ID: 978823995

View in Genome Browser
Species Human (GRCh38)
Location 4:112999150-112999172
Sequence TCTGTATTGCAGAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978823995 Original CRISPR TCTGTATTGCAGAGGGAAAC TGG (reversed) Intronic
900745292 1:4356634-4356656 TGCGTTTTGCAGAGGGAGACAGG + Intergenic
901579458 1:10229027-10229049 GCTGTATTTCAGAGGGAACTCGG + Intronic
904372680 1:30059997-30060019 TCTGTAATCCAGAAGGAAAGGGG - Intergenic
905646887 1:39631126-39631148 TCTGTAGTGCAGAGGGATGAGGG + Intronic
909018937 1:70410332-70410354 TCTGTATTGCTTAGGGAACAGGG + Intergenic
913189845 1:116404341-116404363 CCAGCATTACAGAGGGAAACAGG - Intronic
915912686 1:159924457-159924479 TCTGTGGGGCAGAGAGAAACGGG - Intronic
917081222 1:171258640-171258662 TCTGTAATGCAGACGGAGCCAGG - Intronic
919786239 1:201260166-201260188 TCCCTCTTGCAGAGGGAAATTGG - Intergenic
919947723 1:202333205-202333227 TATGTGTTGCAGAGGAAAATGGG + Intronic
922584551 1:226723743-226723765 TCTGTTTTGTAGGTGGAAACTGG - Intronic
922773711 1:228205437-228205459 TCTGTATTCCAGGAGGAAAGAGG - Intronic
923000617 1:230003886-230003908 TCTGGTTTGCTGTGGGAAACAGG - Intergenic
923172157 1:231428135-231428157 TCTCTATTGCAGTGTGAAAATGG - Intergenic
924110581 1:240695645-240695667 TCTGTATGGCAGAGAGTAAAGGG - Intergenic
1062844570 10:694007-694029 TCTGTATGGCCGGGGGAAGCAGG + Intergenic
1062995406 10:1861118-1861140 TGTGTACTGAAGAGGGAAGCAGG - Intergenic
1066186703 10:33016455-33016477 TCTTTATAGCAGTGGGAAAACGG - Intergenic
1066360327 10:34724024-34724046 TGTTCACTGCAGAGGGAAACAGG + Intronic
1067170409 10:43901471-43901493 TCTGTGGTGCAGTGGCAAACAGG + Intergenic
1067382534 10:45788055-45788077 TTTGTTTTGCACAAGGAAACAGG - Intronic
1067574755 10:47402154-47402176 TCTGTATTGCAGAGCCATAAAGG - Intergenic
1067890237 10:50128603-50128625 TTTGTTTTGCACAAGGAAACAGG - Intronic
1069381853 10:67849793-67849815 TCTGTATTGCAGAATGAAATCGG + Intergenic
1070399075 10:76036791-76036813 TCTGTAGTGGGGATGGAAACAGG + Intronic
1073305378 10:102499671-102499693 TCTGCATTGCTGATGAAAACAGG + Intronic
1075393393 10:122109697-122109719 TCTGGGTAGCAGAGGGAAAGTGG + Intronic
1076163223 10:128262069-128262091 TCTGTACCGCAGAGGGAATTAGG - Intergenic
1076183688 10:128430569-128430591 TCTGCATGCCAGAGGGACACAGG - Intergenic
1077484775 11:2833639-2833661 CCTGTCTTGCAGAGGCAAAATGG + Intronic
1081474094 11:43408342-43408364 TCTGTATTTCAAAAGAAAACAGG - Intronic
1082836527 11:57654886-57654908 TCTGTATTTTAGAGGCAAAATGG + Intronic
1083484021 11:62971709-62971731 CCTGTAACCCAGAGGGAAACCGG - Intronic
1083754408 11:64782847-64782869 GCTCTATTGCAGAGTGAAATGGG + Intergenic
1087251326 11:95903687-95903709 TCTGTATTTTTGAGTGAAACAGG - Intronic
