ID: 978827086

View in Genome Browser
Species Human (GRCh38)
Location 4:113038595-113038617
Sequence ACCTACCCCTCAACAAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978827082_978827086 7 Left 978827082 4:113038565-113038587 CCATATGCTCTTCAGCAATGTGA 0: 1
1: 0
2: 9
3: 53
4: 317
Right 978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 98
978827077_978827086 25 Left 978827077 4:113038547-113038569 CCCAAGATGGCTCCCCTTCCATA 0: 1
1: 0
2: 0
3: 5
4: 118
Right 978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 98
978827079_978827086 13 Left 978827079 4:113038559-113038581 CCCCTTCCATATGCTCTTCAGCA 0: 1
1: 0
2: 0
3: 22
4: 272
Right 978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 98
978827078_978827086 24 Left 978827078 4:113038548-113038570 CCAAGATGGCTCCCCTTCCATAT 0: 1
1: 0
2: 2
3: 18
4: 162
Right 978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 98
978827080_978827086 12 Left 978827080 4:113038560-113038582 CCCTTCCATATGCTCTTCAGCAA 0: 1
1: 0
2: 2
3: 31
4: 266
Right 978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 98
978827081_978827086 11 Left 978827081 4:113038561-113038583 CCTTCCATATGCTCTTCAGCAAT 0: 1
1: 0
2: 1
3: 21
4: 208
Right 978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978827086 Original CRISPR ACCTACCCCTCAACAAGAGG TGG Intronic
900167680 1:1250181-1250203 GCCTGACCCTCCACAAGAGGTGG + Intergenic
900208499 1:1441611-1441633 TCCTACCCCTCCAGAGGAGGTGG - Exonic
900220351 1:1505461-1505483 GCCTGACCCTCCACAAGAGGTGG + Intergenic
906200700 1:43958406-43958428 TCCTACCCCACAACTAGATGTGG + Intronic
909381517 1:75004154-75004176 ACTTACCCCTGAACAATAGAAGG + Intergenic
913309208 1:117469627-117469649 ACCTACAACTCAACAACAGAAGG + Intronic
917724231 1:177813946-177813968 CCCTACTCCTCAATAAGAGCAGG + Intergenic
920379584 1:205527873-205527895 ACCTGCTCATCAACGAGAGGGGG + Exonic
920871807 1:209801257-209801279 GCATAGCCCTCAACAAGAAGAGG - Exonic
1063138835 10:3239138-3239160 ACATATCCCTAAACAAGAAGTGG - Intergenic
1067221114 10:44345090-44345112 CCTTAGCCCTCCACAAGAGGTGG + Intergenic
1067713627 10:48670794-48670816 ACCTTCCCCTCCACCAGCGGGGG + Intergenic
1068942888 10:62697773-62697795 ACCTACCCCTGGATAAGATGGGG - Intergenic
1074823954 10:117201518-117201540 ATCTAATCCTCACCAAGAGGTGG + Intronic
1076693059 10:132233534-132233556 ACAAACCTCTCAAGAAGAGGTGG + Intronic
1077210732 11:1369972-1369994 CCCTGCCACTCAGCAAGAGGTGG + Intergenic
1080520413 11:33063695-33063717 ACGTACCCCCCAAAAAGAGAGGG - Intronic
1081599291 11:44481594-44481616 AGCCACCCCTCAACAATAGCAGG - Intergenic
1083641203 11:64146346-64146368 ACCTCCTCCTCCAGAAGAGGGGG + Intronic
1088282346 11:108148237-108148259 AACTCCCCCTCAGGAAGAGGAGG + Intergenic
1088347137 11:108839409-108839431 ACCTTCCTCTCAAGAAGAAGTGG - Intronic
1089733132 11:120532018-120532040 ACCTGCCCCACATCCAGAGGTGG - Intronic
1091171293 11:133521767-133521789 CCATACCCCTCAAAGAGAGGAGG - Intronic
