ID: 978830846

View in Genome Browser
Species Human (GRCh38)
Location 4:113082888-113082910
Sequence CAGGATCACTTTTACAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1300
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 1271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978830846_978830848 17 Left 978830846 4:113082888-113082910 CCATCTTTGTAAAAGTGATCCTG 0: 1
1: 0
2: 0
3: 28
4: 1271
Right 978830848 4:113082928-113082950 TATCTGAGAGTCATTTATAAAGG 0: 1
1: 0
2: 3
3: 21
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978830846 Original CRISPR CAGGATCACTTTTACAAAGA TGG (reversed) Intronic
900242260 1:1622736-1622758 CAGGGCCACTTTTCCAGAGAAGG + Intronic
900317901 1:2068572-2068594 CAGGAACCCTTTTCCAAAGGAGG + Intronic
900930351 1:5733203-5733225 CAGGAACACTTTTACACTGTTGG + Intergenic
902105148 1:14029087-14029109 CAGGAACACTTTTACACTGTTGG - Intergenic
902279073 1:15361276-15361298 CAGGATCATTTTTTCATGGATGG + Intronic
904226971 1:29029634-29029656 CATGAACACTTTTCAAAAGACGG + Intronic
905113461 1:35616089-35616111 CAGTATCCCTTTTACAAATGTGG + Intronic
905149823 1:35918969-35918991 CAGGATCACTGTTAAGAATATGG - Intronic
905425165 1:37877868-37877890 TATGATCTCTTTTACAAAAAAGG + Intronic
905735274 1:40320721-40320743 CAGGATGTATTTTCCAAAGATGG - Intergenic
905808668 1:40895897-40895919 CAGGATCACTTGTAAAACAAAGG - Intergenic
906600442 1:47123562-47123584 CAGGAACACTTTTACACTGTTGG - Intergenic
906949190 1:50320662-50320684 TAGGATCACTTTTACACTGTTGG + Intergenic
906979114 1:50609253-50609275 CAGGTTCATTCTTACTAAGAGGG - Intronic
907107210 1:51894640-51894662 CAGGAACACTTTTACACTGTTGG + Intergenic
907597709 1:55734961-55734983 GAGGAGAATTTTTACAAAGATGG - Intergenic
907794448 1:57701081-57701103 CAGGAACACTTTTACACTGTTGG + Intronic
908050004 1:60219121-60219143 CAGGAACACTTTTACACTGTTGG + Intergenic
908095899 1:60738403-60738425 CAGGAACACTTTTACACTGTTGG + Intergenic
908289573 1:62650822-62650844 CAGGAACACTTTTACAGTGTTGG + Intronic
908593361 1:65657479-65657501 TAGGAACACTTTTACACAGTTGG + Intergenic
908791205 1:67783843-67783865 CAGGAACACTTTTACACTGTTGG + Intronic
909177130 1:72374806-72374828 CAGGAACACTTTTACACTGTTGG - Intergenic
909333684 1:74446153-74446175 CAGGAACACTTTTACACTGTTGG - Intronic
909436143 1:75645240-75645262 CAGGAACACTTTTACACTGTTGG - Intergenic
909454963 1:75840046-75840068 CAGGAACACTTTTACACTGTTGG + Intronic
909604926 1:77498433-77498455 CAAGGTCATTTTTATAAAGAGGG + Intronic
909657794 1:78049984-78050006 GAGGATCACTTGAACACAGAAGG - Intronic
909963027 1:81871548-81871570 TAGGATCACTTTTACACTGCTGG - Intronic
909988477 1:82192002-82192024 CTGGATAACTTTTTCAAAGGTGG - Intergenic
910072186 1:83230574-83230596 CAGGAACACTTTTACACTGTTGG + Intergenic
910274095 1:85429629-85429651 CAGGAACACTTTTACACTGTTGG - Intronic
910274547 1:85434745-85434767 CAAGAACACTTTGAAAAAGAAGG - Intronic
910942297 1:92549876-92549898 TAGGAACACTTTTACACAGTTGG + Intronic
910977906 1:92927282-92927304 GAGGATCACTTGTGCACAGAAGG - Intronic
911141482 1:94507604-94507626 CAGGAACACTTTTACACTGTTGG - Intronic
911148511 1:94574283-94574305 CATGAACACTTTTCAAAAGAAGG - Intergenic
911342574 1:96656779-96656801 CAGGAACACTTTTACACCGTTGG + Intergenic
911344518 1:96680425-96680447 CAGGAACACTTTTACACTGTTGG + Intergenic
911649746 1:100374419-100374441 CAGGAACACTTTTACACTGTTGG - Intronic
911899683 1:103486833-103486855 TAGGAACACTTTTACACAGTCGG + Intergenic
912130758 1:106596984-106597006 CAGGAACACTTTTACACTGTTGG - Intergenic
912591127 1:110821605-110821627 CAGGAACACTTTTACACTGTTGG - Intergenic
912732566 1:112121968-112121990 CATGAACACTTTTCAAAAGAAGG + Intergenic
912792583 1:112667071-112667093 CAGGTTCACTATTATGAAGATGG + Exonic
913310193 1:117482331-117482353 CAGGAACACTTTTACACTGTTGG - Intronic
913504404 1:119503182-119503204 TAGGAACACTTTTACAATGTTGG + Intergenic
913506432 1:119520312-119520334 CAGGAACACTTTTACATTGTTGG - Intergenic
913506859 1:119525179-119525201 TAGGAACACTTTTACAATGTTGG + Intergenic
914208218 1:145553929-145553951 CAGGAACACTTTTACACTGTTGG - Intergenic
914219026 1:145660833-145660855 CAGGAACACTTTTACACTGTTGG + Intronic
914219543 1:145667199-145667221 CAGGAACACTTTTACACTGTTGG - Intronic
914439376 1:147690533-147690555 CAGAATCAGCTTTAGAAAGATGG - Intergenic
914459877 1:147873628-147873650 TAGGATCACTTTTACACTGTTGG - Intergenic
914471611 1:147983704-147983726 CAGGAACACTTTTACACTGTTGG + Intronic
914797090 1:150929207-150929229 CAGGAACACTTTTACACTGTTGG - Intronic
914801325 1:150964618-150964640 CAGGAACACTTGGACAAATATGG - Exonic
915028186 1:152852917-152852939 TAGGAACACTTTTACACAGTTGG - Intergenic
915765855 1:158361597-158361619 CAGGAACACTTTTACACTGTTGG - Intergenic
915990335 1:160509031-160509053 CAGGAACACTTTTACAATGTTGG + Intronic
915993620 1:160542205-160542227 CATGCTCTCTTTTACAAAGTAGG - Intronic
916020528 1:160788402-160788424 CAGGAACACTTTTACACTGTTGG + Intergenic
917019886 1:170574741-170574763 CAGGAACACTTTTACACTGTTGG + Intergenic
917170485 1:172167533-172167555 CAGGAACACTTTTACACTGTTGG - Intronic
917175915 1:172235374-172235396 CAGGAACACTTTTACACTGTTGG + Intronic
917242330 1:172961829-172961851 CAGGAACACTTTTACACTGTTGG - Intergenic
917385011 1:174463039-174463061 CAGGAACACTTTTACACTGTTGG + Intronic
917400672 1:174645821-174645843 CAGGAACACTTTTACACTGTTGG - Intronic
917987815 1:180339058-180339080 CAGGAACACTTTTACACTGTTGG + Intronic
918397586 1:184131185-184131207 CAGGAACACTTTTACACTGTTGG - Intergenic
918407996 1:184229560-184229582 CAGGAACACTTTTACACTGTTGG - Intergenic
918769832 1:188542978-188543000 CAAGATCAGTTTGACTAAGATGG + Intergenic
918784987 1:188752849-188752871 CAGGAACACTTTTACACTGTTGG - Intergenic
918944298 1:191041196-191041218 CAGGAACACTTTTACACTGTTGG + Intergenic
918959730 1:191258506-191258528 CAGGAACACTTTTACACTGTTGG + Intergenic
918998742 1:191800076-191800098 AAGGATCATTTTGACAAAAATGG + Intergenic
919010011 1:191947714-191947736 CAGGAACACTTTTACACTGTTGG - Intergenic
919015009 1:192021280-192021302 CAGCATAAATTTTACAAAGCTGG + Intergenic
919099313 1:193074350-193074372 CAGGAACACTTTTACACTGTTGG - Intronic
919164609 1:193876378-193876400 CAGGAACACTTTTACACTGTTGG + Intergenic
919219412 1:194607141-194607163 TAGGAACACTTTTACACAGTTGG - Intergenic
919730508 1:200911228-200911250 CAGGAACACTTTTGCACACAGGG + Intronic
920158256 1:203974100-203974122 CAGTAACACTGTTACAAAAAAGG + Intergenic
920642888 1:207771015-207771037 CAGGAACACTTTTACACTGTTGG - Intronic
920953398 1:210595579-210595601 TAGGAACACTTTTACACTGATGG - Intronic
921289571 1:213644975-213644997 CAGAATCCCTTTTAGACAGAGGG + Intergenic
921535319 1:216342364-216342386 CAGGAACACTTTTACACTGTTGG + Intronic
921976812 1:221211934-221211956 CAGGAACACTTTTACACTGTTGG + Intergenic
922640525 1:227225918-227225940 CAGGATAAATTTTACAGAAAAGG - Intronic
924005699 1:239608521-239608543 CATGAGTACTTTTACATAGAAGG + Intronic
924274640 1:242373327-242373349 CAGGAACACTTTTACACTGTTGG + Intronic
924408003 1:243772564-243772586 CAGGAACACTTTTACACTGTTGG + Intronic
1062780996 10:207452-207474 CAGGAACACTTTTACACTGTTGG - Intronic
1063744450 10:8864135-8864157 TAGGAACACTTTTACACAGTTGG - Intergenic
1063883756 10:10556646-10556668 CAGGAACACTTTTACACTGTTGG - Intergenic
1063885880 10:10577973-10577995 CAGGAACACTTTTACACTGTTGG - Intergenic
1064037072 10:11923055-11923077 CAAAATCATTTTTAAAAAGATGG + Intronic
1064367574 10:14721459-14721481 TAGGAACACTTTTACACAGTTGG - Intronic
1064504930 10:16018315-16018337 CAGGAACACTTTTACACTGTTGG - Intergenic
1064652413 10:17522750-17522772 CAGGAACACTTTTACACTGTTGG - Intergenic
1065433538 10:25683854-25683876 CAGGATCACTTGAACTGAGAAGG + Intergenic
1065511072 10:26478858-26478880 GAGGCTCCCTTTTAAAAAGAAGG + Intronic
1065880768 10:30036120-30036142 GAGAATCACTTTTTAAAAGAAGG - Intronic
1066139983 10:32495008-32495030 CAGGAACACTTTTACACTGTTGG - Intronic
1066172242 10:32861943-32861965 CAGGAACACTTTTACACTGCTGG + Intronic
1066225785 10:33381916-33381938 CTGGAGCTCTTTTACAAAGCCGG + Intergenic
1066582231 10:36893568-36893590 CAGGAACACTTTTACACTGTTGG - Intergenic
1066688156 10:38000830-38000852 CAGGAACACTTTTACACTGTTGG + Intergenic
1067199322 10:44153004-44153026 CAGGAACACTTTTACATGGTTGG + Intergenic
1067548018 10:47210116-47210138 TAGGAACACTTTTACACAGTTGG + Intergenic
1068044439 10:51868167-51868189 AAGGACGACTTATACAAAGATGG + Intronic
1068056988 10:52023529-52023551 CAGGAACACTTTTACACTGTTGG - Intronic
1068082342 10:52335209-52335231 CAGGACCTCTTTTCCATAGATGG - Intergenic
1068197098 10:53731210-53731232 CAGGAACACTTTTACACTGTTGG + Intergenic
1068215113 10:53972818-53972840 CAGGAACACTTTTACACTGTTGG + Intronic
1068256725 10:54520591-54520613 CAGGAACACTTTTACACTGTTGG + Intronic
1068339502 10:55683687-55683709 CAGGAACACTTTTACACTGTTGG - Intergenic
1068390223 10:56386349-56386371 CAGGAACACTTTTACACTGTTGG - Intergenic
