ID: 978826158

View in Genome Browser
Species Human (GRCh38)
Location 4:113026576-113026598
Sequence TAGAGGTATTTTCAGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978826158 Original CRISPR TAGAGGTATTTTCAGTGGAC AGG Intronic
902696617 1:18144571-18144593 TAGTGGTATCTTCAGGGGACTGG - Intronic
905505373 1:38475436-38475458 GAGAGGTATTTAAAGTGAACTGG + Intergenic
905984644 1:42268328-42268350 GAGAGATATTTTCACTGCACAGG - Intronic
905992255 1:42348299-42348321 TAGTTGTATTTTCAAAGGACTGG - Intergenic
909859713 1:80589546-80589568 AAGAGGCATTTTCAGGGAACAGG + Intergenic
911305768 1:96230299-96230321 TAGAGGTATTTTAAATGTTCTGG + Intergenic
911553090 1:99307698-99307720 TAGAAATATTTTCAGTGAAAGGG + Exonic
913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG + Intergenic
916098698 1:161374592-161374614 TTGTGGTATTGTCAGTGGAAAGG - Exonic
916487719 1:165274216-165274238 TAGAGGTATTGGCAATGGATGGG - Intronic
917037787 1:170768190-170768212 TAGAGGAGTTTACAGTGGAGTGG + Intergenic
924498492 1:244613563-244613585 TAGAGGAATTTTCAGTGAGAAGG + Intronic
1063645350 10:7876389-7876411 AAGAGGTATTTTCAATGAAATGG + Intronic
1065308475 10:24391232-24391254 TAGAGGGACTTTCAGTGATCAGG + Intronic
1065853325 10:29809659-29809681 TAGAGCTAACTTCTGTGGACAGG - Intergenic
1066017545 10:31263313-31263335 TGGAGGTATTTACAGTGCCCAGG + Intergenic
1071928810 10:90441544-90441566 TCCAGGGATTGTCAGTGGACTGG - Intergenic
1074620914 10:115120675-115120697 TAGAGGTATTTTCAGTAAGTAGG + Intronic
1079840379 11:25390382-25390404 TAGGGATATTCTCAGTGAACAGG - Intergenic
1081282716 11:41230106-41230128 TATTGGTATTTTCAGAGGATTGG + Intronic
1085192234 11:74637281-74637303 CAGAGGCCTTTTCAGAGGACTGG - Intronic
1085990053 11:81830790-81830812 CAGTGGTATCTTCAGTGGGCTGG - Intergenic
1086641548 11:89164012-89164034 TAAAGGTATTTTGAGGGGAAAGG - Intergenic
1095475125 12:42579112-42579134 CAGAGGTATCTTCAGGGAACAGG + Intronic
1095987837 12:48011318-48011340 AAGAGCTATTTTCAGTGAAAGGG - Intergenic
1096485702 12:51979540-51979562 TCAAGGTATTTTCATTGGCCTGG - Intronic
1096939580 12:55327294-55327316 TCAAGGTATTTTCAGTGGAAAGG - Intergenic
1099003502 12:77209355-77209377 TAGAGAAACTTTCAGTGGTCTGG - Intergenic
1102654074 12:114465569-114465591 TGGAGGAATTTTGAGTGGTCTGG + Intergenic
1106544327 13:30717138-30717160 TAGAGGTGTTTTCATTTGCCCGG - Intronic
1107773055 13:43809311-43809333 TAAAGGCCTTTTCAGTGAACTGG - Intergenic
1109512905 13:63402999-63403021 TAAAGGTAGTTTCAGTGTAGTGG - Intergenic
1111738995 13:92178324-92178346 TATATGCATTTTCAGTGGAATGG - Intronic
1115480498 14:33856419-33856441 TAGAGACAATTTCAGTGGAAAGG + Intergenic
1117007134 14:51432417-51432439 TAGAGGAATTCACAGTGGTCTGG + Intergenic
