422 TTCCCAATGGGGCAGGTGTGAGG - Intronic
1141061872 16:80880891-80880913 TTCACAATAGGGAAGGAGGGCGG + Intergenic
1141245441 16:82302686-82302708 GTGCCAGTGGGGAGGGGAGGAGG - Intergenic
1141380188 16:83569260-83569282 GTTCCAATGGGGAGAGGGAGGGG - Intronic
1142221341 16:88856619-88856641 GGCCCCTTGGGGAAGGGGGGAGG - Intronic
1146595735 17:34166935-34166957 TTGCAATTGGGGAAGGGGGGTGG - Intronic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1150214562 17:63459501-63459523 GTCCCAATGGGCAGGGGCAGAGG + Intergenic
1150482156 17:65518866-65518888 CTCCCAATAGGTAAGGGGGCAGG + Intergenic
1152241759 17:79164693-79164715 GTCCCAAGTGGGAAGGCCGGGGG + Intronic
1152263646 17:79280832-79280854 GTCCCATTGTGGGGGGGGGGAGG + Intronic
1154263286 18:12856573-12856595 GTCCCAATGATGATGGAGGGAGG + Intronic
1156902646 18:42319455-42319477 GTCCTGATGGGGCAGGGGGCAGG - Intergenic
1157914860 18:51654952-51654974 GTCACAATGGGGAGGCGGAGTGG - Intergenic
1159158245 18:64610512-64610534 GTCACAATTGGGGAGGGAGGAGG - Intergenic
1159746999 18:72249164-72249186 GTCACACTGGGGATGGGAGGCGG + Intergenic
1160363393 18:78303597-78303619 GTCTCCATGAGGAAGCGGGGAGG + Intergenic
1160712518 19:559089-559111 GTCCTCATGGGGGCGGGGGGTGG - Intergenic
1160974304 19:1785132-1785154 GCCCCCATGGGGAAGTGGGACGG - Intronic
1161977789 19:7615779-7615801 GCCCCCATGGGTAAGGGGGGAGG + Intronic
1162532075 19:11241861-11241883 GCCCCATTGGGGAGGGGTGGAGG + Exonic
1162565930 19:11445915-11445937 GACCGAATGGGCAAGGGTGGGGG + Intronic
1162584937 19:11552826-11552848 GTCACAATAGGAAATGGGGGAGG - Intronic
1162845274 19:13387539-13387561 GTCCCAGTGGGGAAGGTGAGTGG - Intronic
1162956701 19:14102788-14102810 GTCCCAGTGGCCAAGGGCGGGGG - Intronic
1163242133 19:16070723-16070745 GGCCCAAAGGGGAAGTAGGGCGG - Intronic
1163607164 19:18281677-18281699 CACCCAATGGCGAACGGGGGCGG - Intergenic
1164305834 19:24003475-24003497 GGCCCAGTGAGGGAGGGGGGCGG + Intergenic
1164919352 19:32077277-32077299 TTCCCAATGGGAAAGGGAGCTGG - Intergenic
1165068560 19:33242244-33242266 GACCTAAGGGGGATGGGGGGTGG - Intergenic
1165447790 19:35866241-35866263 GGCCCAAGGGGGGAGGGTGGTGG - Exonic
1165490931 19:36122192-36122214 GTCCACCTGGGGAAGGGGAGCGG + Intronic
1165792631 19:38501018-38501040 GTCCCTCTGTGGAAGTGGGGAGG - Intronic
1166047241 19:40236633-40236655 TTCACAATGGGGACGGTGGGTGG - Intronic
1166387704 19:42391358-42391380 CTCCAAATTGGGAAGGGAGGAGG + Intergenic
1166816084 19:45547065-45547087 TTTCCTATGGGGAAGGAGGGAGG + Intronic
1167253611 19:48414654-48414676 GTCCCAAGGGAGGAGGGGGCTGG - Intronic
1167375272 19:49107803-49107825 GTCCCTGTGCGGAAGCGGGGAGG - Exonic
1167495044 19:49812774-49812796 GTCCTAAGGGGGAAGGGGATGGG - Intronic
1168144995 19:54415732-54415754 GTCCCGAGGGAGAAGGGGGCTGG + Intronic
1168149088 19:54435488-54435510 GTGCCGATGGGGGAGGGGGTGGG + Intronic