1068404204 10:56569168-56569190 TAGGATCACTTTTACACTGTTGG - Intergenic
1068575761 10:58682481-58682503 CAGGAACACTTTTACACTGCTGG - Intronic
1068642214 10:59422632-59422654 CAGGAACACTTTTACAGTGTTGG - Intergenic
1069260409 10:66387472-66387494 CAGGAACACTTTTACACTGTTGG + Intronic
1069321952 10:67183066-67183088 CAGGAACACTTTTACACTGTTGG + Intronic
1069968208 10:72139677-72139699 CAGGACCATCTTTACAAATAAGG + Intronic
1069972089 10:72180423-72180445 CAGGACCAGTCTTACAAATATGG + Intronic
1071001251 10:80832964-80832986 CAGGAACACTTTTACACTGTTGG + Intergenic
1071131071 10:82394260-82394282 CAGGAGCACATTTACAAAGCAGG + Intronic
1071644597 10:87350071-87350093 CAGGAACACTTTTACACTGTTGG + Intergenic
1071696661 10:87881824-87881846 CAGGAACACTTTTACACTGTTGG - Intronic
1072179450 10:92966902-92966924 CAGGAACACTTTTACACTGTTGG - Intronic
1072461187 10:95620309-95620331 CAGGAACACTTTTACACTGTTGG + Intronic
1072778752 10:98228196-98228218 CAGGAACACTTTTACACTGTTGG - Intronic
1072887659 10:99293511-99293533 TAGGATAACTTTTACAGAAAGGG + Intergenic
1073220065 10:101864270-101864292 CAGGAACACTTTTACACTGTTGG + Intronic
1073697800 10:105890339-105890361 CAGGAGCACTTTTACACTGTTGG - Intergenic
1073725335 10:106223765-106223787 CAGGAACACTTTTACACTGTTGG + Intergenic
1073989048 10:109242545-109242567 CAGGAACACTTTTACACTGTTGG + Intergenic
1074625174 10:115175923-115175945 CAGGAACACTTTTACACTGTTGG - Intronic
1074902779 10:117833499-117833521 CAGGAACACTTTTACACTGTTGG - Intergenic
1075491291 10:122872313-122872335 CAGGAACACTTTTACACTGTTGG + Intronic
1075701816 10:124474835-124474857 CAGGGGCACCTTTAGAAAGAGGG - Intronic
1075998856 10:126899447-126899469 TAGGAACACTTTTACACTGATGG + Intergenic
1077696327 11:4396271-4396293 CAGGAGCACTTTTACACTGTTGG - Intergenic
1077748307 11:4934187-4934209 CAGGAACACTTTTACACTGTTGG - Intronic
1077818956 11:5716874-5716896 CAGGAACACTTTTACACTGTTGG + Intronic
1077944326 11:6878567-6878589 CAGGAACACTTTTACACTGTTGG + Intergenic
1077946926 11:6910090-6910112 CAGGAACACTTTTACACTGTTGG + Intergenic
1077960052 11:7066322-7066344 CAGGAACACTTTTACACTGTTGG - Intronic
1079256038 11:18831390-18831412 AAGGAACACTTTTACACTGATGG + Intergenic
1079271379 11:18989344-18989366 TAGGAACACTTTTACAATGTTGG - Intergenic
1079825915 11:25192456-25192478 TAGGATCACTTTTACACTGTTGG + Intergenic
1079859060 11:25644387-25644409 CAGGAACACTTTTACACTGTTGG - Intergenic
1079974288 11:27073439-27073461 CAGGAACACTTTTACACTGTTGG + Intronic
1080515086 11:33013010-33013032 CAGGAACACTTTTACACTGTTGG + Intergenic
1080564495 11:33495740-33495762 CAGGAACACTTTTACACTGTTGG - Intergenic
1080777126 11:35396290-35396312 CAGGAACACTTTTACACTGTTGG - Intronic
1080915254 11:36651169-36651191 CAGGAACACTTTTACACTGTTGG - Intronic
1081321390 11:41696054-41696076 CAGGAACACTTTTACACTGTTGG + Intergenic
1081423208 11:42896819-42896841 CAGGAACACTTTTACACTGTTGG - Intergenic
1081510917 11:43772481-43772503 CAAGATGACTTTTGCAAGGAGGG + Intronic
1082102691 11:48186376-48186398 CAGGAACACTTTTACATTGTTGG - Intergenic
1082109676 11:48260756-48260778 TAGGAACACTTTTACACAGTTGG + Intergenic
1082142008 11:48619986-48620008 CAGGAACACTTTTACACTGTTGG + Intergenic
1082174003 11:49040820-49040842 CAGGAACACTTTTACACTGTTGG - Intergenic
1082191862 11:49255253-49255275 AAGGATGACTTATACAAGGATGG + Intergenic
1082297413 11:50459096-50459118 CAGGAACACTTTTACACTGTTGG - Intergenic
1082582916 11:54895699-54895721 CAGGAACACTTTTACACTGTTGG + Intergenic
1082619855 11:55406815-55406837 TAGGAACACTTTTACACAGTTGG - Intergenic
1082629631 11:55526620-55526642 CAGGAACACTTTTACACTGTTGG - Intergenic
1082910186 11:58363781-58363803 TAGGAACACTTTTACACAGTTGG - Intergenic
1083124233 11:60547740-60547762 CAGGAACACTTTTACACTGTTGG + Intergenic
1083124985 11:60555882-60555904 CAGGAACACTTTTACACTGTTGG + Intergenic
1084995862 11:72977702-72977724 CAGGAACACTTTTACACTGTTGG + Intronic
1085609248 11:77932484-77932506 CAGGAACACTTTTACACTGTTGG + Intronic
1086404791 11:86490257-86490279 CAGGTTTACATTTAGAAAGATGG + Intronic
1086414268 11:86572893-86572915 CAGGAACACTTTTACACTGTTGG - Intronic
1086483412 11:87269958-87269980 CAGGAACACTTTTACACTGTTGG - Intronic
1086601335 11:88637682-88637704 CAGGAACACTTTTACACTGTTGG + Intronic
1086602274 11:88648031-88648053 CAGGAACACTTTTACACTGTTGG + Intronic
1086640915 11:89155007-89155029 CAGGAACACTTTTACACTGTTGG + Intergenic
1086662105 11:89431728-89431750 CAGGAACACTTTTACACTGTTGG + Intronic
1086664312 11:89460685-89460707 CAGGAACACTTTTACACTGTTGG + Intronic
1086674263 11:89585763-89585785 AAGGATGACTTATACAAGGATGG - Intergenic
1086694205 11:89824516-89824538 CAGGAACACTTTTACACTGTTGG + Intergenic
1086711941 11:90019995-90020017 CAGGAACACTTTTACACTGTTGG - Intergenic
1086805435 11:91235494-91235516 CAGGAACACTTTTACACTGTTGG - Intergenic
1086910406 11:92465419-92465441 CAGGAACACTTTTACACTGTTGG - Intronic
1087087946 11:94238770-94238792 CAGGAACACTTTTACACTGGTGG - Intergenic
1087298525 11:96406235-96406257 CAGGAACACTTTTACACTGTTGG - Intronic
1087312523 11:96561106-96561128 CAGGAACACTTTTACACAGTTGG + Intergenic
1087322359 11:96678391-96678413 CAGGAACACTTTTACACTGTTGG - Intergenic
1087330271 11:96772408-96772430 CAGGAACACTTTTACACTGTTGG - Intergenic
1087477075 11:98649858-98649880 CAGGAACACTTTTACACTGTTGG + Intergenic
1087503050 11:98983908-98983930 CAGGAACACTTTTACACTGTTGG - Intergenic
1087971119 11:104485450-104485472 CAGGATGGCTCTTACAGAGATGG + Intergenic
1087980054 11:104600959-104600981 AAGGATCACTTTTACACTGTTGG + Intergenic
1088198196 11:107299212-107299234 CAGGAACACTTTTACACTGTTGG + Intergenic
1088310016 11:108450160-108450182 CAGGAACACTTTTACACTGTTGG + Intronic
1088410532 11:109529406-109529428 CAGGAACACTTTTACACTGTTGG + Intergenic
1088512891 11:110596668-110596690 CAGGAACACTTTTACACTGTTGG + Intronic
1089833785 11:121352233-121352255 CAGGATCACTTGCAAACAGAAGG + Intergenic
1090167213 11:124562122-124562144 TAGGAACACTTTTACACAGTTGG - Intergenic
1090677189 11:129009932-129009954 AAGGAGCACTTTTACAATGTTGG - Intronic
1090689362 11:129161673-129161695 CAGGAACACTTTTACACTGTTGG + Intronic
1091247114 11:134106859-134106881 CAGGAACACTTTTACACTGTTGG + Intronic
1091247809 11:134113806-134113828 CAGGAACACTTTTACACTGTTGG - Intronic
1092710769 12:11335024-11335046 CAGGAACACTTTTACACTGTTGG - Intergenic
1092828417 12:12419658-12419680 CAGGAACACTTTTACACCGTTGG - Intronic
1093549066 12:20385316-20385338 CAGGAACACTTTTACACTGTTGG + Intronic
1093760312 12:22902655-22902677 TAGGATCACTTTTACACTGTTGG + Intergenic
1093981982 12:25485118-25485140 CAGGAACACTTTTACACTGTTGG - Intronic
1094305793 12:29017626-29017648 CAGGAACACTTTTACACTGTTGG - Intergenic
1094874975 12:34630142-34630164 TAGGAACACTTTTACACAGTTGG - Intergenic
1095053906 12:37578327-37578349 TAGGTTCAGTTTTACAAAGATGG - Intergenic
1095526760 12:43135201-43135223 TATCATCTCTTTTACAAAGATGG - Intergenic
1096033155 12:48439275-48439297 CAGGAACACTTTTACACTGTTGG + Intergenic
1096036780 12:48478893-48478915 CAGGAACACTTTTACACTGTTGG + Intergenic
1096044172 12:48547493-48547515 CAGGAACACTTTTACACTGTTGG - Intergenic
1096047655 12:48577847-48577869 CAGGAACACTTTTACACTGTTGG + Intergenic
1097462104 12:59874406-59874428 CAGGAACACTTTTACACAGTTGG + Intergenic
1097534927 12:60856394-60856416 CAGGAACACTTTTACACTGTTGG - Intergenic
1097562220 12:61221501-61221523 CAGGAACACTTTTACACTGTTGG - Intergenic
1097577689 12:61415588-61415610 CAGGAACACTTTTACACTGTTGG - Intergenic
1097616291 12:61888107-61888129 CAGGAACACTTTTACACTGTTGG + Intronic
1097998262 12:65914020-65914042 CAGGAACACTTTTACACTGTTGG + Intronic
1098380043 12:69859797-69859819 CAGGAACACTTTTACACTGTTGG + Intronic
1098380207 12:69861361-69861383 CAGGAACACTTTTACACTGTTGG - Intronic
1098463503 12:70760336-70760358 CAGGATCACTTGCACCCAGATGG - Intronic
1098646437 12:72907739-72907761 CAGGAACACTTTTACACTGTTGG - Intergenic
1098888540 12:75984248-75984270 GAGAATCACTTTTACCCAGAAGG + Intergenic
1099050070 12:77771291-77771313 CAGGAACACTTTTACACTGTTGG + Intergenic
1099107276 12:78511951-78511973 TAGGAACACTTTTACAATGTTGG + Intergenic
1099126318 12:78762413-78762435 TAGGAACACTTTTACAATGTTGG - Intergenic
1099142644 12:78997894-78997916 CAGGATCACTAAGAGAAAGATGG - Intronic
1099312762 12:81048481-81048503 TAGGAACACTTTTACACAGTTGG - Intronic
1099313491 12:81056952-81056974 CAGGAACACTTTTACACTGTTGG - Intronic
1099434748 12:82629760-82629782 TAGGATCACTTTTACACTGTTGG - Intergenic
1099435647 12:82642167-82642189 AAGGAACACTTTTACACAGTTGG + Intergenic
1099436566 12:82653050-82653072 CAGGAACACTTTTACACTGTTGG - Intergenic
1099626955 12:85087557-85087579 CAGGAACACTTTTACACTGTTGG - Intronic
1099696078 12:86021115-86021137 CAGGAACACTTTTACACTGTTGG + Intronic
1100053252 12:90476854-90476876 TAGGAACACTTTTACACAGTTGG - Intergenic
1100248896 12:92794257-92794279 CAGGAACACTTTTACACTGTTGG + Intronic
