ID: 978828022

View in Genome Browser
Species Human (GRCh38)
Location 4:113048038-113048060
Sequence CAATAGCAACACATTTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978828022 Original CRISPR CAATAGCAACACATTTACAT AGG Intronic
906912308 1:49967460-49967482 CAATAAGAACACATGGACATAGG + Intronic
909041293 1:70655351-70655373 CAATGGGAACACATGGACATGGG + Intergenic
909160203 1:72137542-72137564 CAATAAGAACACATGTACACAGG + Intronic
909391108 1:75123784-75123806 CATCAGAAACACATTCACATAGG - Intergenic
912281407 1:108318616-108318638 CATTTGCCACACATTTCCATGGG - Intergenic
913339524 1:117744946-117744968 AGATAGCAACACATTAACAGTGG - Intergenic
915808354 1:158878619-158878641 CAAGAGCAACACTTTGACATCGG + Intergenic
916917490 1:169425110-169425132 CAATGGCAAGACATTTCCATAGG + Intronic
918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG + Intergenic
919545830 1:198917215-198917237 CAATAGCCACATTTTTATATGGG - Intergenic
921171727 1:212556158-212556180 CAATATCAATACTTTTAAATAGG + Intergenic
921465913 1:215487414-215487436 ACATAGCAACACATCTACACGGG + Intergenic
921782886 1:219189067-219189089 CATTAGTAACATACTTACATTGG + Intronic
922148796 1:222978138-222978160 AAATAGGAACACTTTTACACTGG - Intronic
922284846 1:224161643-224161665 TAATAGCAATACAGTTATATTGG + Exonic
924162705 1:241250439-241250461 CAATATTAACAGGTTTACATTGG - Intronic
924955279 1:248920340-248920362 CAATAAGAACACATGGACATAGG - Intergenic
1062943462 10:1441925-1441947 GAATATCCACACATTTACTTGGG - Intronic
1063693649 10:8311858-8311880 CATTAGAAACACATTAACCTTGG + Intergenic
1064881611 10:20061119-20061141 CAATATCAACAAATTCACGTTGG + Intronic
1065740563 10:28793502-28793524 AAATAGTAATACATTCACATTGG - Intergenic
1066033628 10:31456204-31456226 CAATAAGAACACATGGACATAGG + Intronic
1066077579 10:31895616-31895638 AAATAGGAACACTTTTACATTGG + Intronic
1068914212 10:62410560-62410582 CAATATGAACACATAGACATAGG - Intronic
1069226701 10:65954002-65954024 AAATAGGAACACTTTTACACTGG - Intronic
1070649468 10:78224489-78224511 CAAAATCAACACATTGACAGTGG - Intergenic
1070826417 10:79392850-79392872 CAAAAGCATTACTTTTACATGGG - Intronic
1071066247 10:81639575-81639597 AAATAGGAACACTTTTACACTGG - Intergenic
1071273918 10:84035242-84035264 GAATAGCAAGTCTTTTACATGGG - Intergenic
1072302756 10:94077443-94077465 CAGTAGGAAAACATTAACATAGG - Intronic
1072872837 10:99138689-99138711 CAATGACAACACATGGACATAGG + Intronic
1073637178 10:105211309-105211331 CAATAGCAATGCATTTCCTTTGG - Intronic
1073720841 10:106169749-106169771 AAAAAGAAAAACATTTACATTGG + Intergenic
1074661639 10:115665597-115665619 AGATAGCAACAGATTTAAATTGG - Intronic
1074697726 10:116065555-116065577 CAAAAGAAACATACTTACATTGG + Exonic
1074798368 10:116972700-116972722 CAATAGCAACAGATGTTCTTGGG + Intronic
1074944079 10:118264363-118264385 CAATACCAACCCATTTAACTTGG + Intergenic
1075058761 10:119239725-119239747 CAATAACAACACATGGACAAAGG - Intronic
1075163770 10:120047717-120047739 CAATAAGAACACATGGACATAGG + Intergenic