925777013 2:7345722-7345744 GACCCAATGTGGCAGGGGTGAGG + Intergenic
925838265 2:7966415-7966437 GTCCCAAAAGGGAAGGAGGAGGG + Intergenic
926633845 2:15160572-15160594 GTCCCAGTGTGGGCGGGGGGAGG + Intergenic
927141161 2:20131794-20131816 TTTCCAGTGGGGAAGGGGAGGGG - Intergenic
928113302 2:28527340-28527362 TACCCAATGGGGAAGGAGGGAGG + Intronic
928178792 2:29053196-29053218 GTTCCACTGGGGAAGGGCAGGGG - Exonic
929563231 2:42968728-42968750 GACCCAAGGGGAAAGGGGTGAGG + Intergenic
931288367 2:60851141-60851163 TTGCCAATGGGGATGTGGGGTGG - Intergenic
931631934 2:64309901-64309923 GTCCCAAAGGGGAACGGGCACGG + Intergenic
937259851 2:120578353-120578375 GTCCCAGTGGGGAAGAGTAGGGG + Intergenic
938691554 2:133794617-133794639 TTGCCAGTGGGGAATGGGGGAGG - Intergenic
939723163 2:145680388-145680410 GTCCCAGTGGAGAAGAGGGATGG - Intergenic
940150244 2:150592202-150592224 GTCACAACTGGGATGGGGGGTGG - Intergenic
940517573 2:154699487-154699509 CTCCCGGTGGGGAAGGGGCGGGG - Intronic
942192964 2:173489111-173489133 GCCACACTGGGGAAGGGGAGAGG - Intergenic
942707246 2:178789560-178789582 ATCCCCATGAGGAAGGGGGAAGG - Intronic
943639718 2:190344253-190344275 GGCCCGATGGGGTTGGGGGGCGG + Intronic
943697533 2:190952183-190952205 TTCTTAATGGGGAATGGGGGTGG - Intronic
945031807 2:205672074-205672096 GCCCCATTGGGGAAGGTGGGAGG + Intergenic
945698656 2:213142223-213142245 GTCAGAATTGGGGAGGGGGGTGG - Intronic
945905595 2:215589129-215589151 GTGGCATTGGGGGAGGGGGGAGG + Intergenic
946004384 2:216510723-216510745 GTCCCCATGGGGAAGAGTTGGGG - Intronic
946386252 2:219386201-219386223 GTACCCGTGGGGAAGAGGGGTGG - Intronic
946944725 2:224808877-224808899 GTAGCAATGGGGGAGGGAGGGGG + Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948211479 2:236196433-236196455 GTCTCAGTGGGGAAAGGGTGGGG + Intronic
948426050 2:237887075-237887097 CTGCCCATGGGGAAGGGGTGGGG + Intronic
948826116 2:240574132-240574154 GCCACGATGGGGAAGGAGGGTGG - Exonic
1168760616 20:347507-347529 GTGCCGGTGGGGAAGGGAGGCGG + Intronic
1168846289 20:946914-946936 GTCCCACTGGGGAGGGTGGCTGG + Intergenic
1169660403 20:7972642-7972664 CTCCAAATGGGGAAGGGGGAGGG + Intergenic
1170387501 20:15835323-15835345 GTTCCCATGGAAAAGGGGGGAGG - Intronic
1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG + Intronic
1170882375 20:20308424-20308446 GTACAGATGGGGAAGGGGGCTGG + Intronic
1172101166 20:32484403-32484425 GTGCGGATGGGGAAGGGGGAGGG - Intronic
1172676544 20:36676870-36676892 GTCCCAACCCGGAAGGGGCGGGG - Intronic
1172691433 20:36793237-36793259 TTCCCAATGAGGTAGGTGGGTGG - Exonic
1173911518 20:46674353-46674375 CTCACTATGGGGAAGGGGGCAGG + Intronic
1173934265 20:46847407-46847429 GTCCCCTTGGGGCAGGGTGGTGG - Intergenic
1174602889 20:51739145-51739167 GCACCCATGGGGAAAGGGGGAGG - Intronic
1174907860 20:54571620-54571642 GTATCTCTGGGGAAGGGGGGTGG + Intronic