1100399221 12:94213266-94213288 CAGGAACACTTTTACACTGTTGG - Intronic
1100653449 12:96615890-96615912 TAGGAACACTTTTACACAGTTGG + Intronic
1100763355 12:97834494-97834516 CAGGAACACTTTTACACTGTTGG + Intergenic
1100966231 12:100016206-100016228 CAGGAACACTTTTACACTGTTGG + Intergenic
1101028482 12:100636739-100636761 CAGGAACACTTTTACACTGTTGG - Intergenic
1101078334 12:101154506-101154528 CAGGAACACTTTTACACTGTTGG + Intergenic
1101636437 12:106546531-106546553 CAGGAACACTTTTACACTGTTGG - Intronic
1102470209 12:113155460-113155482 TAGGCTCATTTTTCCAAAGAGGG - Intronic
1103426385 12:120838885-120838907 CAGGAACACTTTTACACTGTTGG + Intronic
1104301175 12:127566436-127566458 CAGGAACACTTTTACACTGTTGG + Intergenic
1105616936 13:22027594-22027616 CAGGAGCACTATTTCAAAGAGGG + Intergenic
1105663174 13:22522129-22522151 CAGGAACACTTTTACACTGTTGG - Intergenic
1106552219 13:30781902-30781924 CAGGAACACTTTTACACTGTTGG - Intergenic
1106886532 13:34191242-34191264 TAGGAACACTTTTACACAGTTGG + Intergenic
1106904134 13:34387063-34387085 CAGGAACACTTTTACACTGTTGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107112000 13:36708066-36708088 TAGGAACACTTTTACACAGTTGG + Intergenic
1107145091 13:37053046-37053068 CAGGAACACTTTTACACTGTTGG + Intronic
1107154484 13:37150568-37150590 TAGGAACACTTTTACAATGTTGG - Intergenic
1107304270 13:39001429-39001451 TAGGAACACTTTTACAATGTTGG - Intergenic
1107484938 13:40817046-40817068 CAGAATCACTTTTACCCAGGAGG + Intergenic
1108168525 13:47717670-47717692 TAGGAACACTTTTACACAGTTGG + Intergenic
1108169868 13:47730034-47730056 TAGGAACACTTTTACACAGTTGG - Intergenic
1108170823 13:47740261-47740283 TAGGAACACTTTTACACAGTTGG + Intergenic
1108170901 13:47740987-47741009 TAGGAACACTTTTACACAGTTGG + Intergenic
1108383072 13:49872695-49872717 CAGGATCACTTAAACCCAGAAGG + Intergenic
1108955412 13:56150349-56150371 AAGGATAAATTTTACAAAAAAGG - Intergenic
1109363745 13:61329102-61329124 CAGGAACACTTTTACACTGTTGG + Intergenic
1109572540 13:64211669-64211691 CAGGAGCACTTTTACACTGTTGG - Intergenic
1109842169 13:67933159-67933181 GAGGATAAATATTACAAAGATGG - Intergenic
1110121965 13:71893843-71893865 TAGGAACACTTTTACACAGTTGG + Intergenic
1110331677 13:74280078-74280100 CAGGATAAATTTTAAAAGGAAGG - Intergenic
1110559996 13:76900833-76900855 CAGTATCACTTCTAGCAAGAAGG - Intergenic
1110752823 13:79135897-79135919 TAGGAACACTTTTACAATGTTGG + Intergenic
1110891117 13:80699832-80699854 CAGGAACACTTTTACACTGTTGG - Intergenic
1111026878 13:82538773-82538795 CAGGAACACTTTTACACTGTTGG + Intergenic
1111049175 13:82856657-82856679 TAGGAACACTTTTACACTGATGG - Intergenic
1111142228 13:84134207-84134229 CAGGAACACTTTTACACTGTTGG + Intergenic
1111214866 13:85128586-85128608 CAGGAACACTTTTACACTGTTGG + Intergenic
1111273033 13:85912404-85912426 CAGGAACACTTTTACACTGTTGG - Intergenic
1111325082 13:86683525-86683547 CAGGAACACTTTTACACTGTTGG + Intergenic
1111390466 13:87588197-87588219 TAGGATCACTTTTACACTGTTGG + Intergenic
1111779114 13:92698779-92698801 CAGGAACACTTTTACACTGTTGG - Intronic
1111786674 13:92795889-92795911 CAGGAACACTTTTACACTGTTGG + Intronic
1111792420 13:92875082-92875104 TAGGAACACTTTTACACAGTTGG + Intergenic
1111953467 13:94730266-94730288 CAGGAACACTTTTACACTGTTGG + Intergenic
1112154180 13:96799224-96799246 CAGGAACACTTTTACACTGTTGG - Intronic
1112644443 13:101313688-101313710 CAGGAACACTTTTACACTGTTGG + Intronic
1112912629 13:104507124-104507146 CAATATCACTTTTTAAAAGATGG - Intergenic
1113364551 13:109664087-109664109 CAGGAACACTTTTACACTGTTGG + Intergenic
1114144896 14:19963690-19963712 CAGGAACACTTTTACACTGTTGG + Intergenic
1114580772 14:23757329-23757351 CAGGAACACTTTTACACTGTTGG - Intergenic
1114809177 14:25875779-25875801 CAGCATCATTATTACAAAAATGG - Intergenic
1114900137 14:27047475-27047497 CAGGAACACTTTTACACTGTTGG + Intergenic
1115103107 14:29727012-29727034 CAGGAGCACTTTTACACTGTTGG - Intronic
1115368030 14:32581166-32581188 CAGGAACACTTTTACACTGTTGG - Intronic
1115369998 14:32602638-32602660 CAGGATAGCTTTTAAAAAGTAGG - Intronic
1115673419 14:35642714-35642736 CAGGAACACTTTTACATGGTTGG + Intronic
1116036524 14:39634152-39634174 CAGGAACACTTTTACACTGCTGG - Intergenic
1116092915 14:40331586-40331608 CAGGAACACTTTTACACTGTTGG + Intergenic
1116170525 14:41396014-41396036 TAGGAACACTTTTACACAGTTGG + Intergenic
1116183475 14:41566448-41566470 CAGGAACACTTTTACACTGTTGG - Intergenic
1116252223 14:42500408-42500430 CAGGAACACTTTTACACTGTTGG - Intergenic
1116343483 14:43756782-43756804 CAGGAACGCTTTTACAATGTTGG + Intergenic
1116407632 14:44584610-44584632 CAGGAACACTTTTACACTGTTGG - Intergenic
1116499881 14:45607771-45607793 CAGGAACACTTTTACACTGTTGG + Intergenic
1116548783 14:46207360-46207382 TAGGAACACTTTTACACAGTTGG + Intergenic
1116677558 14:47925284-47925306 TAGGAACACTTTTACAATGTTGG - Intergenic
1116872239 14:50079367-50079389 CAGGAGCACTTTTACACTGTTGG + Intergenic
1117014209 14:51501838-51501860 AAGGAACACTTTTACACAGTTGG - Intronic
1117332042 14:54722500-54722522 CAGTATCTTTTTGACAAAGAAGG - Intronic
1117725416 14:58668353-58668375 CAGGTTCACTTAGACAAAGCTGG + Intergenic
1117808388 14:59518695-59518717 CAGGAACACTTTTACACTGTTGG + Intronic
1118076588 14:62306286-62306308 CAGGAACACTTTTACACTGTTGG - Intergenic
1118189537 14:63567964-63567986 CAGGATCGCTCTTGCAAAGAAGG + Intergenic
1118414716 14:65523187-65523209 CAGGAACACTTTTACACTGTTGG - Intronic
1118616717 14:67579122-67579144 CAGTTTCACTTCTAAAAAGACGG - Exonic
1119009823 14:70972920-70972942 CTGGATAAGATTTACAAAGAGGG + Intronic
1119154858 14:72400722-72400744 CAGACTCACTTTTATAAAAATGG + Intronic
1120679681 14:87465560-87465582 CAGGATACCTGTCACAAAGATGG - Intergenic
1120723357 14:87911241-87911263 CAGGAACACTTATACACTGATGG - Intronic
1121116598 14:91347711-91347733 CAGGAACACTTTTACACTGTTGG + Intronic
1121532578 14:94667118-94667140 CAGGATCATTTTTTAAAAAACGG - Intergenic
1122192333 14:100055457-100055479 CAGTAACATTTTTCCAAAGAAGG + Intronic
1122282498 14:100631997-100632019 CAGGAACACTTTTACACTGTTGG + Intergenic
1123226650 15:17042940-17042962 TAGGAACACTTTTACAAAGTGGG + Intergenic
1123483283 15:20655944-20655966 TAGGAACACTTTTACACAGTTGG - Intergenic
1124859924 15:33429384-33429406 GAGGCTGACTTTTACAAGGAAGG - Intronic
1124896387 15:33781098-33781120 CAGGATCATTTTACAAAAGAGGG - Intronic
1126084194 15:44995904-44995926 CAGGAACACTTTTACACTGTTGG + Intergenic
1126201062 15:45986798-45986820 TAGGAACACTTTTACACAGTTGG + Intergenic
1126265512 15:46748982-46749004 CAGGAACACTTTTACACTGTTGG + Intergenic
1126272318 15:46834302-46834324 CAGGAACACTTTTACACTGTTGG + Intergenic
1126307590 15:47278226-47278248 CAGGAACACTTTTACACTGTTGG - Intronic
1126442519 15:48705357-48705379 CAGAATTATATTTACAAAGATGG + Intergenic
1126944683 15:53806459-53806481 CAGGAACACTTTTACACTGTTGG + Intergenic
1127185584 15:56476432-56476454 CAGGAACACTTTTACACTGTCGG - Intergenic
1127192162 15:56541856-56541878 CAGGAACACTTTTACACTGTTGG + Intergenic
1127341123 15:58045271-58045293 CAGGAGCACTTTTACACTGTTGG + Intronic
1127564477 15:60173471-60173493 CAGGAACACTTTTACACCGTTGG + Intergenic
1129529934 15:76257545-76257567 GAGGAACACTTTTACAATGTTGG + Intronic
1129572622 15:76704923-76704945 CAGGAACACTTTTACACTGTTGG + Intronic
1129621496 15:77151126-77151148 CAGGAACACTTTTACACTGTTGG - Intronic
1129623800 15:77175630-77175652 CAGGAACACTTTTACACTGTTGG + Intronic
1130111000 15:80965330-80965352 CAGGAACACTTTTACACTGTTGG + Intronic
1130181012 15:81628597-81628619 CAGGAACACTTTTACACTGTTGG + Intergenic
1130245706 15:82246492-82246514 TAGGATAACTTTGACTAAGAAGG + Intronic
1130827158 15:87561122-87561144 CAGGAACACTTTTACACTGTTGG + Intergenic
1131402607 15:92137587-92137609 TAGGAACACTTTTACACAGTTGG - Intronic
1131444740 15:92488528-92488550 CAGGAACACTTTTACACTGTTGG + Intronic
1131719758 15:95154999-95155021 CAGGAACACTTTTACACTGTTGG - Intergenic
1132287454 15:100674179-100674201 CAGGAACACTTTTACACTGTTGG - Intergenic
1132411664 15:101583299-101583321 CTGGATTACTTATACATAGATGG - Intergenic
1202951421 15_KI270727v1_random:42208-42230 CAGGAACACTTTTACACTGGTGG + Intergenic
1133826914 16:9286172-9286194 CAGGAACACTTTTACACTGTTGG - Intergenic
1133874897 16:9724545-9724567 CAGGAACACTTTTACACTGTTGG - Intergenic
1134239157 16:12492143-12492165 CAGGAACACTTTTACACTGTTGG - Intronic
1134880087 16:17738669-17738691 TAGGAACACTTTTACACAGTTGG + Intergenic
1134898464 16:17911921-17911943 TAGGAACACTTTTACACAGTTGG + Intergenic
1135171258 16:20186021-20186043 CAGGAACACTTTTACACTGTTGG + Intergenic
1135239851 16:20794745-20794767 CATAATCTCTTTTACAGAGAAGG + Intronic
1135693580 16:24566136-24566158 CTGGATCACATTTTAAAAGAAGG + Intronic
1136743534 16:32561959-32561981 CAGGAACACTTTTACACTGTTGG + Intergenic
1136901220 16:34040316-34040338 TAGGAACACTTTTACAATGTTGG + Intergenic
1137032573 16:35537679-35537701 CAGGAACACTTTTACACTGTTGG + Intergenic
