ID: 978829010

View in Genome Browser
Species Human (GRCh38)
Location 4:113060172-113060194
Sequence TGTTCAAACGGGTTTGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978829010_978829013 1 Left 978829010 4:113060172-113060194 CCTCAATCAAACCCGTTTGAACA 0: 1
1: 0
2: 0
3: 0
4: 65
Right 978829013 4:113060196-113060218 ATGATGTTTTGTTAAATAAATGG 0: 1
1: 1
2: 5
3: 75
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978829010 Original CRISPR TGTTCAAACGGGTTTGATTG AGG (reversed) Intronic