1175833036 20:61977507-61977529 GGCAGAACGGGGAAGGGGGGAGG - Intronic
1175838704 20:62013283-62013305 GTCGCAAAGGGGTAGGGAGGTGG + Intronic
1175878390 20:62242194-62242216 GTCCCACTGTGGAAGCGTGGTGG + Intronic
1175994498 20:62806004-62806026 GGTCCAAAGGGGAAGGGGAGGGG - Intronic
1176093942 20:63331017-63331039 GCCGCAGTGGGGAAGGGGAGGGG + Intronic
1179025737 21:37676940-37676962 GTCCCAATGGGGACTGGTGGAGG - Intronic
1179568615 21:42264753-42264775 GGCCACATGGGGAAAGGGGGAGG + Intronic
1179980782 21:44894674-44894696 GTCTCTATGGAGAAGGGAGGTGG - Intronic
1181060444 22:20279687-20279709 GCCGCAATGGGGTAGGTGGGAGG + Intronic
1182007386 22:26972133-26972155 GTCCCAATGGGTCTGGGAGGCGG + Intergenic
1182050814 22:27311317-27311339 GTCCTAATGGGGACAGGGAGAGG - Intergenic
1182457326 22:30460275-30460297 GTTCCCATGGGGAAGGGAAGAGG - Intronic
1183037315 22:35150088-35150110 ATCCCCTTGGGGAAGGGGGCAGG - Intergenic
1183433021 22:37777184-37777206 GTCTCAATGGTGCAGGGGGTGGG + Intergenic
1183456402 22:37925518-37925540 GTCCCCATGGGGATGGGGGTGGG + Intronic
1184846331 22:47090085-47090107 GTCCCAGAGGGGTGGGGGGGCGG + Intronic
949323412 3:2837576-2837598 GTGCCATTTGGGAACGGGGGTGG - Intronic
950008259 3:9704875-9704897 GTCCGAACTGGGTAGGGGGGTGG - Exonic
952543341 3:34391730-34391752 CTCCAAATGGGGAATGTGGGAGG + Intergenic
954367996 3:50156235-50156257 GTCCCAGTGGTGAAGTGGGCAGG + Intronic
954636131 3:52071793-52071815 GTGCCAGTGGGGATGGTGGGGGG - Intergenic
955845561 3:63159405-63159427 GTGGCATTGGGGAAGGTGGGTGG - Intergenic
958057053 3:88426876-88426898 GTACCACGGGGGATGGGGGGGGG + Intergenic
958425499 3:93974083-93974105 TTTCCAAAGGGGAAGGGGTGGGG + Intergenic
960943012 3:122946812-122946834 GTCAGAATGGGGAAGGGGAGAGG + Intronic
961876108 3:130025026-130025048 TTCCCAATATGCAAGGGGGGAGG + Intergenic
962272353 3:133987158-133987180 TTCACAATGGGGATGGGTGGGGG - Intronic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
963001841 3:140688558-140688580 GGCCCAGTGGGGAAGTGGGAGGG + Intronic
965081183 3:164034698-164034720 ATCCCCCTGGGGATGGGGGGAGG + Intergenic
967412137 3:189177679-189177701 GTACCAAATGGGAAGGGGGGTGG + Intronic
967857844 3:194131715-194131737 GTCCCATTTGAGAAGGGGTGGGG + Intergenic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
968619239 4:1596402-1596424 GTACCTTTGGGGAAGGTGGGTGG - Intergenic
968659938 4:1794702-1794724 GTCCCAAGGGGCGAGGGGAGGGG + Intronic
969734489 4:8977945-8977967 TTCCCAATATGCAAGGGGGGAGG - Intergenic
969785905 4:9456820-9456842 TTCCCAATATGCAAGGGGGGAGG - Intergenic
971301080 4:25442875-25442897 CTCCCGATGGGGAGGGGTGGTGG + Intergenic
973981050 4:56308672-56308694 GTCACAATGGGCAACAGGGGAGG - Intronic
974278595 4:59759700-59759722 GCCCCAACTGGGAAGGGGTGTGG + Intergenic
976064627 4:81171163-81171185 AGCCCAATGGGGAGGGGTGGGGG - Intronic
978318052 4:107462230-107462252 GTCTCCATGGGGCATGGGGGAGG + Intergenic