1137681364 16:50348784-50348806 CAGGAACACTTTTACACTGTTGG + Intronic
1137809044 16:51335320-51335342 CAGGAACACTTTTACACTGTTGG + Intergenic
1138162504 16:54767777-54767799 TAGGAACACTTTTACACAGTTGG - Intergenic
1138690323 16:58761583-58761605 CATGAACACTTTTCAAAAGAAGG - Intergenic
1138714121 16:59002102-59002124 CAGGAACACTTTTACACTGTTGG - Intergenic
1138822304 16:60276106-60276128 CAGGAACACTTTTACACTGTTGG + Intergenic
1138823703 16:60292573-60292595 CAGGAACACTTTTACACTGTTGG - Intergenic
1138847606 16:60585659-60585681 CAGGAACACTTTTACACTGTTGG + Intergenic
1138891978 16:61154510-61154532 CAGGAACACTTTTACACTGTTGG - Intergenic
1140284137 16:73585102-73585124 CAGGATCACTTTTACACTCTTGG + Intergenic
1140575129 16:76158726-76158748 CAGGAACACTTTTACACTGTTGG + Intergenic
1140582664 16:76249902-76249924 CAGGAACACTTTTACACTGTTGG - Intergenic
1140586529 16:76299522-76299544 CAGGAACACTTTTACACTGTTGG + Intronic
1140610853 16:76597205-76597227 CAGGAACACTTTTACACTGTTGG - Intronic
1140639338 16:76953890-76953912 CAGGAACACTTTTACACTGTTGG + Intergenic
1140693295 16:77506387-77506409 CAGGAACACTTTTACACTGTTGG + Intergenic
1140978842 16:80086677-80086699 CAGGAACACTTTTACACTGTTGG - Intergenic
1141270489 16:82535803-82535825 CACAAACACTTTTACAAAAATGG + Intergenic
1141795136 16:86267562-86267584 CAGGAACACTTTTACACTGTTGG + Intergenic
1141858736 16:86702218-86702240 CAGGATCACTTGAACCCAGAAGG + Intergenic
1203026064 16_KI270728v1_random:513270-513292 CAGGAACACTTTTACACTGTTGG - Intergenic
1203045657 16_KI270728v1_random:821161-821183 CAGGAACACTTTTACACTGTTGG + Intergenic
1142532721 17:593686-593708 CAGGAACACTTTTACACTGTTGG + Intronic
1142916875 17:3147981-3148003 CAGGAACACTTTTACACTGTTGG - Intergenic
1142920583 17:3181921-3181943 CAGGAACACTTTTACACTGTTGG + Intergenic
1143438669 17:6950845-6950867 CAGGAACACTTTTACACTGTTGG + Intronic
1143815790 17:9513548-9513570 CAGGAACTCTTATACACAGATGG + Intronic
1144608121 17:16685859-16685881 CAGAATCACTTAAACAAAGGAGG - Intergenic
1145688229 17:26700177-26700199 TAGGAACACTTTTACACAGTTGG + Intergenic
1145846889 17:28046818-28046840 CAGACTCACTTTTACCAAGGTGG - Intronic
1146113052 17:30109188-30109210 CAGGATAACGGTTACAAACATGG - Intergenic
1146166966 17:30597404-30597426 CAGGAACACTTTTACACTGTTGG - Intergenic
1146451399 17:32977179-32977201 TAGGAACACTTTTACACAGTTGG + Intronic
1147745101 17:42690084-42690106 CAGGATTCCTTATACAAAGCTGG - Exonic
1148335810 17:46840615-46840637 CAGGAACACTTTTACACTGTTGG - Intronic
1149223457 17:54441265-54441287 CAGGAACACTTTTACACTGTTGG + Intergenic
1149277721 17:55062712-55062734 CAGGAACACTTTTACACTGTTGG - Intronic
1149409124 17:56385848-56385870 CAGGAACACTTTTACACTGTTGG + Intronic
1150340895 17:64366351-64366373 CAGGAACACTTTTACACTGTTGG + Intronic
1150857922 17:68770940-68770962 CAGGAACACTTTTACACTGTTGG - Intergenic
1150878728 17:68999740-68999762 CAGGAACACTTTTACACTGTTGG - Intronic
1150901283 17:69280411-69280433 CAGGAACACTTTTACACTGTTGG + Intronic
1150933702 17:69612555-69612577 CAGGAACACTTTTACACTGTTGG - Intergenic
1150945434 17:69741016-69741038 CAGGAACACTTTTACACTGTTGG - Intergenic
1151006014 17:70436616-70436638 CAGGAACACTTTTACACTGTTGG - Intergenic
1152148307 17:78582768-78582790 CAGGATTGCTTTTTCCAAGATGG - Intergenic
1152507976 17:80764775-80764797 CAGGAACACTTTTACACTGTTGG - Intronic
1153243679 18:3053388-3053410 CAGGACCACTTCTGGAAAGAGGG - Intergenic
1153340545 18:3969537-3969559 CTGGATCTCTTTTACAAATAAGG - Intronic
1153374804 18:4363783-4363805 TAGGAACACTTTTACAAGGTTGG + Intronic
1153742747 18:8145946-8145968 CAGGAACACTTTTACACTGTTGG - Intronic
1153857613 18:9166334-9166356 CAGGAACACTTTTACACTGTTGG - Intronic
1154320179 18:13343696-13343718 CAGGAACACTTTTACACTGTTGG - Intronic
1154346090 18:13544752-13544774 CAAAATCACTATTATAAAGATGG - Intronic
1155111702 18:22722021-22722043 CAGGAACACTTTTACACTGTTGG + Intergenic
1155321100 18:24619657-24619679 CAGGAACACTTTTACACTGTTGG - Intergenic
1155401418 18:25443522-25443544 GAGGACCACTTGCACAAAGAAGG + Intergenic
1155458831 18:26053055-26053077 CAGGAGCACTCTGAAAAAGAAGG + Intronic
1155579330 18:27284942-27284964 CAGGAACACTTTTACACTGTTGG + Intergenic
1156071693 18:33219303-33219325 CAGGAACACTTTTACACTGTTGG + Intronic
1156114262 18:33768061-33768083 CAGGAACACTTTTACACTGTTGG + Intergenic
1156152626 18:34260501-34260523 CAGGAACACTTTTACACTGTTGG - Intergenic
1156298490 18:35814917-35814939 TAGGATCACTTTTACACCGTTGG + Intergenic
1156532082 18:37827210-37827232 CAGGAACACTTTTACACTGTTGG - Intergenic
1156543449 18:37940037-37940059 CAGGAACACTTTTACACTGTTGG - Intergenic
1156543565 18:37941409-37941431 CAGGAACACTTTTACACTGTTGG + Intergenic
1156665121 18:39395596-39395618 CAGGAACACTTTTACACTGTTGG + Intergenic
1156679457 18:39570984-39571006 CAGGAACACTTTTACACTGTTGG + Intergenic
1156734005 18:40230429-40230451 CAGGAACACTTTTACACTGTTGG - Intergenic
1156740780 18:40325016-40325038 CAGGAACACTTTTACACTGTTGG - Intergenic
1156752920 18:40482637-40482659 CAGCATCAGTTTTATTAAGACGG - Intergenic
1157029699 18:43890722-43890744 CAGGAACACTTTTACACTGTTGG + Intergenic
1157072246 18:44421749-44421771 CAGGAACACTTTTACACTGTTGG + Intergenic
1157211273 18:45744292-45744314 GTGGATTACTTTTTCAAAGAGGG + Intronic
1157845815 18:51003070-51003092 CAGGAACACTTTTACACTGTTGG + Intronic
1158110989 18:53941431-53941453 CAAGAGTAGTTTTACAAAGAAGG - Intergenic
1158190284 18:54820233-54820255 CAGGAACACTTTTACACTGTTGG - Intronic
1158560529 18:58509497-58509519 CAGGAACACTTTTACACTGTTGG - Intronic
1158707688 18:59808067-59808089 CAGGATCAGTCTTCCAAAGCAGG + Intergenic
1158909877 18:62049316-62049338 CAGGAACACTTTTACACTGTTGG - Intronic
1158944945 18:62439945-62439967 CAGGAACACTTTTACACTGTTGG - Intergenic
1159129665 18:64266669-64266691 CAGGAACACTTTTACACTGTTGG - Intergenic
1159155623 18:64578046-64578068 CAGGAACACTTTTACACTGTTGG + Intergenic
1159327834 18:66947203-66947225 TAGGAACACTTTTACAATGTTGG + Intergenic
1159839221 18:73377342-73377364 CAGGAACACTTTTACACTGTTGG + Intergenic
1160284888 18:77532757-77532779 CAGGAACACTTTTACACTGTTGG - Intergenic
1160502185 18:79407157-79407179 CAGGCTCATTTTTAGAAAGTTGG + Intronic
1163226914 19:15969184-15969206 CAGGAACACTTTTACACTGTTGG + Intergenic
1163399215 19:17081931-17081953 CAGGATGAAGTTTACAAACAGGG + Intronic
1163952213 19:20599249-20599271 CGGGATCACTTTTACACTGATGG - Intronic
1164142271 19:22482979-22483001 CAGCCTCACATTTACAAAAATGG - Intronic
1164350370 19:27329707-27329729 CAGGAACACTTTTACACTGTTGG + Intergenic
1164430382 19:28182989-28183011 CAGGAACACTTTTACACTGTTGG + Intergenic
1164568859 19:29353839-29353861 CAGGAACACTTTTACACTGTTGG + Intergenic
1165264819 19:34651556-34651578 CAGAATAAATTTAACAAAGAAGG + Intronic
1165605967 19:37104599-37104621 CAGGAACACTTTTACACTGTTGG - Intronic
1165632804 19:37316271-37316293 TAGGTTCAGTTTTGCAAAGACGG + Intronic
1165982030 19:39732696-39732718 CAGGAACACTTTTACACTGTTGG - Intronic
1166097144 19:40547643-40547665 CAGGAACACTTTTACACTGTTGG - Intronic
1166613458 19:44221375-44221397 CAGGAACACTTTTACACTGCTGG - Intronic
1166666380 19:44682827-44682849 TTGGATCCCTTTTGCAAAGAAGG - Intronic
1166943811 19:46384835-46384857 GAGGATCACTTCTACAGAGAAGG - Exonic
1167860896 19:52283098-52283120 CAGGAACACTTTTACACTGTTGG - Intronic
1168010232 19:53524377-53524399 CAGGAACACTTTTACACTGTTGG - Intronic
925509887 2:4613469-4613491 TAGGGTCCCTTTGACAAAGAGGG + Intergenic
925720763 2:6824436-6824458 CAGGAACACTTTTACACTGTTGG + Intergenic
925861722 2:8184080-8184102 CAGGAACACTTTTACACTGTTGG + Intergenic
926431450 2:12790072-12790094 CAGGAACACTTTTACACTGTTGG - Intergenic
926469525 2:13236707-13236729 TAGGAACACTTTTACAATGTTGG - Intergenic
926495440 2:13581096-13581118 CAGGAACACTTTTACACTGTTGG - Intergenic
926627499 2:15104664-15104686 CAGGAACACTTTTACACTGTTGG - Intergenic
926649080 2:15321766-15321788 CAGGAACACTTTTACACTGTTGG + Intronic
926721261 2:15963001-15963023 CAGGAACACTTTTACACTGTTGG + Intergenic
926978680 2:18542199-18542221 CAAAATCACTTTTACCCAGAGGG - Intergenic
927230587 2:20821143-20821165 CAGGAACACTTTTACACTGTTGG + Intronic
927275713 2:21260712-21260734 CTGGATCTCTTTTGAAAAGATGG + Intergenic
927439980 2:23107586-23107608 GAGGATCAGTGTTACAAAGGAGG + Intergenic
928187953 2:29131647-29131669 CAAAATTAATTTTACAAAGAAGG - Intronic
928188705 2:29140693-29140715 CAGGAACACTTTTACACTGTTGG - Intronic
928232754 2:29514027-29514049 CAGGAACACTTTTACACTGTTGG + Intronic
928247514 2:29643775-29643797 CAGGAACACTTTTACACTGTTGG + Intronic
928408776 2:31037527-31037549 AAGCATGACTTCTACAAAGAGGG - Intronic
928721693 2:34128402-34128424 CAGGAACACTTTTACACTGTTGG - Intergenic
928765518 2:34640843-34640865 TAGGAACACTTTTACACTGATGG + Intergenic
928776048 2:34765110-34765132 TAGGATCACTTTTACACTGTTGG + Intergenic
928878196 2:36066047-36066069 CAGGAACACTTTTACACTGTTGG + Intergenic