1117476338 14:56098814-56098836 TTAAGGTATCTTCATTGGACTGG - Intergenic
1120160004 14:81135751-81135773 TTGAGATATTTTGAGTGGAGAGG + Intronic
1125347327 15:38731691-38731713 AAGAGGTAATTTGAGTGGACAGG + Intergenic
1126822382 15:52517386-52517408 TAAAAATATTTTCAGTGGGCTGG + Intronic
1138290637 16:55843703-55843725 TAGAAGTATTTTCAGTTTTCTGG - Intergenic
1139585287 16:67898955-67898977 TAGAGATATTTGCAGGTGACAGG + Intronic
1140542669 16:75772490-75772512 TATAGTTGTTTTCAGTGGAAGGG - Intergenic
1142798611 17:2329214-2329236 TAGAGGTATTTTCAGTACTCTGG - Intronic
1146675156 17:34768186-34768208 TAGAAGTTGTTTCAGTGGGCAGG - Intergenic
1148087591 17:45003691-45003713 TAGGGCTTTTTTCAGAGGACTGG + Intergenic
1149112559 17:53050476-53050498 GTGAGGAATTTTCTGTGGACAGG - Intergenic
1153361796 18:4206098-4206120 TAGAGGAAATTATAGTGGACTGG + Intronic
1153690315 18:7585739-7585761 TAGTGGCATTGTCAGTGGCCAGG + Intronic
1154389582 18:13924811-13924833 AAGAGGTATTTTTCTTGGACAGG - Intergenic
1155809878 18:30218794-30218816 TAGGTGTATTTTCAATGAACAGG + Intergenic
1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG + Intronic
1159272032 18:66165186-66165208 TAGAATTATTTTCATTGAACCGG - Intergenic
1166704793 19:44902804-44902826 TAGAGGGCTTTTCAGAGGGCAGG + Intronic
925759912 2:7174626-7174648 TAGCGTTTGTTTCAGTGGACTGG + Intergenic
926515755 2:13843415-13843437 TAAAGGCATTTTCAGTGACCTGG + Intergenic
927040319 2:19223545-19223567 TAGAAGTATTTTCAATCTACTGG + Intergenic
927881949 2:26695155-26695177 TTAAGGTATTCTCAGAGGACAGG - Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929366889 2:41169735-41169757 AATAGGTCTTTTCAGTGGAAAGG + Intergenic
930856093 2:56020204-56020226 TAGAGGCATTGTCAGAGGAAAGG + Intergenic
932305874 2:70704064-70704086 TGGAGGTGACTTCAGTGGACGGG - Intronic
936670808 2:114653725-114653747 TAGAGGAATTCTCAGTGGCTGGG + Intronic
938836739 2:135111336-135111358 GAGAGGAATTTTCAGTATACAGG + Intronic
939245377 2:139616698-139616720 TAGTGGTATTTTCAGCAAACTGG - Intergenic
939497501 2:142941581-142941603 TTGAAGTCTTTTCAGTGGTCTGG + Intronic
940692142 2:156932089-156932111 TAGAGGTATTTGCAAGGGTCAGG + Intergenic
943027701 2:182649419-182649441 AAGAGGTTTTTTCAGGGGGCAGG + Intergenic
1170074870 20:12408714-12408736 TAGAAATATTATCTGTGGACAGG - Intergenic
1171726574 20:28627157-28627179 TAGAAGTATGTTCATTGGCCAGG + Intergenic
1182809925 22:33107054-33107076 TAGAAGTATTTTCAGTTAAGTGG - Intergenic
1182894689 22:33849432-33849454 TTGAGTTTTTTTCAGTAGACTGG - Intronic
1183152370 22:36047894-36047916 TATTTGTATTTTCAGTAGACAGG + Intergenic
949359597 3:3217545-3217567 GAGAGGTATTTGCAGTGGAGAGG - Intergenic
949393191 3:3585859-3585881 TAGTGGTAATCTCTGTGGACCGG + Intergenic