978819065 4:112944580-112944602 GTCCCAATGGGGAAGGGGGGTGG - Intronic
979591030 4:122480405-122480427 GTCCCCTTGGTGAAGAGGGGGGG + Intergenic
979831875 4:125314887-125314909 GGCCCAATGGGGCTGGGGCGAGG + Intergenic
981568971 4:146131672-146131694 GCTCCAGTGGGGAAGGGTGGAGG - Intergenic
984231165 4:177100889-177100911 GTCCCATGGTGGGAGGGGGGAGG + Intergenic
985477896 5:90206-90228 GGCCCTATGGGGTGGGGGGGGGG - Intergenic
985544466 5:502244-502266 GTCCCAGAGAGGAAGGGGTGTGG - Intronic
986782911 5:11083833-11083855 CCCCCATGGGGGAAGGGGGGTGG - Intronic
987492476 5:18598316-18598338 GTCCCTTTGGGGAAGGGCTGGGG - Intergenic
989350941 5:40486094-40486116 TCTCCAATGGGGAATGGGGGTGG - Intergenic
989607266 5:43256570-43256592 GGCCCAAGGGGGAATGGGGGAGG - Intronic
990208314 5:53453895-53453917 GTGCCATTGGGGAGGGGGTGGGG - Intergenic
990988749 5:61664640-61664662 TTCCAAATGGGGAAGGTGGGTGG + Intronic
991113247 5:62925297-62925319 GGCTCACTGGGGAAGGGGGTGGG + Intergenic
993012406 5:82498570-82498592 GTCTCAAAAGGGAAGGGGAGGGG - Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
994085214 5:95750750-95750772 GTCTTTATGGGGAATGGGGGAGG + Intronic
994450093 5:99930096-99930118 GCCCCAATTGGGAAGGGGTGAGG + Intergenic
995428475 5:112049482-112049504 GCCCCTAGGGGGATGGGGGGAGG + Intergenic
996542979 5:124648971-124648993 GGGCCAATGGGAAAGGGAGGCGG - Exonic
997594240 5:135095602-135095624 CTCCCAATGAGGGAGGGGAGGGG - Intronic
997614668 5:135238129-135238151 GTCACAATGGGGATGTGAGGAGG + Intronic
998371495 5:141664876-141664898 GAGCCAATGGGGGTGGGGGGTGG - Intronic
1001142120 5:169153202-169153224 GGGCCAATGGGGAGGGGAGGAGG + Intronic
1001209372 5:169795881-169795903 CTGGCAATGGGGAAGGGGCGGGG - Intronic
1001487096 5:172127569-172127591 GGCCCACTGGGGGAGGGGGACGG - Intronic
1001535754 5:172496840-172496862 GTGCCCATGGGGAAGGGGCTCGG + Intergenic
1002415220 5:179116924-179116946 GTGCCAAGGAGGAAGGGGGAGGG + Intronic
1003571410 6:7258704-7258726 GTCCCACTGGGGAAGTCGGGAGG + Intergenic
1004504642 6:16238371-16238393 GACCGAATGGGGACGGGGGAGGG - Intergenic
1007509162 6:42362349-42362371 GCGACAGTGGGGAAGGGGGGTGG - Intronic
1008828226 6:55725717-55725739 GTCACAATTGGGAAGGGGAGTGG + Intergenic
1009934838 6:70221803-70221825 GTCCCAATGGGCAAGTTTGGTGG + Intronic
1011240670 6:85268136-85268158 CTCTCAATGGGGTAGGGTGGGGG + Intergenic
1011274065 6:85611511-85611533 ATCCCTTTGGGGAAGGGGGGAGG + Intronic
1011586630 6:88933063-88933085 GACCCAAGGGGGAAAGAGGGAGG - Intronic
1012891991 6:104907517-104907539 CTGCCACTGGGGAATGGGGGAGG - Intergenic
1013212924 6:108002809-108002831 CTCCCTATGGGGAAGGAGGGAGG - Intergenic
1014007991 6:116443095-116443117 GACCCAATGGGGAAGAGGTTAGG + Intergenic
1015953449 6:138576704-138576726 GTCCCGCTGGTGAAGGAGGGGGG - Intronic
1016395238 6:143617138-143617160 GTGGCAGTGGGGAAGGGGAGAGG + Intronic