929799421 2:45086718-45086740 CAGGAACACTTTTACACTGTTGG + Intergenic
930505229 2:52275062-52275084 CAGGAACACTTTTACACTGTTGG + Intergenic
930598282 2:53414077-53414099 TAGGAACACTTTTACACTGATGG + Intergenic
930615821 2:53592415-53592437 CAGGAACACTTTTACACTGTTGG + Intronic
930768963 2:55112920-55112942 CAGTCTGACATTTACAAAGATGG + Intergenic
930923869 2:56792051-56792073 TAGGATCACTTTTACACTGTTGG + Intergenic
930964777 2:57308723-57308745 CAGGAACACTTTTACACTGTTGG + Intergenic
931292746 2:60890062-60890084 TAGGAACACTTTTACACAGTTGG - Intronic
931468740 2:62516134-62516156 CAGGAACACTTTTACACTGTTGG - Intergenic
932069252 2:68600461-68600483 CAGGAACACTTTTACACTGTTGG + Intronic
932084051 2:68742017-68742039 GAGCATCACTTTTAGAAAGGTGG - Intronic
932520723 2:72409244-72409266 CAGGAACACTTTTACACTGTTGG + Intronic
932608598 2:73181615-73181637 CAGGAACACTTTTACACTGTTGG + Intergenic
933513188 2:83266903-83266925 CAGAATCTCATTTACAAACAGGG - Intergenic
934045170 2:88167784-88167806 TAGGATCATTTCTGCAAAGAAGG + Intergenic
934811356 2:97280646-97280668 CAGGAACACTTTTACACTGTTGG + Intergenic
934812646 2:97295953-97295975 TAGGATCACTTTTACACTGTTGG + Intergenic
934825048 2:97412519-97412541 TAGGATCACTTTTACACTGTTGG - Intergenic
934826335 2:97427294-97427316 CAGGAACACTTTTACACTGTTGG - Intergenic
935389349 2:102534107-102534129 CAGGAACACTTTTACACTGTTGG - Intergenic
935601444 2:104926482-104926504 CAGGAACACTTTTACACTGTTGG + Intergenic
935852585 2:107238926-107238948 TAGGAACACTTTTACACAGTTGG + Intergenic
936720046 2:115240216-115240238 CAGGAACACTTTTACACTGTTGG - Intronic
936750188 2:115632958-115632980 TAGGAACACTTTTACAATGTTGG + Intronic
936934717 2:117827940-117827962 CAGGAACACTTTTACACTGTTGG - Intronic
936943585 2:117910724-117910746 TAGGAACACTTTTACACAGTTGG - Intergenic
937003195 2:118487313-118487335 CAGGAACACTTTTACACTGTTGG + Intergenic
937456583 2:122046812-122046834 CAGGAACACTTTTACACTGTTGG - Intergenic
937724840 2:125150195-125150217 CAGGACCACTTTTACACTGTTGG - Intergenic
938204842 2:129411668-129411690 CAGGAACACTTTTACACTGTTGG - Intergenic
938233633 2:129683042-129683064 CAGGAACACTTTTACACTGTTGG - Intergenic
938320563 2:130359594-130359616 CAGGATCACCTAGACAAGGAGGG - Exonic
938441831 2:131342094-131342116 CAGGAACACTTTTACACTGTTGG - Intronic
939294570 2:140243641-140243663 AAGGATCACCTTTACTAAGTTGG - Intronic
939491539 2:142882943-142882965 CAGGAACACTTTTACACTGTTGG - Intronic
939503146 2:143011440-143011462 CAGGAACACTTTTACACTGTTGG + Intronic
939890685 2:147732395-147732417 CAGGAACACTTTTACACTGTTGG + Intergenic
940096616 2:149983371-149983393 CAGAAACACTTTTACACTGATGG + Intergenic
940260878 2:151778612-151778634 CAGGAACACTTTTACACTGTTGG + Intergenic
940441831 2:153724833-153724855 CAGGAACACTTTTACACTGTTGG + Intergenic
940453119 2:153865688-153865710 CAGGAACACTTTTACACTGTTGG + Intergenic
940891187 2:159036973-159036995 CAGGAACACTTTTACACTGTTGG - Intronic
940933314 2:159462650-159462672 CAGGTTCACTATTACGAAGATGG - Intronic
940937044 2:159507756-159507778 TATGATTACTTTTAAAAAGAAGG + Intronic
941100683 2:161291703-161291725 CAGGAACACTTTTACACTGTTGG + Intergenic
941592936 2:167442492-167442514 CAGGAACACTTTTACACTGTTGG - Intergenic
942090644 2:172487020-172487042 CAGGTTCACTTCTTAAAAGAGGG + Exonic
942270890 2:174273828-174273850 CAGGAACACTTTTACACTGTTGG + Intergenic
942504270 2:176625272-176625294 CAGGAACACTTTTACACTGTTGG + Intergenic
942790215 2:179752548-179752570 CAGGAACACTTTTACACTGTTGG - Intronic
942899266 2:181094744-181094766 CAGGAACACTTTTACACTGTTGG + Intergenic
942955422 2:181767245-181767267 CAGGAACACTTTTACACTGTTGG - Intergenic
943037964 2:182769439-182769461 CAGGAACACTTTTACACTGTTGG - Intronic
943211619 2:184974538-184974560 CAGGAACACTTTTACACTGTTGG - Intergenic
943303900 2:186235829-186235851 CAGGAACACTTTTACACTGGTGG + Intergenic
943556840 2:189416088-189416110 CAGGAACACTTTTACACTGTTGG + Intergenic
943681494 2:190772864-190772886 CAGGAACACTTTTACACTGTTGG - Intergenic
943814678 2:192237598-192237620 CAGGAACACTTTTACACTGTTGG - Intergenic
943823844 2:192362571-192362593 CAGGAACACTTTTACACAGTTGG + Intergenic
943998709 2:194805010-194805032 TAGGATCACTTTTACACTGTTGG - Intergenic
944019837 2:195088859-195088881 TAGGAACACTTTTACAATGTTGG + Intergenic
944267258 2:197742191-197742213 TAGGAACACTTTTACAATGTTGG + Intronic
944354653 2:198772420-198772442 CAAGATCATTTTTAGGAAGAGGG - Intergenic
944486010 2:200206421-200206443 CAGGAACACTTTTACAGTGTTGG + Intergenic
944536495 2:200715498-200715520 CAGGAACACTTTTACACTGTTGG - Intergenic
944600208 2:201296039-201296061 CAGGAACACTTTTACACTGTTGG + Intronic
945210480 2:207377086-207377108 CAGGAACACTTTTACACTGTTGG - Intergenic
945417693 2:209595485-209595507 CAGGAACACTTTTACATTGTTGG + Intronic
945553819 2:211254531-211254553 TAGGAACACTTTTACAATGTTGG - Intergenic
945867789 2:215195889-215195911 CAGGAACACTTTTACACTGTTGG + Intergenic
946754816 2:222933353-222933375 TCGGAACATTTTTACAAAGAAGG - Intronic
946800114 2:223405715-223405737 CAGGAACACTTTTACACTGTTGG + Intergenic
946944920 2:224811098-224811120 CAGGAACACTTTTACACTGTTGG - Intronic
947132726 2:226945771-226945793 CAGGAACACTTTTACACTGTTGG - Intronic
947193831 2:227540809-227540831 CAGGAACACTTTTACACTGCTGG - Intronic
947241737 2:228002183-228002205 CAGGAACACTTTTACACTGTTGG - Intronic
947270043 2:228324054-228324076 CAGGATCAGTCTGAAAAAGAGGG + Intergenic
947559728 2:231138100-231138122 CAGGATCATCTTTTAAAAGATGG + Intronic
947665399 2:231902253-231902275 CAAGATCACTTCTAAAAAAATGG + Intergenic
948303676 2:236930348-236930370 CAGGAACACTTTTACACTGTTGG + Intergenic
948344975 2:237287834-237287856 CAGGATCAATCTCACACAGAAGG + Intergenic
948503870 2:238414942-238414964 AAGGATCAACTTTAGAAAGATGG - Intergenic
948821368 2:240549893-240549915 CAGGAACACTTTTACACTGTTGG + Intronic
1169400665 20:5276805-5276827 CAGGAACACTTTTACACTGTTGG - Intergenic
1169700837 20:8444662-8444684 CAGGAACACTTTTACATTGTTGG - Intronic
1169702686 20:8465851-8465873 CAGGAACACTTTTACACTGTTGG + Intronic
1169721188 20:8678503-8678525 CAGCACCACTTTTACTAGGATGG - Intronic
1169733041 20:8807271-8807293 CAGGGTCACTTATAGAACGATGG + Intronic
1170385378 20:15810478-15810500 CAGGAACACTTTTACACTGTTGG - Intronic
1170794798 20:19537404-19537426 CAGGAACACTTTTACACTGTTGG + Intronic
1170832348 20:19853496-19853518 CAGGAACACTTTTACACTGTTGG - Intergenic
1171512902 20:25701325-25701347 TAGGAACACTTTTACACTGATGG - Intergenic
1171528356 20:25834012-25834034 TAGGTTCAGTTTTGCAAAGATGG + Intronic
1171548470 20:26021866-26021888 TAGGTTCAGTTTTGCAAAGATGG - Intergenic
1171743481 20:28933758-28933780 TAGGAACACTTTTACACAGTGGG - Intergenic
1171836483 20:30156157-30156179 CAGGAACACTTTTACACTGTTGG + Intergenic
1171934743 20:31263657-31263679 CAGGAACACTTTTACACTGTTGG - Intergenic
1173440400 20:43070352-43070374 CAGGAACACTTTTACACTGTTGG + Intronic
1173714987 20:45195852-45195874 CAGGAACACTTTTACACTGTTGG - Intergenic
1174208374 20:48857681-48857703 CAGGATCACTTGAACCAAGAAGG + Intergenic
1174596198 20:51685743-51685765 CAGGAACACTTTTACACTGTTGG + Intronic
1175025756 20:55900841-55900863 CAGGAACACTTTTACACTGTTGG - Intergenic
1175131861 20:56795271-56795293 CAGGAAGAGTTTTCCAAAGAGGG - Intergenic
1175350009 20:58310600-58310622 CAGCATCAATTTCAGAAAGAAGG - Intronic
1175591524 20:60196027-60196049 CAGGAACACTTTTACACTGTTGG - Intergenic
1176760242 21:10775150-10775172 CAGGAACACTTTTACACTGTTGG + Intergenic
1177155602 21:17498311-17498333 CAGGAACACTTTTACACTGTTGG - Intergenic
1177584548 21:23073452-23073474 CAGGAACACTTTTACACTGTTGG + Intergenic
1177816898 21:25987527-25987549 CATGATCACTATTAAAAGGAAGG - Intronic
1177942869 21:27432564-27432586 CAGGAACACTTTTACAGTGTTGG - Intergenic
1177971274 21:27792995-27793017 AAGGAACACTTTTACACTGATGG + Intergenic
1178219462 21:30639689-30639711 CAGGAACACTTTTACACTGTTGG - Intergenic
1178738503 21:35174765-35174787 CAGGAACACTTTTACACTGTTGG + Intronic
1178747944 21:35271616-35271638 CAGGAACACTTTTACACTGTTGG + Intronic
1179386342 21:40946485-40946507 TAGGAACACTTTTACACAGTTGG + Intergenic
1179823118 21:43948437-43948459 CTGGATCACTTGCTCAAAGAGGG + Intronic
1180295570 22:10931120-10931142 TAGGATCACTTTTACACTGTTGG - Intergenic
1180400528 22:12416371-12416393 TAGGAACACTTTTACACAGTGGG + Intergenic
1181958259 22:26604066-26604088 CATGATGACTTTTGAAAAGATGG - Intronic
1182193682 22:28491637-28491659 CAGGAACACTTTTACACTGTTGG + Intronic
1182988780 22:34746250-34746272 CAGGAACACTTTTACACTGTTGG - Intergenic
1183746068 22:39692485-39692507 TAGGAACACTTTTACACTGATGG + Intergenic
1184399118 22:44263432-44263454 CAGGGACACATTTACAAAGTAGG - Intronic
1184755967 22:46515984-46516006 CAGGAACACTTTTACACTGTTGG + Intronic
1184928912 22:47665475-47665497 CCAGATCACTTTTATAAAGGTGG - Intergenic
950317144 3:12012980-12013002 CAGTATCAATATTACAGAGAAGG - Intronic