1075971826 10:126661258-126661280 CAACAACAACTCATTTTCATGGG + Intronic
1076367991 10:129934530-129934552 CCAGAGCGACTCATTTACATGGG - Intronic
1078239393 11:9516402-9516424 CAGTACCAAAACAGTTACATAGG + Intronic
1078307492 11:10204955-10204977 CAATGACAACACATGGACATAGG + Intronic
1078969513 11:16391139-16391161 CAATAAGAACACATGGACATGGG + Intronic
1078971448 11:16417203-16417225 TAATGGCAACACATTTACTTTGG + Intronic
1079019925 11:16901454-16901476 CACTAGCAACTCATTTATTTAGG + Intronic
1079176349 11:18144971-18144993 CAAAAGCAAAAGATTGACATTGG + Intronic
1079310693 11:19363175-19363197 CAATAAGAACACATGGACATAGG - Intronic
1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG + Intergenic
1082253165 11:50004275-50004297 AGATGGCAACACAATTACATTGG + Intergenic
1082726275 11:56740649-56740671 AACCAGCAACACATTCACATTGG + Intergenic
1084472182 11:69369095-69369117 CAAAACTAAGACATTTACATTGG + Intergenic
1085078284 11:73611459-73611481 CAAAACCAAGAAATTTACATTGG + Intergenic
1087311614 11:96550537-96550559 AAATAGGAACACTTTTACACTGG + Intergenic
1088382212 11:109205938-109205960 CAATAAGAACATATCTACATAGG - Intergenic
1090118988 11:124004712-124004734 CAATAAAAACACATCTAGATCGG - Intergenic
1093095029 12:14961907-14961929 CAGTAGCAATAAATTCACATCGG + Intergenic
1094374831 12:29778846-29778868 CAGAAGCATCACACTTACATAGG - Intronic
1096328452 12:50687681-50687703 CAATAGGAACACATGGACACAGG + Intronic
1100910016 12:99349026-99349048 CAATAACAACACAAACACATGGG + Intronic
1102356357 12:112239707-112239729 CAATAATAAGAAATTTACATAGG + Intronic
1103195389 12:119039291-119039313 CAAGAGCATGCCATTTACATAGG - Intronic
1105434813 13:20367351-20367373 CAATAAAAACACATCTTCATTGG + Intergenic
1106775628 13:33006224-33006246 CAAAGTCAATACATTTACATTGG - Intergenic
1107199097 13:37691981-37692003 CTATAGTAACACATTTACCCAGG + Exonic
1107371190 13:39750599-39750621 CAAAATCAATACATTGACATTGG + Intronic
1107860099 13:44652410-44652432 CAACAGGCACACATTAACATCGG - Intergenic
1108132386 13:47316719-47316741 CAATGAGAACACATGTACATAGG + Intergenic
1109050880 13:57479730-57479752 CAATGGGAACACATGGACATAGG + Intergenic
1110457761 13:75709414-75709436 AAATAGGAACACTTTTACACTGG - Intronic
1110479457 13:75957428-75957450 AAATAGGAACACTTTTACACTGG + Intergenic
1110823934 13:79950116-79950138 CATTAGCAAAACTCTTACATTGG - Intergenic
1111279341 13:85998697-85998719 AAATAGGAACACTTTTACACTGG - Intergenic
1111814863 13:93139543-93139565 CAATAAGAACACATGGACATAGG - Intergenic
1111995563 13:95162847-95162869 CAATAGCCACATATTTCCAGTGG + Intronic
1114256720 14:21009420-21009442 CAACAGCAATACATATAAATAGG - Intergenic
1114698348 14:24649067-24649089 CAATGGCAACACATGGACACAGG + Intergenic
1115373687 14:32649540-32649562 AAATAACAACAAAATTACATTGG - Intronic
1115737777 14:36353233-36353255 CAATAACAACACTTGGACATAGG - Intergenic
1115902379 14:38166642-38166664 CCATAGCATCACATTTCCTTAGG - Intergenic
1115955017 14:38768209-38768231 AAATAGGAACACTTTTACACTGG + Intergenic