1093702529 12:22238161-22238183 ACTCCCCCCCCAACAAGAGGTGG + Intronic
1101661294 12:106767825-106767847 ATCTTCCCCTAAACCAGAGGTGG + Intronic
1102470520 12:113157527-113157549 CCCCACCCCTCAACACGCGGGGG - Exonic
1103728415 12:123010606-123010628 ACCGGCCCTTGAACAAGAGGTGG + Intronic
1104952433 12:132447565-132447587 ACCTTCCCCGCAGCCAGAGGTGG - Intergenic
1109658042 13:65420316-65420338 ACTTTCCCCTCAGCAATAGGGGG - Intergenic
1119001745 14:70888298-70888320 AACAGCCCCTCATCAAGAGGTGG + Intergenic
1119825651 14:77655198-77655220 GCCAGCCCCTCAACAATAGGTGG - Intergenic
1202893495 14_KI270722v1_random:182134-182156 GCCTGGCCCTCCACAAGAGGTGG - Intergenic
1124468128 15:29958724-29958746 ACCTCCTCCTAAACAAGAAGTGG + Intronic
1126019083 15:44382224-44382246 ACTTACATCTCAACAAGAAGAGG + Intronic
1126060949 15:44782117-44782139 ACCTACCCCAAAACAACAGACGG + Intergenic
1129959925 15:79675043-79675065 GCCTCCCCCACATCAAGAGGTGG + Intergenic
1131353403 15:91722056-91722078 CCCTACCCCTCAACCTGTGGGGG - Intergenic
1134264799 16:12683831-12683853 ATCTACCCCGTAAAAAGAGGAGG + Intronic
1143712977 17:8746315-8746337 CCCCAACCCTAAACAAGAGGTGG + Intergenic
1151406221 17:73888375-73888397 ATCAACCCCTCAACAAGGAGAGG + Intergenic
1152540172 17:80970782-80970804 ACCTACCTCACAGCCAGAGGTGG + Intergenic
1152595068 17:81233923-81233945 TCCCACCCCTCTACAGGAGGAGG + Intronic
1153275345 18:3361903-3361925 CCCCACCCCTCAACAAGGTGGGG - Intergenic
1161559746 19:4966068-4966090 ACCTCCCCCTAAACAAGACCAGG - Intergenic
1164681906 19:30140400-30140422 ACCTTCTCCCCAACAAGAGGTGG - Intergenic
1168128245 19:54299070-54299092 TCCTAGCCCTCAATAAGATGAGG - Intergenic
926218308 2:10919034-10919056 ACCCATCCCTCAATCAGAGGTGG + Intergenic
927639973 2:24840123-24840145 CTCTTCCCCTCCACAAGAGGGGG + Intronic
930046511 2:47177025-47177047 GTCTACCCCTCAATAAGGGGCGG - Intergenic
932838801 2:75061832-75061854 ACCTACCCATGAACAAGACAGGG + Intronic
936881503 2:117257103-117257125 ACCTAGCACTCAACAAAAGTTGG + Intergenic
938451048 2:131420699-131420721 ACCTAAGCATCAACAATAGGAGG + Intergenic
939754089 2:146087613-146087635 ACCCACCCCTCATTAAGAGGAGG + Intergenic
945182386 2:207105251-207105273 ACCTACCCTTCAGAAAGGGGCGG - Intronic
1170263795 20:14442745-14442767 ACCTACCTCCCCACAAGAGATGG + Intronic
1171832232 20:30027335-30027357 ACCTACACATAAAAAAGAGGCGG + Intergenic
1171960249 20:31488360-31488382 CCCTCCCCCACAGCAAGAGGAGG - Intergenic
1172017354 20:31885662-31885684 GCCTACCCCTCAAAGAGCGGCGG - Intronic
1176366012 21:6033406-6033428 ACCTACCCCACTCCAAGAAGTGG - Intergenic
1179757505 21:43505139-43505161 ACCTACCCCACTCCAAGAAGTGG + Intergenic
1180992795 22:19947745-19947767 ACCTGACACTCCACAAGAGGTGG + Intronic
1181272213 22:21665818-21665840 ACAGACCCCTCAAGAAGATGGGG + Intronic
1181725289 22:24806773-24806795 ACCTGCTCCTCCACAAGAGGAGG - Intronic
1182245731 22:28956039-28956061 ACCTCTCCCTCAACCAGATGGGG - Intronic