950781073 3:15392112-15392134 TAGGATCACTTTTACACTGTTGG - Intronic
950998687 3:17532363-17532385 CAGGAACACTTTTACACTGTTGG + Intronic
951199375 3:19860441-19860463 CAGGAACACTTTTACACTGTTGG + Intergenic
951378244 3:21950170-21950192 CAGGAACACTTTTACACTGTTGG - Intronic
951420926 3:22483915-22483937 CAGGAACACTTTTACACTGTTGG + Intergenic
951498294 3:23354756-23354778 CAGGAACACTTTTACACTGTTGG + Intronic
951684989 3:25334055-25334077 CAGGAACACTTTTACACTGTTGG + Intronic
951868936 3:27338549-27338571 CAGGAACACTTTTACACTGTTGG - Intronic
951919205 3:27835033-27835055 AAGGAACACTTTTACACTGATGG - Intergenic
952513525 3:34080325-34080347 CAGGAACACTTTTACACTGTTGG - Intergenic
952658708 3:35819267-35819289 CAGGAACACTTTTACACTGTCGG - Intergenic
952681577 3:36099547-36099569 CAGGAACACTTTTACACTGTTGG + Intergenic
952693572 3:36238972-36238994 CAGGAACACTTTTACACTGTTGG + Intergenic
952695654 3:36262633-36262655 AAGGAACACTTTTACAATGTTGG - Intergenic
952711550 3:36437153-36437175 CAGGAACACTTTTACACTGTTGG + Intronic
954127730 3:48541570-48541592 CAGCATCACTTTTTTAAAAAGGG + Intronic
954349495 3:50031109-50031131 CAGGAACACTTTTACACTGTTGG + Intronic
955303501 3:57806979-57807001 CAGGAACACTTTTACACTGTTGG - Intronic
955388984 3:58505239-58505261 TAAGACCACTTTTACAAAGTTGG - Exonic
955621550 3:60869667-60869689 AGGGACCACTCTTACAAAGATGG + Intronic
955899656 3:63738704-63738726 CAGGAACACTTTTACACTGTTGG + Intergenic
955902442 3:63771497-63771519 CAGGAACACTTTTACACTGTTGG - Intergenic
955903349 3:63780605-63780627 CAGGAACACTTTTACACTGTTGG - Intergenic
956578532 3:70782878-70782900 CAGGAACACTTTTACACTGTTGG + Intergenic
956588932 3:70893093-70893115 CAGGAACACTTTTACACTGTTGG - Intergenic
957033753 3:75274070-75274092 CAGGAACACTTTTACACTGTTGG - Intergenic
957133106 3:76248018-76248040 CAGGAACACTTTTACACTGTTGG + Intronic
957267507 3:77985755-77985777 TAGGAACACTTTTACACTGATGG - Intergenic
957629588 3:82702043-82702065 CAGGAACACTTTTACATTGTTGG - Intergenic
957640409 3:82846183-82846205 TAGGATCACTTTTACACTGTTGG + Intergenic
957642054 3:82866989-82867011 CAGGAACACTTTTACACTGTTGG + Intergenic
957673832 3:83340798-83340820 CAGGAACACTTTTACACTGCTGG - Intergenic
957688573 3:83537598-83537620 CAGGAACACTTTTACACTGTTGG + Intergenic
957705376 3:83773912-83773934 CAGGAACACTTTTACACTGTTGG + Intergenic
957718508 3:83965063-83965085 CAGGAACACTTTTACACTGTTGG - Intergenic
958125146 3:89346231-89346253 CAGGAACACTTTTACACTGTTGG - Intronic
958127074 3:89370034-89370056 TAGGAACACTTTTACAATGTTGG + Intronic
958157057 3:89768733-89768755 TAGGAACACTTTTACACTGATGG - Intergenic
958208068 3:90431268-90431290 CAAGAACACTTTTACAAAGTTGG - Intergenic
958215001 3:90554541-90554563 CAAAATCCCTTTTCCAAAGAAGG + Intergenic
958433817 3:94073416-94073438 CAGGAACACTTTTACACTGTTGG - Intronic
958563633 3:95780142-95780164 TAGGAACACTTTTACACTGATGG + Intergenic
958669549 3:97185590-97185612 CAGGAACACTTTTACACTGTTGG + Intronic
958976296 3:100671164-100671186 CAGGAACACTTTTACACTGTTGG - Intronic
959075693 3:101747056-101747078 CAGGAACACTTTTACACTGTTGG + Intronic
959101410 3:102013722-102013744 CAGGAACACTTTTACACTGTTGG + Intergenic
959103970 3:102045423-102045445 CAGGAACACTTTTACATTGTTGG + Intergenic
959179044 3:102955292-102955314 CAGGGTAATTTTTATAAAGAAGG + Intergenic
959292359 3:104490312-104490334 CATGAACACTTTTCAAAAGAAGG + Intergenic
959417878 3:106099142-106099164 TAGGAACACTTTTACAATGTTGG - Intergenic
959518467 3:107298153-107298175 AAGGACCCCTTTTCCAAAGAAGG - Intergenic
959744229 3:109757845-109757867 CAGGAACACTTTTACACTGTTGG - Intergenic
959891032 3:111556818-111556840 CAGGAACACTTTTACACTGTTGG - Intronic
960018018 3:112915178-112915200 TAGGAACACTTTTACAATGTTGG + Intergenic
960125665 3:113995738-113995760 TAGGAACACTTTTACACTGATGG - Intronic
960430653 3:117564832-117564854 TAGGAACACTTTTACACAGTTGG + Intergenic
960515692 3:118599918-118599940 CAGGAACACTTTTACATGGTTGG + Intergenic
961151807 3:124644940-124644962 CAGGAACACTTTTACACTGTTGG - Intronic
961265902 3:125642557-125642579 GAGGATCACTTGTACTCAGAAGG - Intergenic
961354163 3:126324183-126324205 CAGGAACACTTTTACACTGTTGG - Intergenic
961963456 3:130877665-130877687 CAGGAACACTTTTACACTGTTGG + Intronic
961992521 3:131207280-131207302 CAGGAACACTTTTACACTGTTGG - Intronic
962123170 3:132585868-132585890 CAGGAACACTTTTACACTGTTGG + Intronic
962141635 3:132796323-132796345 CAGGAACACTTTTACACTGTTGG - Intergenic
962153177 3:132914895-132914917 CAGGAACACTTTTACACTGTTGG + Intergenic
962158117 3:132970398-132970420 CAGGAACACTTTTACACTGTTGG - Intergenic
962234520 3:133695701-133695723 CAGTATCACTTTAACACAGTTGG + Intergenic
962657316 3:137561116-137561138 CAGGAACACTTTTACACTGATGG + Intergenic
962667185 3:137666090-137666112 CAGGAACACTTTTACACTGTTGG + Intergenic
962931637 3:140043137-140043159 CAGGAACACTTTTACACTGTTGG - Intronic
963069979 3:141296154-141296176 CAGGAACACTTTTACACTGTTGG - Intergenic
963210020 3:142678886-142678908 CAGGAACACTTTTACACTGTTGG - Intronic
963978990 3:151514995-151515017 CAGGAACACTTTTACACTGTTGG + Intergenic
964020802 3:152007916-152007938 CAGGAACACTTTTACACTGTTGG - Intergenic
964048940 3:152367642-152367664 CAGGAACACTTTTACACTGTTGG - Intronic
964456591 3:156875146-156875168 AAGGATCACTTTTACACTGATGG - Intronic
964561711 3:158004355-158004377 TAGGAACACTTTTACAATGTTGG + Intergenic
964645878 3:158957907-158957929 CAGGAACACTTTTACACTGTTGG - Intergenic
964651023 3:159011318-159011340 CAGGAACACTTTTACACTGTTGG - Intronic
964896606 3:161603877-161603899 TAGGATCACTTTTACACTGTTGG + Intergenic
965025945 3:163302075-163302097 CAGGAACACTTTTACAATGTTGG + Intergenic
965228407 3:166021715-166021737 CAGGAACACTTTTACACTGTTGG - Intergenic
965435054 3:168640142-168640164 CAGGAACACTTTTACACTGTTGG + Intergenic
965987933 3:174779092-174779114 TAGGAACACTTTTACAATGTTGG - Intronic
966280425 3:178220099-178220121 CAGGAACACTTTTACACTGTTGG - Intergenic
966429473 3:179816122-179816144 CAGGAACACTTTTACACTGTTGG + Intronic
967780064 3:193428318-193428340 CAGGAACACTTTTACACTGTTGG + Intronic
969193954 4:5546091-5546113 CAGGAACACTTTTACACTGTTGG + Intronic
969977873 4:11122792-11122814 TAGGAACACTTTTACAATGTTGG - Intergenic
970079509 4:12264621-12264643 TAGGATCACTTTTACACTGTTGG - Intergenic
970275718 4:14398249-14398271 CAGGAACACTTTTACACTGTTGG - Intergenic
970755385 4:19419576-19419598 CAGGAACACTTTTACACTGTTGG + Intergenic
970888757 4:21017805-21017827 CAGGAACACTTTTACACTGTTGG - Intronic
970952257 4:21770569-21770591 CAGGAACACTTTTACACTGTTGG - Intronic
971022145 4:22547601-22547623 GAGGATCACTTTCTCATAGATGG - Intergenic
971651580 4:29282618-29282640 TAGGAACACTTTTACAACGTTGG + Intergenic
971659880 4:29400019-29400041 CAGGAACACTTTTACACTGTTGG + Intergenic
971960116 4:33475128-33475150 CAGTATCACTTATACAGAAAGGG + Intergenic
971965702 4:33552574-33552596 TAGGATCACTTTTACACTGTTGG - Intergenic
972491799 4:39594931-39594953 CAGGAACACTTTTACACTGTTGG + Intronic
972820546 4:42696907-42696929 CAGGAACACTTTTACACTGTTGG - Intergenic
972845349 4:42982669-42982691 CAGGAACACTTTTACACTGTTGG - Intronic
972864168 4:43209996-43210018 TAGGAACACTTTTACAACGTTGG + Intergenic
973049334 4:45575569-45575591 CAGGAACACTTTTACACTGCTGG + Intergenic
974147183 4:57963491-57963513 CAGGAACACTTTTACACTGTTGG + Intergenic
974155589 4:58068056-58068078 CATGAACACTTTTCAAAAGAAGG + Intergenic
974418471 4:61641900-61641922 CAGGAACACTTTTACACTGTTGG - Intronic
974536258 4:63179448-63179470 CAGGAACACTTTTACACTGTTGG - Intergenic
974680794 4:65159392-65159414 CAGGAACACTTTTACACTGTTGG - Intergenic
975007208 4:69304866-69304888 CAGGAACACTTTTACATTGTTGG + Intronic
975092311 4:70418519-70418541 CAGGAACACTTTTACACTGTTGG - Intergenic
975296968 4:72745954-72745976 CAGGAACACTTTTACACTGCTGG - Intergenic
975302222 4:72803152-72803174 CTGAAACACTTTTGCAAAGATGG + Intergenic
975352897 4:73365619-73365641 CAGGAACACTTTTACACTGTTGG + Intergenic
975398471 4:73905490-73905512 CAGGAACACTTTTACACTGTTGG - Intergenic
975501058 4:75085338-75085360 CAGGAACACTTTTACACTGTTGG - Intergenic
975692177 4:76976483-76976505 CAGGATCAATGTGACATAGAAGG - Intronic
975824182 4:78302469-78302491 CAGGAACACTTTTACACTGTTGG - Intronic
975886910 4:78977046-78977068 CAGGAACACTTTTACACTGTTGG - Intergenic
976131564 4:81890292-81890314 CAGGAACACTTTTACACTGTTGG + Intronic
976573397 4:86639204-86639226 CAGGAACACTTTTACACTGTTGG + Intronic
976996769 4:91443000-91443022 CAGGAACACTTTTACACTGTTGG + Intronic
977121285 4:93104921-93104943 CAGGAACACTTTTACACTGTTGG - Intronic
977191298 4:94004197-94004219 CAGGAACACTTTTACACTGTTGG + Intergenic
977239983 4:94556519-94556541 CAGGAACACTTTTACACTGTTGG - Intronic
977291716 4:95171852-95171874 CAGGAACACTTTTACACTGTTGG - Intronic
977417607 4:96754201-96754223 AGGGATCACTTTTATAAAGTGGG + Intergenic