1116294978 14:43096157-43096179 CAATAGAAACATATTTAAAAAGG + Intergenic
1117481236 14:56147416-56147438 GAACAGCAGCACATGTACATGGG + Intronic
1118085057 14:62404784-62404806 GAAGAGCAACTCATTCACATGGG - Intergenic
1118409937 14:65468645-65468667 AAATACCAAAATATTTACATAGG - Intronic
1119339311 14:73862619-73862641 CAAAAGCAGGACATTAACATTGG - Intronic
1120806906 14:88761810-88761832 AAATAGGGACACTTTTACATTGG - Intronic
1121590154 14:95099794-95099816 CAAAAGCAACACAGATAAATGGG - Exonic
1122055521 14:99095641-99095663 CAATAGGAACACAGTGTCATGGG - Intergenic
1122332589 14:100933328-100933350 CAAAATCAACACAATCACATTGG - Intergenic
1123486612 15:20746025-20746047 AAATAGGAACACTTTTACACTGG + Intergenic
1123543102 15:21315075-21315097 AAATAGGAACACTTTTACACTGG + Intergenic
1125230605 15:37450933-37450955 AAATAGGTATACATTTACATAGG + Intergenic
1126276302 15:46886164-46886186 CAATAGCATGACATATACAATGG + Intergenic
1126333712 15:47563791-47563813 TAAAAGCATCACATTTACATAGG + Intronic
1126878546 15:53070332-53070354 CAGTAGCAACACCTTTATACAGG + Intergenic
1129679323 15:77649178-77649200 CTATTAAAACACATTTACATTGG - Intronic
1130615531 15:85403509-85403531 CAAAAGCGACACATTTCCATGGG - Intronic
1131338880 15:91577079-91577101 CTATAGCAACTGATCTACATAGG - Intergenic
1131633485 15:94205252-94205274 TAATAACAACATATTTAAATGGG + Intergenic
1134470240 16:14518393-14518415 CTATACCAATACATTTAAATGGG + Intronic
1135919443 16:26635447-26635469 CAATGGGAACACATGGACATAGG + Intergenic
1137467693 16:48725837-48725859 CACTAGCTCCACATTTTCATTGG - Intergenic
1138944803 16:61836090-61836112 CATTAGGACCACATTAACATTGG - Intronic
1139040341 16:62992563-62992585 CAATGGCAACACATGGACACAGG - Intergenic
1140160313 16:72484107-72484129 CAGTAACAAAATATTTACATTGG - Intergenic
1140855960 16:78977940-78977962 CAATAGCAGTACATTCACAATGG + Intronic
1149806470 17:59621705-59621727 CAATAAAAACACTTTTACAGAGG + Intronic
1150892897 17:69174924-69174946 CAATAACTACACATTTCCATTGG - Intronic
1153270407 18:3315376-3315398 CAATAAGAACACATGGACATGGG - Intergenic
1153315854 18:3721158-3721180 CAATAGCAACTCAGTTACAAAGG - Intronic
1155272806 18:24157388-24157410 CTACAGCAATGCATTTACATAGG + Intronic
1155698363 18:28711788-28711810 CCATAGCAACAAATTTACCATGG - Intergenic
1156848839 18:41701762-41701784 CAACAACAAAACATTAACATTGG - Intergenic
1158099132 18:53809709-53809731 AAATAGGAACACTTTTACACTGG + Intergenic
1158123188 18:54072917-54072939 CAATAAGAACACATTGACACAGG - Intergenic
1158299059 18:56032204-56032226 CCATAGATACACATTTACCTAGG - Intergenic
1159182088 18:64921028-64921050 CAAAAGCAACAGATTTTCTTGGG + Intergenic
1159413200 18:68108097-68108119 CAAAAGCAACACACATACAATGG - Intergenic
1159657622 18:71051384-71051406 CCAAAGCAACAAATTAACATAGG + Intergenic
1159705207 18:71677637-71677659 CAATAGGAACACATGGACACAGG - Intergenic
1159827401 18:73230848-73230870 TATTAAAAACACATTTACATAGG - Intronic
1162228017 19:9240579-9240601 CAATAGAAACACAGATACAAAGG - Intergenic