1017146404 6:151239731-151239753 GTTCCCCGGGGGAAGGGGGGCGG + Intergenic
1018488078 6:164262748-164262770 TTCCCAATGTGGAGTGGGGGAGG - Intergenic
1018813867 6:167316699-167316721 GAACCAAAGGGGAAGGGGAGGGG - Intergenic
1019595035 7:1854509-1854531 GTCACACGGGGGAAGGGGCGGGG + Intronic
1019648147 7:2141881-2141903 GTCCCAGTGGAGAAGAGAGGGGG + Intronic
1019698731 7:2461883-2461905 GTCCCCATGTGGAAGGAGTGTGG + Intergenic
1020080801 7:5284724-5284746 GTCCCCATGGTGGAGGGGGTGGG - Intronic
1020307156 7:6844063-6844085 GTCACCAAGGGGCAGGGGGGGGG - Intergenic
1022724048 7:32964941-32964963 GTCCCATTCGTGAAGGGTGGTGG + Intronic
1022858689 7:34342643-34342665 GTCCCAGTGGGGAAGGCAGATGG + Intergenic
1023202328 7:37712168-37712190 GTCCCAAGGGGGAGAGTGGGTGG + Intronic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023742650 7:43294360-43294382 TTCCCATGGGGGGAGGGGGGAGG + Intronic
1024142951 7:46480615-46480637 GTTACACTGGGGAAGAGGGGTGG + Intergenic
1024202043 7:47117598-47117620 GTCCCATGGTGGAAGGGGTGAGG - Intergenic
1025049564 7:55722974-55722996 GTCCCATTCGTGAAGGGTGGTGG - Intergenic
1025198115 7:56947443-56947465 GTCCCCATGGTGGAGGGGGTGGG + Intergenic
1025673834 7:63629494-63629516 GTCCCCATGGTGGAGGGGGTGGG - Intergenic
1025939914 7:66068314-66068336 GTTCCAAAGGAGAAGGGGGGTGG - Intergenic
1026129719 7:67610161-67610183 GTCGCAAAGGGGAAGGGAGAGGG + Intergenic
1027682285 7:81235890-81235912 GTTCCAATGGGGAAAGTGGAAGG - Intergenic
1027820887 7:83043112-83043134 GTCACAATGGGGAAAGGGAAGGG - Intronic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1029113250 7:98223980-98224002 GTCTCCCTGGGGAAGGGGGTCGG + Intronic
1029736635 7:102469068-102469090 GTCCCAGGGGTGAAGGGGAGGGG - Intronic
1030168744 7:106580472-106580494 GTCTCTATAGGGAAGGGGTGGGG + Intergenic
1031983763 7:128148795-128148817 ATCCCACTGGGGTAGGGGTGGGG + Intergenic
1032729460 7:134623821-134623843 GCCCAAATGGGAAATGGGGGAGG + Intergenic
1033306751 7:140230858-140230880 AGCCCGATGGGGAAGGGCGGCGG + Intergenic
1033738123 7:144244945-144244967 GTCTCAATGGGGGGGGTGGGGGG - Intergenic
1033744930 7:144306008-144306030 GTCTCAATGGGGGGGGTGGGGGG + Intergenic
1034123793 7:148652785-148652807 GTACTAAAGGGGAAGAGGGGAGG + Intergenic
1035177037 7:157058843-157058865 GTGCCCATGGGGAAGGCGTGGGG + Intergenic
1038126173 8:24675254-24675276 CTCCCAAGGGGAAAGAGGGGAGG + Intergenic
1038278256 8:26139782-26139804 CTCCCCATGGGGAAGAGGGAGGG - Intergenic
1038804658 8:30779065-30779087 CTCCAACTGGGGAAGGGGTGAGG + Intronic
1039549544 8:38432910-38432932 ATCCCAACTGGGGAGGGGGGGGG - Intronic
1039834596 8:41246497-41246519 GTCCCCAAGGGGAAGGGAGAGGG + Intergenic
1042503314 8:69533403-69533425 GGCCCACTGGGGGAGGGGGACGG - Intronic
1043099349 8:76020863-76020885 TTCCCAATGGGGTTGGGGTGGGG - Intergenic
1045506251 8:102780894-102780916 GACCCAGTGAGGAAGAGGGGAGG + Intergenic