1089182836 11:116594899-116594921 TCTGTCTTGCAGAGGACACCAGG - Intergenic
1090265206 11:125349243-125349265 TGAGGATTGCAGAGGGAAAAAGG - Intronic
1091264195 11:134257743-134257765 TGTGTATTGCTTAGGGAATCAGG + Intronic
1091397944 12:165412-165434 TCTGTTCAGGAGAGGGAAACAGG - Exonic
1093084373 12:14850728-14850750 ACTGAATTTCAGAGGGCAACAGG + Intronic
1094083508 12:26563673-26563695 TGTGTATAGCAGAGGCAGACTGG - Intronic
1094725489 12:33110377-33110399 TGTGTAATGCTGAGGGAAAGAGG + Intergenic
1095240452 12:39852728-39852750 TCTGCATTGCAGATGAAAAATGG + Intronic
1095919314 12:47513679-47513701 TCTCTATGGCAGGGGGAAAATGG - Intergenic
1099397544 12:82159356-82159378 TCTGTATAGCAGTGTGAAAACGG + Intergenic
1100492846 12:95098069-95098091 TCTGGATTTCAGAGGGAAGTAGG - Intronic
1101963502 12:109266647-109266669 ACTGTTTTGCAAAAGGAAACAGG - Exonic
1103050651 12:117776553-117776575 TCTATATTGCTGGGGGTAACTGG + Intronic
1107692093 13:42963626-42963648 TGTGTATTGGGGAGGGAAAAGGG + Intronic
1110802482 13:79715415-79715437 TCTGTATAGCAGTGTGAAAATGG - Intergenic
1111334030 13:86798182-86798204 TCTGAAATTCAGAGAGAAACTGG - Intergenic
1111664496 13:91249926-91249948 TCTGTATAGCAGTGTGAAAACGG - Intergenic
1116693813 14:48146551-48146573 GCTGTATTTCTGAGGGAAATTGG - Intergenic
1118642086 14:67802282-67802304 TCTGAATTACAAAGAGAAACAGG + Exonic
1119086386 14:71743239-71743261 ACTACCTTGCAGAGGGAAACAGG + Intergenic
1120261264 14:82189056-82189078 TCTGGACTGCAGAGGAAGACAGG + Intergenic
1122646117 14:103195360-103195382 TCTTTATAGCAGTGTGAAACTGG + Intergenic
1123158209 14:106251203-106251225 TCTTTATAGCAGTGGGAAAATGG + Intergenic
1124204945 15:27709648-27709670 TCTTTATAGCAGTGGGAAAATGG + Intergenic
1125344896 15:38709333-38709355 TCTGGATTGCAGCGGCTAACAGG - Intergenic
1125631956 15:41154470-41154492 TGTTTATTGCATAGGCAAACAGG - Intergenic
1130647020 15:85737546-85737568 TCTGTATTTTAGGGGGAAAAAGG - Intronic
1131090777 15:89623461-89623483 CATGTTTTGGAGAGGGAAACGGG + Intronic
1131222621 15:90597812-90597834 TCTCATTTGCTGAGGGAAACAGG + Intronic
1141277141 16:82598587-82598609 TCTACATTGCAGAGGGAAGTGGG - Intergenic
1141411275 16:83834786-83834808 TCTTTATAGCAGTGGGAAAATGG + Intergenic
1143950032 17:10625049-10625071 TCAGCATTGCTGAGGGTAACCGG + Intergenic
1144312669 17:14027083-14027105 TCTTGATGGCAGAGGGAGACTGG + Intergenic
1144373334 17:14614257-14614279 TCTGTCTTGTGGAGAGAAACAGG + Intergenic
1145897358 17:28467095-28467117 TCTGTAAAGCAGGGGAAAACTGG - Intronic
1149641567 17:58206218-58206240 TCTGCACTGCAGAGAGAAACAGG + Intronic
1151197814 17:72444521-72444543 TGTGTATTCCAGAGGGACACAGG + Intergenic
1152782799 17:82233618-82233640 TGTGTTTTGCAGGGGGAACCTGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159526739 18:69601876-69601898 TCTGTATGTCAGAGGGACACAGG + Intronic