977538766 4:98288645-98288667 CAGGAACACTTTTACACTGTTGG - Intronic
977713528 4:100154696-100154718 CAGGAACACTTTTACACTGTTGG - Intergenic
977857242 4:101908934-101908956 CAGGAACACTTTTACACTGTTGG + Intronic
977915801 4:102591328-102591350 GAGGATCACTTGAACACAGAAGG + Intronic
977918314 4:102617681-102617703 CAGGAACACTTTTACACTGTTGG + Intergenic
978636183 4:110810103-110810125 CAGGAACACTTTTACACTGTTGG + Intergenic
978830846 4:113082888-113082910 CAGGATCACTTTTACAAAGATGG - Intronic
978900179 4:113939524-113939546 CAGGAACACTTTTACACTGTTGG - Intronic
979197375 4:117936444-117936466 TAGGAACACTTTTACACAGTTGG - Intergenic
979415699 4:120435591-120435613 CAGGAATAGTTATACAAAGAAGG + Intergenic
979775970 4:124588965-124588987 CAGGAACACTTTTACACTGTTGG + Intergenic
979981786 4:127265269-127265291 CAGGAACACTTTTACACTGTTGG + Intergenic
980112407 4:128647420-128647442 CAGGAACACTTTTACACTGTTGG + Intergenic
980168385 4:129255564-129255586 TAGGAACACTTTTACAATGTTGG - Intergenic
980231030 4:130046809-130046831 CAGGAACACTTTTACACTGTTGG - Intergenic
980547677 4:134289470-134289492 CAGGAACACTTTTACACTGTTGG - Intergenic
980726828 4:136772885-136772907 TAGCATCACTTTTCTAAAGAAGG - Intergenic
980751194 4:137091682-137091704 TAGGAACACTTTTACACAGTTGG + Intergenic
980848450 4:138352741-138352763 CAGGAACACTTTTACACTGTTGG + Intergenic
980863870 4:138530494-138530516 CAGGAACACTTTTACACTGTTGG + Intergenic
981107337 4:140896064-140896086 CAGGAACACTTTTACACTGTTGG + Intronic
981130184 4:141149849-141149871 AAGGAACACTTTTACAATGTTGG - Intronic
981192251 4:141877960-141877982 CAGGAACACTTTTACACTGTTGG - Intergenic
981378528 4:144043808-144043830 TAGGAACACTTTTACAATGTTGG + Intergenic
981395093 4:144237988-144238010 CAGGAACACTTTTACACTGTTGG - Intergenic
981440191 4:144774071-144774093 TAGGAACACTTTTACAATGTTGG + Intergenic
981444902 4:144824269-144824291 TAGGAACACTTTTACAATGTTGG - Intergenic
981450934 4:144896889-144896911 TAGGAACACTTTTACAATGTTGG + Intergenic
981779586 4:148411958-148411980 CAGCATCAATTTAAAAAAGAGGG + Intronic
981910743 4:149979019-149979041 TAGGAACACTTTTACAATGTTGG + Intergenic
981962015 4:150552524-150552546 CAGGAACACTTTTACACTGTTGG + Intronic
982327611 4:154145197-154145219 CAGGAACACTTTTACACTGCTGG - Intergenic
982329993 4:154170626-154170648 CAGGAACACTTTTACACTGTTGG - Intergenic
982684572 4:158472714-158472736 CAGGAACACTTTTACACTGTTGG - Intronic
982752968 4:159184355-159184377 CAGGAACACTTTTACACTGTTGG - Intronic
982760500 4:159277539-159277561 CAGGAACACTTTTACACTGTTGG - Intronic
982776781 4:159450030-159450052 CAGGAACACTTTTACACTGTTGG - Intergenic
982873121 4:160608874-160608896 CAGGAACACTTTTACACTGTTGG - Intergenic
982875247 4:160640160-160640182 CAGGAACACTTTTACACTGTTGG + Intergenic
982886754 4:160791115-160791137 CAGGAACACTTTTACACTGTTGG + Intergenic
983477562 4:168233235-168233257 AGGGAACACTTTTACAAAGCTGG + Intronic
983765073 4:171469297-171469319 CAGGAACACTTTTACACTGTTGG - Intergenic
983819884 4:172180059-172180081 CAGGAACACTTTTACACTGTTGG - Intronic
984703006 4:182830349-182830371 CAGGATCACTTTTAGAAGAAAGG - Intergenic
985808144 5:2063295-2063317 CAGGAACACTTTTACACTGGTGG + Intergenic
985954021 5:3248427-3248449 TAGGAACACTTTTACACAGTTGG - Intergenic
985954864 5:3256875-3256897 CAGGAACACTTTTACACTGTTGG + Intergenic
986152856 5:5143506-5143528 TAGGAACACTTTTACACAGTTGG + Intronic
986286620 5:6363843-6363865 CAGGAACACTTTTACACTGTTGG + Intergenic
986373611 5:7107029-7107051 CAGGAACACTTTTACACTGTTGG - Intergenic
986382319 5:7199162-7199184 CAGGAACACTTTTACACTGTTGG + Intergenic
986530943 5:8736366-8736388 CAGGAACACTTTTACACTGTTGG + Intergenic
987128434 5:14837651-14837673 CAGGAACACTTTTACACTGTTGG + Intronic
987154949 5:15079667-15079689 AAGGTTTTCTTTTACAAAGAAGG - Intergenic
987475340 5:18385160-18385182 CAGGAACACTTTTACACTGTTGG - Intergenic
987523415 5:19017153-19017175 CAGGAACACTTTTACACTGTTGG + Intergenic
987563219 5:19550877-19550899 CAGGAACACTTTTACACTGTTGG - Intronic
987761083 5:22163619-22163641 CAGGATAATTCTAACAAAGATGG - Intronic
987768151 5:22262729-22262751 CAGGAACACTTTTACACTGTTGG - Intronic
987795660 5:22624687-22624709 CAGGAACACTTTTACACAGTTGG + Intronic
987927367 5:24360540-24360562 CAGGAACACTTTTACACTGTTGG + Intergenic
987974981 5:25003445-25003467 CAGGAACACTTTTACACTGTTGG - Intergenic
988012726 5:25511261-25511283 CAGGAACACTTTTACACTGTTGG - Intergenic
988056199 5:26100600-26100622 CAGGAACACTTTTACACTGTTGG + Intergenic
988210418 5:28196768-28196790 CAGGAACACTTTTACACTGTTGG - Intergenic
988644946 5:33084663-33084685 CAGGAACACTTTTACACTGTTGG + Intergenic
988661924 5:33279943-33279965 CAGGAACACTTTTACACTGTTGG + Intergenic
988742057 5:34085816-34085838 CAGGAACACTTTTACACTGTTGG + Intronic
988810534 5:34780747-34780769 CAGGAACACTTTTACACTGTTGG + Intronic
988886974 5:35568840-35568862 TAGGAACACTTTTACACAGTTGG - Intergenic
989044305 5:37259404-37259426 TAGGATCACTTTTACACTGTTGG - Intergenic
989153047 5:38319107-38319129 CAAGGTCACCTTTCCAAAGAAGG - Intronic
989297539 5:39847538-39847560 AAGGAACACTTTTACAATGTTGG - Intergenic
989419926 5:41225681-41225703 CAGGAACACTTTTACACTGTTGG - Intronic
989740065 5:44760432-44760454 CAGGAACACTTTTACATTGTTGG + Intergenic
989941140 5:50151250-50151272 CAGGAACACTTTTACACTGTTGG + Intergenic
989958358 5:50381014-50381036 CAGGAACACTTTTACACTGTTGG + Intergenic
989999455 5:50875921-50875943 CAGGAACACTTTTACATTGTTGG - Intergenic
990062586 5:51670280-51670302 CAGGAACACTTTTACACTGTTGG - Intergenic
990228619 5:53686071-53686093 CAGGAACACTTTTACACTGTTGG - Intergenic
990359332 5:55002450-55002472 CAGGAACACTTTTACACTGTTGG + Intronic
990482647 5:56226865-56226887 CAGGAACACTTTTACACTGTTGG + Intronic
990602989 5:57380187-57380209 CAGGAACACTTTTACACTGTTGG + Intergenic
990611408 5:57460513-57460535 CAGGAACACTTTTACACTGTTGG - Intergenic
990653449 5:57928343-57928365 TAGGAACACTTTTACAATGTTGG + Intergenic
990726161 5:58757057-58757079 CAGGAACACTTTTACACTGTTGG - Intronic
990745358 5:58953691-58953713 CAGGAACACTTTTACACTGTTGG - Intergenic
991049578 5:62258257-62258279 TAGGAGGACTTTTCCAAAGATGG + Intergenic
991098890 5:62770121-62770143 TAGGAACACTTTTACACAGTTGG + Intergenic
991108399 5:62868666-62868688 TAGGATCACTTTTACACTGTTGG + Intergenic
991110242 5:62891487-62891509 CAGGAACACTTTTACACTGTTGG - Intergenic
991151972 5:63381337-63381359 CAGGAACACTTTTACACTGTTGG + Intergenic
991162164 5:63516744-63516766 CAGATTCTATTTTACAAAGATGG + Intergenic
991170133 5:63615088-63615110 TAGGATCACTTTTACACTGTTGG - Intergenic
991241428 5:64465366-64465388 TAGGATCGCTTTTACAATGTTGG - Intergenic
991495873 5:67225337-67225359 CAGGAACACTTTTACACTGTTGG - Intergenic
991559052 5:67929918-67929940 TAGGAACACTTTTACACAGTTGG + Intergenic
991625847 5:68600230-68600252 TAGGAACACTTTTACACAGTTGG - Intergenic
991895873 5:71397075-71397097 CAGGATAATTCTAACAAAGATGG - Intergenic
992347652 5:75896681-75896703 CAGGAACACTTTTACACTGTTGG - Intergenic
992380315 5:76229738-76229760 CAGCATGACTTTGAGAAAGAGGG - Intronic
992514092 5:77473822-77473844 CAGGAACACTTTTACACTGTTGG + Intronic
992652346 5:78872193-78872215 CAGGAACACTTTTACACTGTTGG + Intronic
993008277 5:82451852-82451874 TAGGATCACTTTTACACTGTTGG - Intergenic
993378504 5:87178764-87178786 TAGGAAAACTTTTAAAAAGAAGG + Intergenic
993576683 5:89610843-89610865 CAGGAACACTTTTACACTGCTGG - Intergenic
993663100 5:90663225-90663247 CAGGAACACTTTTACACTGTTGG - Intronic
993818585 5:92584674-92584696 CAGGAACACTTTTACACTGTTGG + Intergenic
993978658 5:94514747-94514769 CAAGATCACTATTAGAAAGTAGG - Intronic
994321115 5:98396055-98396077 CAGGAACACTTTTACACTGTTGG + Intergenic
994574347 5:101557082-101557104 CAGGAACACTTTTACACTGTTGG + Intergenic
994616547 5:102111448-102111470 CAGGAACACTTTTACACTGTTGG - Intergenic
994859552 5:105170926-105170948 CAGGAACACTTTTACACTGTTGG + Intergenic
994861667 5:105203329-105203351 CAGGAACACTTTTACACTGTTGG + Intergenic
995154289 5:108892279-108892301 CAGGAACACTTTTACACTGTTGG - Intronic
995282592 5:110352858-110352880 TAGGATCACTTTTACACTGTTGG - Intronic
995529671 5:113080180-113080202 CAGGAACACTTTTACACTGTTGG + Intronic
995631763 5:114141744-114141766 CAGGAACACTTTTACACTGCTGG - Intergenic
995744102 5:115385664-115385686 CAGGATTATTTTTACCAATAGGG + Intergenic
995749296 5:115437583-115437605 CAGGAACACTTTTACACTGTTGG + Intergenic
995806308 5:116056261-116056283 CAGGAACACTTTTACACTGTTGG - Intronic
995864784 5:116679339-116679361 TAAGAACACTTTTACACAGATGG - Intergenic
996003217 5:118388486-118388508 CAGGAACACTTTTACACTGTTGG + Intergenic
996057009 5:118992542-118992564 CAGGAACACTTTTACACTGTTGG - Intergenic
996120603 5:119667470-119667492 CAGGAACACTTTTACACTGTTGG - Intergenic
996128694 5:119754850-119754872 CAGGAACACTTTTACACTGCTGG + Intergenic
996138937 5:119880558-119880580 CAGGATTTGTTTTACAAAGAAGG - Intergenic