1164132480 19:22377714-22377736 AAATAGGAACACTTTTACACTGG - Intergenic
1164413535 19:28025987-28026009 CAATAGCAAGCCATTTCAATAGG - Intergenic
1164535893 19:29086461-29086483 CAACACAAACACATTCACATGGG + Intergenic
1165965685 19:39577615-39577637 CAATGGGAACACATGCACATAGG - Intergenic
1166249004 19:41552812-41552834 CAACAGCAACACATATAAATAGG + Intronic
1166291634 19:41867300-41867322 CAAAAGTAAAACATCTACATAGG - Intronic
927418533 2:22904927-22904949 CAATAGTACTACATTTACAGAGG + Intergenic
930961783 2:57271054-57271076 CAATAGGAACACATGGACACAGG - Intergenic
931034317 2:58220530-58220552 CTCTAGAAACAAATTTACATGGG + Intronic
933392675 2:81691712-81691734 TAATAGAAACACATTTAGAGGGG + Intergenic
935483654 2:103625066-103625088 CAATAGCAACAAAGATACTTAGG + Intergenic
936900621 2:117478134-117478156 AAATAGGAACACTTTTACACTGG + Intergenic
939623889 2:144452816-144452838 GAAAAGCAAAACATTTACGTGGG + Intronic
940069672 2:149671709-149671731 CAATAAGAACACATGGACATAGG - Intergenic
940373655 2:152930908-152930930 CAAAAGCACCCCATGTACATAGG - Intergenic
940636532 2:156304661-156304683 CAATGACAACACATTGACACAGG + Intergenic
940724289 2:157317824-157317846 CAATACAAACACAATGACATGGG - Intergenic
941629674 2:167870029-167870051 GAAAAGAAACATATTTACATTGG - Exonic
942353218 2:175076991-175077013 CAATAAGAACACATGGACATAGG - Intronic
942816003 2:180054918-180054940 CAATAAGAACACATGAACATAGG + Intergenic
943281716 2:185943167-185943189 CACTAGCAACACATTAATTTTGG + Intergenic
943284248 2:185976908-185976930 AAATAGGAACACTTTTACACTGG + Intergenic
943382496 2:187169928-187169950 CAATAGCCAAACATCTACAGTGG + Intergenic
943666089 2:190609895-190609917 CAACAGCAACACATATAAAGAGG + Intergenic
944253706 2:197603020-197603042 CAATAAGAACACATGGACATAGG + Intronic
944279880 2:197883769-197883791 AAATAGTAACACTTTTAGATAGG + Intronic
945921838 2:215762871-215762893 AAATAGCAAAACATTTAGAAAGG + Intergenic
947334287 2:229065820-229065842 CTATTGCAACACATTTCCAAAGG + Intronic
1169071582 20:2735996-2736018 CAATAGCCACACATATTTATTGG + Intronic
1169446971 20:5680389-5680411 TATGAGCAACACATTTACCTAGG + Intergenic
1169613387 20:7409826-7409848 CAATAATAACAAATTTACATAGG + Intergenic
1170518711 20:17160690-17160712 CAATAAGAACACATGGACATAGG + Intergenic
1171082325 20:22199644-22199666 AAATAGGAACACTTTTACACTGG + Intergenic
1171246659 20:23615544-23615566 CAATGGGAACACATGGACATAGG - Intergenic
1175987930 20:62773311-62773333 CAATAGCAACAAAATCACAAAGG - Intergenic
1177220974 21:18192554-18192576 CAACATCAACACATTTACATAGG + Intronic
1177662547 21:24105068-24105090 CAATAAGAACACATGGACATGGG + Intergenic
1177667483 21:24180021-24180043 AAATAGGAACACTTTTACACTGG + Intergenic
1177782773 21:25638797-25638819 AAATTGCACCACACTTACATTGG - Intergenic
1178516952 21:33256107-33256129 CATCAGCAACACATTCACCTTGG - Intronic
1179355539 21:40655380-40655402 CTATAGCTGCACCTTTACATGGG + Intronic
1182615846 22:31589556-31589578 CAAGAGCAACACGTTTCCACAGG + Exonic