1160101703 18:75926170-75926192 TCTGTGTTGCAGAGGTTAAAGGG - Intergenic
1160573720 18:79836537-79836559 TCTGTATAGCAGTGTGAAAATGG - Intergenic
1161075900 19:2285642-2285664 TCTGTCTTGTGGAGGAAAACAGG + Intronic
1164230962 19:23287930-23287952 TCCATTTTGGAGAGGGAAACTGG - Intergenic
1166057857 19:40304027-40304049 TCTGTATGGCACAAGCAAACAGG - Intergenic
1168127341 19:54292759-54292781 TCTTTATTCTAGAGGGTAACTGG + Intergenic
1168673250 19:58257555-58257577 TCTGTGTTGCAGATGAAAAATGG - Intronic
925314159 2:2908436-2908458 TCCGTGTTGCAGATGGAAATAGG - Intergenic
926019821 2:9485184-9485206 TCTGTGATGAATAGGGAAACTGG + Intronic
926663789 2:15497660-15497682 TCTGAAGTGCAGAGGAGAACTGG + Intronic
926814285 2:16784976-16784998 TCTGTATTCCAGATGGAAAGAGG + Intergenic
928422225 2:31146921-31146943 CCAGTATTGCAGAGGAAAAGCGG + Intronic
928593802 2:32841956-32841978 TCTTTATAGCAGTGTGAAACGGG + Intergenic
928740037 2:34340977-34340999 TCTTTATAGCAGTGGGAAAATGG - Intergenic
930006023 2:46897979-46898001 GCTGAATTGCAGATGGGAACAGG - Intergenic
931109722 2:59097804-59097826 TCTTTATGGCAGTGTGAAACTGG - Intergenic
933900147 2:86843930-86843952 TCTAAATTGAAGAGGGCAACAGG - Intronic
934519618 2:95011714-95011736 TCTGCATTGAAGAAGGAACCTGG + Intergenic
937287900 2:120764584-120764606 TCTGTGTTGTAGAAGGGAACAGG + Intronic
938246449 2:129781037-129781059 CCTGTATAGCAGAGGGGAAGTGG + Intergenic
938312478 2:130302119-130302141 TCTGTGTTGCAGAGACAACCTGG + Intergenic
939575064 2:143885886-143885908 TTAGTATTGAAGATGGAAACAGG + Intergenic
947918710 2:233851394-233851416 TCTGTGTTGCAGGAGGAAAGTGG - Intronic
948066024 2:235081078-235081100 TCTTTATGGCAGAGTGAAAACGG - Intergenic
1169301943 20:4450481-4450503 TGTGTTTTGCAGAAGGAAAATGG + Intergenic
1169733988 20:8817080-8817102 TTTCTATGGCAGAGGGAAACAGG - Intronic
1172800982 20:37576022-37576044 TCTGGCTTACAGGGGGAAACAGG + Intergenic
1173465642 20:43279019-43279041 TATGTGCTGCAGAGGGAAAGGGG - Intergenic
1176423664 21:6534686-6534708 TCTTTATAGCAGTGGGAAAATGG + Intergenic
1176711390 21:10152769-10152791 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1176922309 21:14703194-14703216 TCTGTATGCCAAAGAGAAACTGG - Intergenic
1177398010 21:20562680-20562702 ATTGTATTGCACAGGGAACCAGG - Intergenic
1177891463 21:26808928-26808950 TCTGAAATGCTGAGAGAAACTGG + Intergenic
1178589274 21:33895772-33895794 TGTGCCTTGGAGAGGGAAACAGG + Exonic
1178970066 21:37166408-37166430 TCTGTGTTTCAGAGGCAATCTGG - Exonic
1179699157 21:43143001-43143023 TCTTTATAGCAGTGGGAAAATGG + Intergenic
1185181546 22:49366302-49366324 TGCGTATAGGAGAGGGAAACGGG - Intergenic