951823028 3:26835133-26835155 TAGAGGTATTTTCATTTCTCTGG + Intergenic
953630836 3:44615566-44615588 TCTAGGTATTTTCAGTGGAAAGG - Intronic
954128286 3:48545575-48545597 TAGAGCTCTTTTCAGTGCCCTGG - Intronic
958536163 3:95407553-95407575 TTTAGGCTTTTTCAGTGGACAGG + Intergenic
959465405 3:106680346-106680368 TAGATCTATTTTAAATGGACTGG + Intergenic
960217380 3:115058431-115058453 TTGAAATATTTTCAGTGGCCAGG + Intronic
961802643 3:129464374-129464396 TAGAGGTATGTACAGAGGGCTGG + Intronic
965096802 3:164239723-164239745 TACATGTATGTTCTGTGGACTGG + Intergenic
965532015 3:169780430-169780452 TACTGGTGTTTTCAGTGGTCTGG + Intronic
976984786 4:91280383-91280405 TAGTGGTGATTGCAGTGGACTGG + Intronic
978826158 4:113026576-113026598 TAGAGGTATTTTCAGTGGACAGG + Intronic
979271123 4:118763360-118763382 TAGAATTTTTTTCAGTTGACTGG - Intronic
979397619 4:120207357-120207379 TAGAAGTAGTTTCAATGGAGTGG + Intergenic
980181645 4:129408289-129408311 TATAGATATTTTCATTGGAATGG + Intergenic
982117280 4:152108122-152108144 TAAAACTATTTTCACTGGACTGG - Intergenic
982169945 4:152651645-152651667 TAGAGAAAGTTTCAGTGGTCTGG - Intronic
983413445 4:167425614-167425636 AAGAGGTAGTTATAGTGGACTGG - Intergenic
983529490 4:168794573-168794595 TAGAGGGGTTATCAGTGGCCAGG + Intronic
985161152 4:187046291-187046313 TAGAGGTCTTATCAGGGGAGAGG - Intergenic
987328979 5:16838357-16838379 TAGAGGAAGTTTGAGTGGTCTGG + Intronic
988998979 5:36741609-36741631 AGGAGATATTTTCAGTGGTCTGG - Intergenic
989802807 5:45564939-45564961 TAAAGGTATTTTGAGTTTACAGG - Intronic
991272979 5:64807944-64807966 TGGAAGTAGTTTCAGTGGAGTGG - Intronic
995668919 5:114577816-114577838 TAGAGAAATTTTGAGTGGTCTGG - Intergenic
995957281 5:117793058-117793080 TAGTGGTATTTTCATTAGGCAGG - Intergenic
996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG + Intergenic
1000986089 5:167862075-167862097 TGGAGGTATTTTCATTAGATGGG + Intronic
1005532258 6:26719933-26719955 TAGAGGTACGTTCAGTGAAATGG + Intergenic
1005538537 6:26781732-26781754 TAGAGGTACGTTCAGTGAAATGG - Intergenic
1007676784 6:43602539-43602561 ATGAGATATTTTCAGTGAACTGG + Intronic
1008390779 6:50948933-50948955 TAGAGGAAGTTTGAGTGGTCTGG + Intergenic
1009007172 6:57801288-57801310 TAGAGGTACCTTCAGTGAAATGG - Intergenic
1009009389 6:57823969-57823991 TAGAGGTACGTTCAGTGAAATGG - Intergenic
1010585161 6:77650273-77650295 TGGAGTTATTTTCTCTGGACTGG + Intergenic
1018038794 6:159903920-159903942 TAGGAGTATTTTCAGTAGACTGG - Intergenic
1021372131 7:19862148-19862170 TACAGGTAGTTCCAGTGGATTGG + Intergenic
1022034799 7:26523569-26523591 TAGAGCAATTTTCTGTGGAGTGG + Intergenic
1025008408 7:55374465-55374487 TAGTGGTATTTTCAATAAACAGG - Intronic