1182835190 22:33336187-33336209 CAATAACAACAAACTTACATGGG - Intronic
949633192 3:5951840-5951862 CAATGGCTACACATTAACCTGGG - Intergenic
950253324 3:11485160-11485182 AAATAGGAACACTTTTACACTGG - Intronic
950309791 3:11947104-11947126 AAATAGGAACACTTTTACACTGG - Intergenic
952086104 3:29823622-29823644 CACTAGCCACACATTTCCAGAGG - Intronic
953349976 3:42208209-42208231 CAATAGCAACATACTTAATTTGG - Intronic
955955274 3:64282524-64282546 CAATAGCAGCAAAATTCCATTGG - Intronic
956419251 3:69068980-69069002 CAATAACCACACATATAGATAGG + Intronic
957596083 3:82268597-82268619 CAATGAGAACACATGTACATAGG - Intergenic
957729638 3:84117171-84117193 CCTTAGCAACACAATTGCATTGG - Intergenic
958177917 3:90020593-90020615 CAATTTCAAGACATTTAAATTGG + Intergenic
959185318 3:103039542-103039564 CACTAGCCACAGATTTATATTGG + Intergenic
960177830 3:114537929-114537951 CAATAAGAACACATGGACATAGG + Intronic
960754164 3:120991355-120991377 AAATAGGAACACTTTTACAGTGG + Intronic
960835555 3:121902970-121902992 AAATAGGAACACTTTTACACTGG - Intronic
961343041 3:126243048-126243070 CATTTGCAAAACAATTACATTGG + Intergenic
962122161 3:132573123-132573145 CAATAAGAACACATGGACATGGG - Intronic
962160424 3:132993455-132993477 CAAAAGCAACACATATTCGTGGG + Intergenic
966058979 3:175732851-175732873 CAATGAGAACACATGTACATGGG + Intronic
966531270 3:180983759-180983781 CAATATCAACATATTTAATTTGG - Exonic
966573424 3:181473150-181473172 CAATAAGAACACATGGACATAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968218185 3:196912368-196912390 CAATAAGAACACATGGACATAGG + Intronic
970645362 4:18114435-18114457 CCATAGGAATTCATTTACATTGG + Intergenic
971122601 4:23720995-23721017 CAATAAGAACACATGTACACAGG + Intergenic
971147506 4:23994960-23994982 CAAAAGGAACACATTTACGAGGG + Intergenic
972811845 4:42597158-42597180 CAGTAGCCACACATTTAGAAAGG + Intronic
974772747 4:66436999-66437021 CAATGACAACACATGGACATCGG + Intergenic
975269139 4:72408863-72408885 CAATAACAACACATGGACACAGG + Intronic
975534799 4:75437953-75437975 TAATAGCAACACAATAACAGTGG + Intergenic
976772722 4:88671353-88671375 CAAAAGCAAGACATTTAAATAGG + Intronic
976927821 4:90523335-90523357 AAATAGAAACAAATTTAAATTGG - Intronic
977680486 4:99793268-99793290 AAATAGGAACACTTTTACACTGG - Intergenic
977852369 4:101846059-101846081 CAATAGGAACACATGGACACAGG - Intronic
978704709 4:111692735-111692757 CAGTGGCAACAGATTTTCATAGG + Intergenic
978828022 4:113048038-113048060 CAATAGCAACACATTTACATAGG + Intronic
978948082 4:114523167-114523189 AAATAGGAACACTTTTACACTGG - Intergenic
979302244 4:119100241-119100263 CAATGGGAACACATGGACATAGG - Intergenic
979515543 4:121605380-121605402 CAATAGCAACTAAAATACATTGG - Intergenic
979791868 4:124793967-124793989 AAATAGGAACACTTTTACATTGG + Intergenic
980192289 4:129540554-129540576 CAATAGGAACTCAATTACTTGGG - Intergenic
980630274 4:135422559-135422581 CAATAAGAACACATGGACATGGG - Intergenic
982050957 4:151501400-151501422 AAATAGAAACACTTGTACATCGG - Intronic