1185234052 22:49700812-49700834 TCTTTATAGCAGTGGGAAACTGG + Intergenic
951132775 3:19068221-19068243 TCTTTATTGCAGTGTGAAAATGG + Intergenic
951624071 3:24640902-24640924 TCTGCCTTGCAAAAGGAAACTGG - Intergenic
952818955 3:37469298-37469320 TCTGTTTTGCAGTGGGAGAGAGG + Intronic
952916349 3:38247364-38247386 TCAGTCTTGTAGAGGGGAACAGG + Intronic
955396765 3:58563097-58563119 GGTGTATTGCAGAGGGAGAAGGG + Intergenic
955705077 3:61719490-61719512 GCTGTATCACAGAGGAAAACTGG - Intronic
956983203 3:74664751-74664773 TCTGTATTGCAGCCAGAAAAAGG - Intergenic
958000526 3:87743334-87743356 TCTTTATGGCAGTGGGAAAATGG - Intergenic
958523121 3:95217130-95217152 TCTTTAGTGAAAAGGGAAACTGG + Intergenic
960158829 3:114326954-114326976 TGTGTGTTGCAGAGGGAGAGGGG + Intergenic
964048149 3:152356821-152356843 TCTGTATTCCAGAGGGGATCTGG + Intronic
965119981 3:164541857-164541879 ACTGTTTTGGAGAGGGAAAAAGG - Intergenic
966233449 3:177674192-177674214 GATGTATTGCAGAGGAAAAGAGG - Intergenic
968263148 3:197341023-197341045 TATGTATAGTGGAGGGAAACTGG - Intergenic
968343782 3:197982659-197982681 TATGAATTGCAGAGGGAGACAGG + Intronic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
970004919 4:11401019-11401041 TTTGTATTGCAGCGGGAAATTGG + Intronic
970196896 4:13560142-13560164 TCTTTATAGCAGTGTGAAACAGG - Intergenic
971972597 4:33639010-33639032 TCTTTATAGCAGTGGGAAAATGG + Intergenic
973208765 4:47591069-47591091 TCAGAATTGGAGATGGAAACAGG - Exonic
973281021 4:48361480-48361502 TCTTAAGGGCAGAGGGAAACTGG + Intronic
973753016 4:54042727-54042749 TCTGTAGTGCAAAGGTAATCTGG + Intronic
973785616 4:54330068-54330090 TCTGAATTCCAGAGGGAACAGGG - Intergenic
974244376 4:59294935-59294957 TCTGGTTTAGAGAGGGAAACTGG - Intergenic
974306500 4:60149428-60149450 TATGTATTGCATAGGAAAGCAGG + Intergenic
974557160 4:63465768-63465790 TCTTTATAGCAGTGTGAAACTGG - Intergenic
975307141 4:72863212-72863234 GCAGTATTGCAGTGGGAATCTGG + Intergenic
975461932 4:74664046-74664068 TTTGAATTGGAGAGAGAAACTGG + Intergenic
978506228 4:109460417-109460439 TCTGTCTTGTGGAAGGAAACAGG - Intronic
978823995 4:112999150-112999172 TCTGTATTGCAGAGGGAAACTGG - Intronic
979106418 4:116694433-116694455 TCTTTATTGCAGTGTGAAAATGG + Intergenic
979452555 4:120890055-120890077 TCTGTATTGCAGTGTGAGAATGG - Intronic
981506261 4:145503615-145503637 TTTGTATTGGAGGAGGAAACAGG - Intronic
982432738 4:155340680-155340702 TCAGTATTGAAGAGGCAAAATGG - Intergenic
983155109 4:164337441-164337463 TCTGCATAGCTGAGGGAACCAGG - Intronic
983967291 4:173828524-173828546 TCTGTAGGGCAGAGGGAAAGGGG + Intergenic
984398848 4:179235666-179235688 TCTATTTTGCAGATGGAAAATGG + Intergenic
985396155 4:189546469-189546491 TCTGCATTTTGGAGGGAAACGGG + Intergenic