1047372135 8:124264994-124265016 GTCACAATTAGGAAGGGGGAAGG - Intergenic
1048029045 8:130613620-130613642 GTCCAAATGGGGAAGCCAGGAGG + Intergenic
1049012255 8:139894901-139894923 GTCCCAGAGTGGAAGGGGGAAGG + Intronic
1049237329 8:141518782-141518804 GGCCCGGCGGGGAAGGGGGGCGG + Intergenic
1049861268 8:144901094-144901116 GGCCCAAGGGGGTAGGGGCGGGG + Intronic
1053127251 9:35592290-35592312 GTCCCAAAGGGAATGTGGGGAGG - Intergenic
1054967555 9:71046617-71046639 GTGACAATAGGGAAGGAGGGTGG - Intronic
1056160780 9:83890316-83890338 CTCCCAATGGGGTATGAGGGAGG + Intronic
1056359357 9:85839006-85839028 CTCCCAATGGGGTATGAGGGAGG - Intergenic
1056378777 9:86038531-86038553 GTCCCACTGGGGTAGGGAGTGGG + Intronic
1057258372 9:93568803-93568825 CTCCCAGTGGGGAAGGGTGGGGG + Intergenic
1058647291 9:107142465-107142487 GCCCCTATGGGGAATGGGAGAGG + Intergenic
1060151726 9:121293125-121293147 GTCCCCATCGGGAAGGTGGTTGG + Intronic
1060282333 9:122222861-122222883 CTCCCAACGGGGCAAGGGGGAGG - Intronic
1060827072 9:126693610-126693632 GGGCCAGTGGGGATGGGGGGTGG - Intronic
1060966915 9:127716676-127716698 GTCCCTAAGGGGAATGGGGCTGG + Exonic
1061216573 9:129225199-129225221 GTCCCAAGGGGGAGAGGGAGGGG - Intergenic
1061572355 9:131485621-131485643 GTCCCCAAGGGGAAGCGTGGGGG + Intronic
1062154331 9:135038054-135038076 GTCCCTGTGGGGAAGGAGAGGGG + Intergenic
1062166061 9:135107880-135107902 GTGGCAATGGTGAAGGAGGGAGG - Intronic
1062331662 9:136047608-136047630 GTCCCATTGGGGCTGAGGGGTGG - Intronic
1062375954 9:136262017-136262039 GTCCCCATGGAGCAGGGGAGGGG - Intergenic
1062411980 9:136430242-136430264 GGCCCAAGGGGGAAGGTGAGCGG + Intronic
1062572446 9:137191889-137191911 GGTCCAAGGGGGAAGTGGGGTGG - Exonic
1203788192 EBV:139595-139617 GCCCCATTGGGGAGGGGGGGTGG + Intergenic
1185621203 X:1452479-1452501 GTCCCCATAGGGATGGGGGAGGG - Intronic
1187588120 X:20686381-20686403 TTCCCAATGTGGGAGGGAGGTGG + Intergenic
1187597962 X:20795928-20795950 ATTCCAATGGAGAAGTGGGGAGG + Intergenic
1190296226 X:49029521-49029543 GTTCCTATAGGGAAGGGGTGGGG + Exonic
1190296311 X:49029858-49029880 GTCCCACAGGGGCAGGGGTGAGG + Exonic
1190445026 X:50515274-50515296 GTCCCAACTCAGAAGGGGGGGGG + Intergenic
1191714646 X:64185892-64185914 CACCCAATGGGGAAGGAAGGGGG - Exonic
1192584595 X:72309129-72309151 GTCCGGATGGGGGAGGGGGCTGG - Intergenic
1194743725 X:97606133-97606155 GCCCCACTGGGGAGTGGGGGTGG - Intergenic
1195378425 X:104249797-104249819 CTCCCAATGGGGCAGGGTAGAGG + Intergenic
1196798814 X:119523959-119523981 GGCCCCATGGGGAAAGGGAGAGG + Intergenic
1198761545 X:140038294-140038316 GTGCTACTGGGGAATGGGGGAGG - Intergenic
1198808632 X:140512303-140512325 GTCTGAGTGGGGAAGTGGGGAGG - Intergenic
1200070094 X:153524940-153524962 GTCCCCATGGGGTGGGGTGGCGG + Intronic
1200731558 Y:6748419-6748441 GACTCAAGGGGGAAGGTGGGAGG - Intergenic