984105419 4:175539623-175539645 AAACAGCATCACATTTACAATGG + Intergenic
985197272 4:187444695-187444717 CAACAGCAACATATATAAATTGG + Intergenic
987402904 5:17496544-17496566 TTCCAGCAACACATTTACATCGG - Intergenic
987593456 5:19963949-19963971 CAATATCAAGACATTAGCATAGG + Intronic
987899533 5:23993757-23993779 CCATAGAAAGACATTTATATGGG + Intronic
987957239 5:24755922-24755944 CAATAGGAACACATGGACACAGG + Intergenic
988647504 5:33110314-33110336 CAATGGCAACACATGGACACAGG - Intergenic
988899425 5:35716539-35716561 CAACAGCAAAATATATACATTGG + Intronic
989539532 5:42602814-42602836 CAATATAAACAGATGTACATTGG - Intronic
990766304 5:59187432-59187454 CAATAGAAACAGATTAACCTGGG + Intronic
991490678 5:67179917-67179939 CAATAATAACACATTTTTATAGG + Intergenic
991588549 5:68224681-68224703 CAATAGCCACACAATTTCAGTGG - Intronic
992390152 5:76323834-76323856 CAATGACAACACATGGACATAGG + Intronic
993435097 5:87883195-87883217 AAATAGCAACACTTTTACACTGG - Intergenic
993949515 5:94156425-94156447 CAATATTAGCACCTTTACATGGG - Intronic
994480190 5:100324442-100324464 AAATAGCAACACAGTCAAATAGG - Intergenic
995162224 5:108995460-108995482 CAATGAGAACACATGTACATAGG - Intronic
995340403 5:111052304-111052326 CAATGAGAACACATTAACATAGG - Intergenic
995823127 5:116261076-116261098 GAAAAGCAACAAATTTCCATAGG - Intronic
997456740 5:134023272-134023294 CAATAGGAACACATGGACACAGG + Intergenic
998074865 5:139227526-139227548 CAATATCAAAACATTTAAAAGGG + Intronic
998324417 5:141266864-141266886 CAACAGCAAAACATTTACTCAGG + Intergenic
999034877 5:148336640-148336662 CACTAGCAACAAATTTAGAAAGG + Intronic
999082586 5:148858287-148858309 CACTAGCAAGGCATCTACATGGG - Intergenic
1000765364 5:165282885-165282907 AAATAGTAACATATTTACCTAGG - Intergenic
1001348202 5:170929014-170929036 CAATAGCATCAAAAATACATAGG - Intronic
1002669375 5:180853829-180853851 CAAAATCAACACATTTACTCAGG - Intronic
1202774677 5_GL000208v1_random:58060-58082 AAATAGGAACACTTTTACACTGG - Intergenic
1003767042 6:9249573-9249595 CTGTAGCAACACATTTACATAGG - Intergenic
1004257678 6:14080024-14080046 CAAGAGCAATAAATTAACATTGG + Intergenic
1004282156 6:14289466-14289488 CAATAAGAACACATGGACATAGG + Intergenic
1005365691 6:25074426-25074448 AAATAGGAACACTTTTACACTGG - Intergenic
1007049867 6:38816280-38816302 CAATGTGAACACATTGACATAGG - Intronic
1008474206 6:51918778-51918800 AAATAGAAACACTTTTACACTGG - Intronic
1009247703 6:61260110-61260132 CAATAAGAACACATGGACATAGG - Intergenic
1009355411 6:62738871-62738893 AAATAGGAACACTTTTACACTGG - Intergenic
1011332310 6:86223879-86223901 CAATGGGAACACATTGACACAGG - Intergenic
1012149013 6:95722062-95722084 CAATAGGAACACATGGACACAGG + Intergenic
1012945591 6:105462233-105462255 AAACAGCAAAACATTTCCATGGG - Intergenic
1013588474 6:111600059-111600081 AAATAGCAACACTTCTCCATAGG + Intronic
1014277737 6:119405471-119405493 AAATAGGAACACTTTTACACTGG + Intergenic
1014350982 6:120345064-120345086 CAATACCAAGAAATTGACATTGG + Intergenic
1014600862 6:123410587-123410609 CAACAGCAACAAATAAACATAGG + Intronic