988560818 5:32279515-32279537 TCTCTTTTGCAATGGGAAACTGG - Intronic
991042049 5:62186339-62186361 TCTATATGAAAGAGGGAAACTGG + Intergenic
991478732 5:67053252-67053274 TCTGTATTGCTGAAAGAAATTGG + Intronic
992225554 5:74616793-74616815 TCTGTCTTGCAGATGGACAGAGG - Intergenic
992631961 5:78690345-78690367 TCTTTATAGCAGTGTGAAACCGG + Intronic
993502936 5:88682302-88682324 TTTGAAATGCAGTGGGAAACAGG - Intergenic
994740553 5:103612334-103612356 TCAGTATGGCAGAGTGAAAAAGG - Intergenic
996747528 5:126858131-126858153 TCTATAAAGCAGAGAGAAACTGG + Intergenic
997079461 5:130721639-130721661 TATGTAGGGGAGAGGGAAACTGG + Intergenic
997418782 5:133749962-133749984 TGTGTTCTGCAGAGGGGAACAGG + Intergenic
998581703 5:143383942-143383964 TCTTTATTGCAGTGTGAAAACGG - Intronic
999370192 5:151050347-151050369 TCTGTGTTAACGAGGGAAACTGG - Intronic
1005497079 6:26397155-26397177 TTTGTATTGCCCAGGGAAAGAGG - Intergenic
1007991891 6:46264999-46265021 TATCTATGGCAGAGGGAAGCTGG + Intronic
1008134362 6:47756847-47756869 TCTGTAATGCAGATATAAACTGG - Intergenic
1008599013 6:53070992-53071014 TGTAGATTGCAGAGGGCAACTGG + Exonic
1011360098 6:86514614-86514636 TCTCTTTTGCAGAGGGTGACAGG + Intergenic
1013968425 6:115984713-115984735 TGTGAATGGCAGAGGGAAACAGG - Intronic
1014231297 6:118905211-118905233 CCTGGGTTGAAGAGGGAAACTGG + Intronic
1015073290 6:129123724-129123746 TCTGGGTTGGAGGGGGAAACAGG + Intronic
1015751295 6:136562253-136562275 TATGTATTACTGAGGTAAACAGG - Intronic
1015775325 6:136808530-136808552 TCTTTATAGCAGAGTGAAAATGG - Intergenic
1016381277 6:143483961-143483983 TATGTATTCCTGAGGGAAGCAGG - Intronic
1016631428 6:146237232-146237254 TCTGTATAGCAGGAGGAAATGGG + Intronic
1017032990 6:150240662-150240684 TCTGCATTGCAGATGAAAAATGG - Intronic
1017515109 6:155149280-155149302 TCTGTCTTGAAGGGGGAATCCGG + Intronic
1018536607 6:164827149-164827171 TCTGTCTTGCAGATGGACAGAGG + Intergenic
1020500952 7:8919757-8919779 TCTGTATTGCAGAGAGCTAGAGG + Intergenic
1020746872 7:12090257-12090279 TCTGTCTTGCAGACGGACAGAGG + Intergenic
1021597596 7:22333862-22333884 TCTGTCTTGCAGATGGACAGAGG + Intronic
1022160740 7:27708529-27708551 TCTGTGTTGCAGATGAAAAATGG + Intergenic
1022558018 7:31319423-31319445 TTTGTATTGCAGAGGACAAAAGG + Intergenic
1024779482 7:52830603-52830625 TTTGTTTTGGAGAGGGAGACTGG + Intergenic
1024904160 7:54357057-54357079 TCTGTAGTGCAGACTAAAACAGG + Intergenic
1027412336 7:77934157-77934179 TCTGTATAGCAGACAGAAAAAGG - Intronic
1027455914 7:78391848-78391870 TTTATATTGCAGTGGGAATCAGG - Intronic
1029381582 7:100218902-100218924 TTTGGATGGCAGAGAGAAACAGG + Intronic
1029401018 7:100346229-100346251 TTTGGATGGCAGAGAGAAACAGG + Intronic
1031331898 7:120475564-120475586 TCTGTTTTACAGACGAAAACAGG + Intronic