1026234097 7:68510872-68510894 TAAAGGTCTTTTCAGAGGCCAGG + Intergenic
1029032428 7:97482931-97482953 TTTAGGTACTTTCGGTGGACTGG - Intergenic
1032967352 7:137114826-137114848 TAGAGGTATTTTCAGTTCTCAGG - Intergenic
1033291713 7:140090781-140090803 TTGATGTATTTTCAGTGGTAGGG - Exonic
1034125595 7:148668721-148668743 TGGAGGAATTATCAGTGGACAGG + Intergenic
1034596494 7:152199112-152199134 TGGAACTATTTTAAGTGGACAGG - Intronic
1036438451 8:8758254-8758276 TATAGGCATTTTCAGTGGAGGGG + Intergenic
1036965380 8:13291519-13291541 TAGAAATACTTTAAGTGGACAGG - Intronic
1038918671 8:32056677-32056699 TAGAGGTATTTTCAGTGCCAAGG - Intronic
1039079365 8:33720605-33720627 AAGAGGTAATTTCAGCAGACAGG + Intergenic
1039161152 8:34622654-34622676 TACAGGTATTTGCATTGGATAGG + Intergenic
1041365728 8:57101899-57101921 TAATGGTATTTTCAGTGACCTGG - Intergenic
1043745937 8:83873555-83873577 TACAGGTATTTTCATTGGAAGGG - Intergenic
1044684758 8:94816107-94816129 TAGTTGTATTTTTAGTAGACAGG + Intronic
1045129511 8:99133395-99133417 TGGAGGAATTTTGAGTGGTCTGG - Intronic
1045355413 8:101384042-101384064 TAGAGGAAGTTTCAGTGGTCTGG - Intergenic
1046170736 8:110501861-110501883 TGGTGGTATCATCAGTGGACTGG - Intergenic
1046338308 8:112819544-112819566 TAGAGGTGTTTTAATAGGACTGG - Intronic
1046649911 8:116826431-116826453 TAGAGCTACTTTCAGTGCAATGG - Intronic
1047113514 8:121816822-121816844 TAGGTATATTTTCAGGGGACAGG + Intergenic
1047644724 8:126858129-126858151 TAGGGGTATTTTCCCTGGTCAGG + Intergenic
1048099964 8:131340554-131340576 TAGAGATATTTTCATTGGCCTGG - Intergenic
1048678087 8:136807297-136807319 TAGAGGTATTTTCAGATAAGTGG - Intergenic
1051667081 9:19475714-19475736 TCTAGCTCTTTTCAGTGGACAGG + Intergenic
1052690746 9:31813834-31813856 TGGAGAAATTTTCAGTGGTCTGG - Intergenic
1054342812 9:63882050-63882072 TAGAAGTATATTCATTGGCCAGG + Intergenic
1056680473 9:88713454-88713476 TACAGGTATTTGGATTGGACTGG + Intergenic
1056998898 9:91489377-91489399 TAGAGGGATGCTAAGTGGACAGG + Intergenic
1058514628 9:105757761-105757783 TAAAAGCAATTTCAGTGGACTGG + Intronic
1059870134 9:118563587-118563609 TAGAGGCATTTTCAGAGGCTGGG - Intergenic
1060511871 9:124240392-124240414 GAGAGGTGTTTCCTGTGGACTGG - Intergenic
1188931410 X:36115793-36115815 GAGATGTATTTTCAGTGCACAGG - Intronic
1189426808 X:40909281-40909303 TAGAGGTATTTTCCCAGGAGAGG - Intergenic
1194207578 X:91030095-91030117 TATATGTTTTTTGAGTGGACTGG - Intergenic
1195032594 X:100940979-100941001 TAGAGGGATGTACAGTGGATAGG - Intergenic
1197236133 X:124066567-124066589 TTGATGTATATTCAGTGGAGAGG + Intronic
1197722220 X:129753060-129753082 CAGGGGTGTTTTCAGAGGACTGG - Intronic
1200553375 Y:4605141-4605163 TATATGTTTTTTGAGTGGACTGG - Intergenic