1014783958 6:125596948-125596970 CAAGACAAACACATATACATGGG + Intergenic
1015079845 6:129210424-129210446 CACCAACCACACATTTACATTGG + Intronic
1015418278 6:132975429-132975451 TAATAACAATACCTTTACATAGG + Intergenic
1016100543 6:140094352-140094374 TAATAGCAAAACATTTACAAAGG + Intergenic
1016484835 6:144526293-144526315 AAACAGCAACACATTAACAGTGG - Intronic
1017719347 6:157234092-157234114 AAATAGCAAGACAATTGCATGGG + Intergenic
1018011637 6:159676121-159676143 AAATAGGAACACTTTTACACTGG + Exonic
1018325623 6:162664510-162664532 AAATAGGAACACTTTTACACTGG - Intronic
1018593326 6:165452088-165452110 CATGAGAAACACATTTACAGGGG + Intronic
1021779724 7:24091494-24091516 CAATATCAAGAAATTGACATTGG + Intergenic
1022626726 7:32044463-32044485 AAATAGCAACAAATCTCCATTGG - Intronic
1023752756 7:43387553-43387575 CAGCAGCAAGACATTTACATAGG + Intronic
1024906516 7:54388285-54388307 CAACAGCAACACATATAAATAGG + Intergenic
1025636245 7:63322209-63322231 CAATAAGAACACATGGACATAGG + Intergenic
1025646451 7:63425967-63425989 CAATAAGAACACATGGACATAGG - Intergenic
1027327373 7:77059098-77059120 CAATAACCACACTTTTACAATGG - Intergenic
1027681381 7:81225847-81225869 CAAAAGCAACAGATTTACAGTGG - Intergenic
1028254257 7:88573594-88573616 TAATAGCAACAAATTTATATAGG - Intergenic
1029857877 7:103537052-103537074 CAATAGCAATACTTTTACACTGG + Intronic
1029869661 7:103677209-103677231 CAATAAGAACACATGGACATAGG + Intronic
1030178315 7:106677963-106677985 AAATAGGAACACTTTTACACTGG + Intergenic
1031671853 7:124557438-124557460 CATAAGCAACACATTTGTATGGG - Intergenic
1033806547 7:144960742-144960764 CAATACCAAGAAATTAACATTGG + Intergenic
1037338660 8:17817326-17817348 CATTATCAAAACATTTTCATTGG + Intergenic
1038855234 8:31323849-31323871 CAATAAGAACACATGGACATGGG - Intergenic
1039175478 8:34799323-34799345 CGCTAGCAACACCTTTGCATGGG + Intergenic
1040738804 8:50546576-50546598 CAATGAGAACACATTTACACAGG - Intronic
1040748169 8:50671568-50671590 AAATAGGAACACTTTTACACTGG + Intronic
1043025449 8:75061739-75061761 CAATAAAAACACATGAACATAGG + Intergenic
1043609737 8:82047706-82047728 CAAGAGCAACACATTTACAAAGG + Intergenic
1043686680 8:83095376-83095398 AAATAGGAACACTATTACATTGG + Intergenic
1044480678 8:92683898-92683920 CTATAGGAAAACATGTACATAGG + Intergenic
1044910183 8:97049576-97049598 CAATAGTGACACATTGAGATGGG + Intronic
1044995675 8:97835934-97835956 CAACAGCATTACATTTTCATAGG + Intronic
1046343446 8:112889536-112889558 CAAAAGACACACATTTCCATAGG - Intronic
1046385395 8:113502189-113502211 CAACAGCAATACATATAAATAGG + Intergenic
1046482643 8:114842595-114842617 CAATAGCTGTACATATACATAGG - Intergenic
1048338674 8:133522424-133522446 GAATTGCAACACATTTCCAGAGG - Intronic
1048470637 8:134700995-134701017 CCATAAACACACATTTACATGGG - Intronic
1048594071 8:135847952-135847974 AAATAGGAACACTTTTACACTGG - Intergenic
1049314067 8:141950228-141950250 CAATAGAAACAGATCTCCATGGG + Intergenic
1051302839 9:15671552-15671574 CAATGACAACACATGTACACAGG - Intronic