1031388151 7:121178439-121178461 GCTGTAATGTAGAGGTAAACAGG + Intronic
1033286834 7:140048647-140048669 TATTTCTTGCAGAGGGAACCTGG + Intronic
1035732490 8:1862702-1862724 TGTGTTTTGCAGAGGGACAAAGG - Intronic
1035782505 8:2239619-2239641 TGTGTATTACAGAAGGAAATGGG - Intergenic
1035809615 8:2479969-2479991 TGTGTATTACAGAAGGAAATGGG + Intergenic
1035819455 8:2576698-2576720 TCTTTATAGCAGTGGGGAACGGG - Intergenic
1036490953 8:9225054-9225076 TCTGTGTTCCCCAGGGAAACAGG + Intergenic
1039853034 8:41387746-41387768 TCTGTATAGCAGTGTGAAAATGG + Intergenic
1043831142 8:84990925-84990947 TCTTTATAGCAGTGGGAAAACGG - Intergenic
1044052056 8:87516980-87517002 TCTTTATTGCAGAGTGAGAATGG + Intronic
1044362614 8:91306246-91306268 ACTGGATTTCAGAGGGAAAAGGG - Intronic
1045525056 8:102934340-102934362 TCTTTATAGCAGAGTGAAAATGG - Intronic
1046782381 8:118229739-118229761 TCTGTAATGAAGGGGGAGACTGG - Intronic
1047851317 8:128860667-128860689 TGTTTATTGCAGAGGAAAAATGG - Intergenic
1048736932 8:137512652-137512674 ACTGCATTGCTGAGGGAAGCAGG + Intergenic
1049465694 8:142750371-142750393 TCAGTATTGCAGCAGGACACGGG + Exonic
1050538110 9:6647411-6647433 TCTGTATGGCAGACGGAGGCGGG + Intergenic
1052599640 9:30608509-30608531 TCTTTATTGCAGTGTGAAAATGG + Intergenic
1053264081 9:36697908-36697930 TCTGTATAGCAGTGTGAAAATGG - Intergenic
1053833783 9:42112044-42112066 GCTGTAGTGCAGAGAGTAACGGG - Intronic
1055744948 9:79433426-79433448 TCTCTATTCCAGATGGCAACTGG + Intergenic
1056598818 9:88029949-88029971 TCTTTATTGTAAAGGAAAACTGG + Intergenic
1058362156 9:104161114-104161136 TATGTATTCAAGAGGGAAAGTGG - Intergenic
1060455924 9:123796809-123796831 TTGGTATGACAGAGGGAAACAGG - Intronic
1062343851 9:136105736-136105758 TCTCTTTTGCAGAAGAAAACTGG + Intergenic
1202796143 9_KI270719v1_random:121758-121780 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1187817635 X:23249944-23249966 TTTGATTTGCAGAGTGAAACTGG + Intergenic
1188077683 X:25798473-25798495 TCTTTATAGCAGTGGGAAAATGG + Intergenic
1188643961 X:32541153-32541175 TCTGTTTTGAAGAGGAAAACAGG + Intronic
1195427646 X:104752810-104752832 TCTGTATTCCATTGTGAAACAGG + Intronic
1196884324 X:120228560-120228582 TCTGTCTTGCAGATGGACAGCGG + Intergenic
1198690951 X:139284053-139284075 TCTTTATAGCAGAGTGAAAATGG - Intergenic
1199028255 X:142965020-142965042 TCAGTGTTGCTGAGGGAAATTGG - Intergenic
1199402862 X:147420100-147420122 TCTGAATTCCACAGGGAATCTGG + Intergenic
1201785194 Y:17768746-17768768 TCTGTACCACAGAGGGAAAAGGG + Intergenic
1201816359 Y:18137241-18137263 TCTGTACCACAGAGGGAAAAGGG - Intergenic
1201853112 Y:18510500-18510522 TCTGCACTGCAAAGGGAAAAGGG - Intergenic
1201880209 Y:18809884-18809906 TCTGCACTGCAAAGGGAAAAGGG + Intronic