949911996 3:8918826-8918848 TTCTACCCATCAACCAGAGGTGG + Intronic
952330457 3:32359973-32359995 ACCTACCGCTCAGGCAGAGGGGG - Intronic
952620137 3:35328279-35328301 ACATACTTCTCAATAAGAGGAGG + Intergenic
960394078 3:117114925-117114947 TCCTCCCCCTGAAAAAGAGGCGG + Intronic
961137305 3:124523690-124523712 ACCTACCCCTCCACAAAAAATGG + Intronic
964095132 3:152922548-152922570 ACCTCCCCCTCTGTAAGAGGTGG + Intergenic
968689776 4:1984500-1984522 GCCTACCCAGCAACAAGAGCTGG + Intronic
969896968 4:10314350-10314372 ACCTCCCCCACTACAAGAGATGG - Intergenic
971669727 4:29542052-29542074 ACCTTCCCCTCACCCAGAAGGGG - Intergenic
971710006 4:30098392-30098414 ATCACACCCTCAACAAGAGGTGG + Intergenic
971868752 4:32208308-32208330 ACACACCCATCAGCAAGAGGTGG + Intergenic
978827086 4:113038595-113038617 ACCTACCCCTCAACAAGAGGTGG + Intronic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
991770794 5:70039190-70039212 ACCCATCCCTCAGCAAGAGGAGG + Intronic
991850088 5:70914607-70914629 ACCCATCCCTCAGCAAGAGGAGG + Intronic
992478935 5:77131009-77131031 CCCAACCCCTCAAAGAGAGGAGG - Intergenic
995127605 5:108594072-108594094 ACCTCCCTCTCAACCAGAAGTGG - Intergenic
996544122 5:124659639-124659661 ACCTACTGATCTACAAGAGGTGG - Intronic
997393963 5:133541524-133541546 CCCTGCCTCTCAACAAGAGGAGG + Intronic
997406148 5:133648482-133648504 ACCTGACCCTCAGCAAGAGGGGG + Intergenic
997491646 5:134282350-134282372 ACCTACTCCTCAAAAAGAGGAGG - Intergenic
999135861 5:149318406-149318428 ACCTTCTCCTCCACCAGAGGAGG - Intronic
1004785074 6:18959463-18959485 ACCTACCTTTAAAAAAGAGGGGG - Intergenic
1005940558 6:30556593-30556615 ACCTACCACTCACCTGGAGGGGG + Exonic
1010315300 6:74441861-74441883 ACCTACCCCTCAACAGGTCCTGG + Intergenic
1019597055 7:1863091-1863113 TCCAACCCCCCAACCAGAGGAGG + Intronic
1026452751 7:70543713-70543735 AAACACCCCTCAACAGGAGGAGG - Intronic
1026562820 7:71464466-71464488 CCCAACCTCTCAACAAGAGTGGG + Intronic
1035193813 7:157197878-157197900 ACCTTCCTCTCCAGAAGAGGAGG - Intronic
1035477861 7:159156327-159156349 ACCTACTCCTCCACAGCAGGCGG - Intergenic
1040058494 8:43083589-43083611 ACCTACTCCTCAACTAGAAAAGG + Intronic
1041492197 8:58445931-58445953 ACCTTCCTCTCCAGAAGAGGAGG + Exonic
1042373491 8:68019629-68019651 ACCTAATGCTCAACAAGAAGTGG + Exonic
1046748745 8:117904682-117904704 ACCTGCCCCCCAACACCAGGTGG + Intronic
1046937985 8:119904038-119904060 CTCTATCCCTCCACAAGAGGAGG + Intronic
1049246767 8:141567053-141567075 TCCTGCCCCACAGCAAGAGGCGG - Intergenic
1055582204 9:77718207-77718229 ACCTAAGCATCAACAATAGGAGG + Exonic
1186211220 X:7252558-7252580 ACGTCCTCCTCAACAAGAAGGGG + Intronic
1193875823 X:86861685-86861707 ACCTACTCATCCACAATAGGAGG + Intergenic
1196092658 X:111762753-111762775 ACCTCTCCCCCAACAACAGGAGG - Intergenic
1197904978 X:131415012-131415034 TCCTACCCCCCAACCAGGGGAGG - Intergenic
1199149028 X:144407153-144407175 ACCCACCCCTCAAACAGAGCTGG + Intergenic
1201312179 Y:12606913-12606935 ACCAAACCCTGAAAAAGAGGTGG - Intergenic