1051469279 9:17418048-17418070 CAAAAGTAAGACATTTACCTTGG - Intronic
1055433027 9:76263575-76263597 CAATAGGAACACATGGACACAGG + Intronic
1055594526 9:77851557-77851579 CAAAAGCAAAACATTTAGAATGG - Intronic
1056393720 9:86162474-86162496 AAATAGGAACACTTTTACACTGG + Intergenic
1056405522 9:86270467-86270489 AAATAGGAACACTTTTACACTGG + Intronic
1057347763 9:94266501-94266523 CAACAGCAACACATATAAATAGG + Intronic
1058164815 9:101607387-101607409 CTATAGCAACAGACTTACACAGG + Intronic
1058262377 9:102852051-102852073 CAATAACAACACAATTATAATGG - Intergenic
1060904274 9:127290922-127290944 CAAGAGCATCACATTTTAATTGG - Intronic
1061732570 9:132627592-132627614 CATTAGAAACACATTTAAAGGGG + Intronic
1186093779 X:6078384-6078406 CAGTAGCAACACATATGCATAGG - Intronic
1186895286 X:13999211-13999233 CAAAACCAAGAAATTTACATTGG + Intergenic
1187156720 X:16726841-16726863 TAACAGCAACACATATAAATAGG + Intronic
1187459138 X:19469925-19469947 AAATAGGAACACTTTTACACTGG + Intronic
1187589670 X:20703621-20703643 AAATAGGAACACTTTTACACTGG - Intergenic
1187771345 X:22700697-22700719 CAATAGCTAAACATTTGGATTGG + Intergenic
1187813259 X:23203847-23203869 AAATAGGAACACTTTTACACTGG + Intergenic
1188167613 X:26880915-26880937 CAACAGCAACACATATAAATAGG + Intergenic
1189244029 X:39549516-39549538 CAATGACAACACATGGACATAGG + Intergenic
1189584765 X:42447516-42447538 AAATAGGAACACTTTTACACTGG - Intergenic
1189598474 X:42595173-42595195 AAATAGGAACACTTTTACACTGG + Intergenic
1189629604 X:42938963-42938985 AAATAGAAACACATTTAAAGAGG - Intergenic
1190272617 X:48878061-48878083 CAGTAGTAAAACATTGACATTGG + Intergenic
1190923240 X:54877387-54877409 CAATTGCAACTCATTTTCCTTGG + Intergenic
1191177594 X:57521710-57521732 AAATAGGAACACTTTTACACTGG - Intergenic
1192824482 X:74681125-74681147 GAATTGCAACACATATTCATAGG + Intergenic
1193235411 X:79100696-79100718 CAATAGGAAGAGATTTACATAGG - Intergenic
1193251333 X:79294225-79294247 AAATAGCAACACATTAATAGTGG + Intergenic
1193304682 X:79934254-79934276 CAATAAGAACACATTGACACTGG + Intergenic
1193880308 X:86912811-86912833 CAATAGCAACATATTTATAATGG + Intergenic
1194533763 X:95080333-95080355 CAATAGCAACACAATAATAGTGG + Intergenic
1194548083 X:95262858-95262880 CAATGAGAACACATTGACATGGG + Intergenic
1196019052 X:110970544-110970566 CAATAAGAACACATGGACATCGG + Intronic
1196074010 X:111554965-111554987 CAATACCAAGAAATTTATATTGG + Intergenic
1196475176 X:116076052-116076074 CAATAGCTACAAAAATACATAGG + Intergenic
1196527820 X:116747922-116747944 AAATAGGAACACTTTTACACTGG + Intergenic
1196994141 X:121362371-121362393 AAATAGGAACACTTTTACACTGG - Intergenic
1197119344 X:122871630-122871652 GGATAGCAAATCATTTACATAGG + Intergenic
1197269394 X:124409286-124409308 AAATAGGAACACTTTTACACTGG - Intronic
1197481389 X:126991096-126991118 CAACAGCAACACATATACATAGG - Intergenic
1198610116 X:138389540-138389562 CAAAAACAACACATGTATATAGG + Intergenic
1199007773 X:142722525-142722547 AAATAGGAACACTTTTACACTGG + Intergenic