996311120 5:122107151-122107173 CAGGATCATTTTCCCAGAGACGG + Intergenic
996484662 5:124017819-124017841 TAGGATCACTTTTACACTGTTGG - Intergenic
996868623 5:128159765-128159787 TAGGATCACTTTTACACTGTTGG + Intronic
996964991 5:129297482-129297504 CAGGAACACTTTTACACTGTTGG - Intergenic
997095230 5:130903037-130903059 CAGGAACACTTTTACACTGTTGG + Intergenic
997095499 5:130905910-130905932 CAGGAACACTTTTACACTGTTGG - Intergenic
997807103 5:136928871-136928893 TAGGAACACTTTTACAATGTTGG - Intergenic
998603574 5:143610272-143610294 CAGGAACACTTTTACACTGCTGG + Intergenic
998715502 5:144879543-144879565 CAGGAACACTTTTACACGGTTGG + Intergenic
998763101 5:145454078-145454100 TAGGAACACTTTTACACAGTTGG - Intergenic
999019127 5:148143659-148143681 TAGGAACACTTTTACAATGTTGG - Intergenic
999081982 5:148853188-148853210 TAGGATCACTTTTGCTTAGAGGG - Intergenic
999523992 5:152382522-152382544 CGGGAACACTTTTACAATGTCGG - Intergenic
999542772 5:152591881-152591903 CAGGAACACTTTTACACTGTTGG + Intergenic
999544870 5:152616617-152616639 TAGGAACACTTTTACACAGTTGG + Intergenic
999797093 5:154998853-154998875 CAGGAACGCTTTTACACAGTTGG - Intergenic
1000471847 5:161652693-161652715 CATAATCACTTTTATAAAAATGG + Intronic
1000553128 5:162691379-162691401 CAGGAACACTTTTACACTGTTGG - Intergenic
1000611582 5:163380869-163380891 CAGGAACACTTTTACACTGTTGG + Intergenic
1000687608 5:164272257-164272279 CATAATCACTTTTTCAAAGGTGG + Intergenic
1000699266 5:164427926-164427948 CAGGAACACTTTTACACTGTTGG - Intergenic
1000704244 5:164490929-164490951 CAGGAACACTTTTACACTGTTGG - Intergenic
1000773230 5:165383640-165383662 CAGGAACACTTTTACACTGCTGG - Intergenic
1000775799 5:165418063-165418085 CAGGAACACTTTTACACTGTTGG + Intergenic
1001167196 5:169380412-169380434 CAGGAACACTTTTACACTGTTGG + Intergenic
1001842076 5:174886322-174886344 TAGGATCACTTTTACACTGTTGG + Intergenic
1001938261 5:175722401-175722423 CAGGAACACTTTTACACCGTTGG + Intergenic
1002010599 5:176277061-176277083 CAGGAACACTTTTACACTGTTGG - Intronic
1002413774 5:179106451-179106473 CAGGAACACTTTTACACTGTTGG + Intergenic
1004578544 6:16924420-16924442 CAGGAACACTTTTACACTGTTGG - Intergenic
1004832034 6:19487257-19487279 CAGGAACACTTTTACACTGTTGG + Intergenic
1004840280 6:19576280-19576302 CAGGAACACTTTTACACTGTTGG + Intergenic
1004937792 6:20525087-20525109 CAGGAACACTTTTACACTGTTGG + Intergenic
1005101377 6:22175468-22175490 CAGGAACACTTTTACACTGTTGG - Intergenic
1005127137 6:22460356-22460378 CAGGAACACTTTTACACTGTTGG - Intergenic
1005234528 6:23744525-23744547 CAGGAACACTTTTACACTGTTGG + Intergenic
1005500440 6:26424558-26424580 CAGTGTCAGTTTTACAGAGAGGG - Intergenic
1005545324 6:26861908-26861930 CAGGAACACTTTTACACTGTTGG - Intergenic
1005790977 6:29300391-29300413 CAGGAACACTTTTACACTGTTGG + Intergenic
1005791703 6:29309496-29309518 CAGGAACACTTTTACACTGTTGG - Intergenic
1005846610 6:29785205-29785227 CAGGAACACTTTTACACTGTTGG + Intergenic
1006207357 6:32359259-32359281 CAGGAACACTTTTACACTGTTGG - Intronic
1006487755 6:34357950-34357972 CAGAATAATTTTTACATAGATGG - Intronic
1007860720 6:44905547-44905569 CAGGAACACTTTTACACTGTTGG + Intronic
1007983370 6:46182305-46182327 CAGGATAAATTTTTCAAAAATGG - Intergenic
1008350869 6:50488717-50488739 CAGGAACACTTTTACATTGTTGG + Intergenic
1008757906 6:54819652-54819674 CAGGAACACTTTTACACTGTTGG - Intergenic
1008769997 6:54966818-54966840 CAGGAACACTTTTACACTGTTGG + Intergenic
1008780232 6:55094549-55094571 CAGGAACACTTTTACACTGTTGG + Intergenic
1008968592 6:57340233-57340255 TAGGAACACTTTTACACAGTTGG + Intronic
1009210977 6:60862984-60863006 CAGGAACACTTTTACACTGTTGG + Intergenic
1009829263 6:68910019-68910041 CAGGAACACTTTTACACTGTTGG - Intronic
1010131005 6:72493599-72493621 CAGGAACACTTTTACACCGTTGG + Intergenic
1010170645 6:72971373-72971395 CAGGAACACTTTTACACTGTTGG + Intronic
1010311052 6:74386347-74386369 CAGGAACACTTTTACACTGTTGG + Intergenic
1010410807 6:75559428-75559450 GAGAATCACTTTAACAAAGGAGG + Intergenic
1010558416 6:77315290-77315312 CAGGAACACTTTTACACTGTTGG - Intergenic
1010604652 6:77873216-77873238 CAGGAACACTTTTACACTGTTGG - Intronic
1010809870 6:80289316-80289338 CAGTCTCACTATTTCAAAGAAGG - Intronic
1011120943 6:83951897-83951919 CAGGAACACTTTTACACTGTTGG - Intronic
1011271519 6:85584776-85584798 CAGGAACACTTTTACACTGTTGG + Intronic
1011296988 6:85836944-85836966 CAGGAACACTTATACAATGCTGG + Intergenic
1011313462 6:86005317-86005339 CAGGAACACTTTTACACTGTTGG - Intergenic
1011332344 6:86224298-86224320 CAGGAACACTTTTACACTGTTGG - Intergenic
1011337654 6:86278763-86278785 TAGGATCACTTTTACACTGTTGG - Intergenic
1011434701 6:87323887-87323909 CAGGAACACTTTTACACTGTTGG - Intronic
1011709068 6:90032734-90032756 CAGGAACACTTTTACACTGTTGG + Intronic
1011971175 6:93224764-93224786 CAGGAACACTTTTACACTGTTGG + Intergenic
1012020175 6:93908190-93908212 TAGGATCACTTTTACACAGTCGG - Intergenic
1012487966 6:99743219-99743241 CAGGATCATTTTAACAATAAAGG + Intergenic
1012514932 6:100048396-100048418 CAGGAACACTTTTACACTGTTGG - Intergenic
1012516708 6:100070215-100070237 CAGGAACACTTTTACACTGTTGG - Intergenic
1012636399 6:101547933-101547955 CAGGAACACTTTTACACTGTTGG - Intronic
1012692645 6:102334442-102334464 CAGGAACACTTTTACACTGTTGG + Intergenic
1012726942 6:102825375-102825397 CAGGAACACTTTTACACTGTTGG - Intergenic
1012829849 6:104190219-104190241 CAGGAACACTTTTACACTGTTGG + Intergenic
1012877285 6:104742689-104742711 CAGGAACACTTTTACACTGTTGG + Intronic
1012998578 6:105997689-105997711 CAAAATCCCTTTTACAAATATGG - Intergenic
1013038496 6:106410401-106410423 TAGGAACACTTTTACACAGTTGG + Intergenic
1013189991 6:107794167-107794189 CAGAGTGACTGTTACAAAGAAGG + Intronic
1013200179 6:107887125-107887147 CAGGAACACTTTTACACTGTTGG + Intronic
1013850007 6:114502931-114502953 CAGGAACACTTTTACACTGTTGG + Intergenic
1014065706 6:117122802-117122824 TAGGAACACTTTTACACAGTTGG - Intergenic
1014071556 6:117187191-117187213 TAGGAACACTTTTACACAGTTGG + Intergenic
1014332391 6:120085976-120085998 CAGGAACACTTTTACACTGTTGG - Intergenic
1014431322 6:121374083-121374105 TAGGAACACTTTTACACAGTTGG + Intergenic
1014674109 6:124343444-124343466 TAGGAACACTTTTACACAGTTGG - Intronic
1014731246 6:125033808-125033830 TAGGAACACTTTTACACAGTTGG - Intronic
1015230581 6:130910902-130910924 CAGGAACACTTTTACACTGTTGG + Intronic
1015263047 6:131260418-131260440 CAGGAACACTTTTACACTGTTGG - Intronic
1015540276 6:134306611-134306633 CAGGATCACTTGAACCCAGAAGG - Intronic
1015702717 6:136053672-136053694 TAGGAACACTTTTACAATGTTGG - Intronic
1015738856 6:136431716-136431738 CAAGATCAGCTTTACCAAGATGG - Intronic
1016073535 6:139769924-139769946 CAGGAACACTTTTACACTGTTGG + Intergenic
1016315594 6:142782499-142782521 CAGGATGATTTTTAAAAAGGTGG + Intronic
1016766078 6:147795679-147795701 CAGGAACACTTTTACACTGTTGG - Intergenic
1017207933 6:151824085-151824107 CAGGAACACTTTTACACTGTTGG - Intronic
1017462612 6:154665732-154665754 CAGGATTTTTTTTAAAAAGAGGG + Intergenic
1017496916 6:154991564-154991586 CAGATTCATTTTTACAGAGAAGG - Intronic
1017536821 6:155356039-155356061 CAGGAACACTTTTACACTGCTGG + Intergenic
1018676338 6:166225555-166225577 TAGGAACACTTTTACACAGTTGG + Intergenic
1019056804 6:169229627-169229649 CAGGAAGACTTTGACAAGGACGG - Exonic
1019081470 6:169433704-169433726 CAGGAACACTTTTACACAGTTGG - Intergenic
1019205142 6:170355096-170355118 CAGGAACACTTTTACACTGTTGG + Intronic
1019958439 7:4436028-4436050 CATGATTAATTTTATAAAGATGG + Intergenic
1020253917 7:6491083-6491105 CAGGATGGCTTCTGCAAAGAAGG - Intergenic
1020443575 7:8244936-8244958 CAGGAACACTTTTACACTGTTGG + Intronic
1020698266 7:11444177-11444199 GAGGAACACTTTTACAATGTTGG + Intronic
1020751202 7:12144457-12144479 CAGGAACACTTTTACACTGTTGG + Intergenic
1020852872 7:13378861-13378883 TAGGATCACTTTTACACTGTTGG + Intergenic
1021036186 7:15801924-15801946 CAGGATCCGTTTTACAAAAGTGG - Intergenic
1021375069 7:19896476-19896498 CAGGAACACTTTTACACTGTTGG - Intergenic
1021461794 7:20896158-20896180 TACGATCACTTTTTAAAAGATGG + Intergenic
1021752981 7:23823210-23823232 CAGGAACACTTTTACACTGTTGG - Intronic
1021831853 7:24620232-24620254 CAGAATCACTTGTACTAAGTTGG + Intronic
1022242579 7:28527334-28527356 CAGGAGTACTGTTCCAAAGAAGG - Intronic
1022823881 7:33989229-33989251 CAGGAACACTTTTACACTGTTGG - Intronic
1022958419 7:35402208-35402230 CAGGAAGACGTTTACAAAGCTGG + Intergenic
1023143434 7:37125674-37125696 CAGGAACACTTTTACACCGTTGG + Intronic
1023615358 7:42014160-42014182 CAGCATCAGCTTTAGAAAGATGG - Intronic
1024416881 7:49118094-49118116 CAGGAACACTTTTACACTGTTGG + Intergenic
1024671001 7:51594623-51594645 CAGGAACACTTTTACACTGTTGG - Intergenic
1024753285 7:52495524-52495546 TAGGAACACTTTTACAATGTTGG - Intergenic
1025312246 7:57962912-57962934 TAGGAACACTTTTACAATGTTGG - Intergenic
1025521182 7:61731745-61731767 CAGGAACACTTTTACACTGTTGG + Intergenic
1025599027 7:62971537-62971559 CAGGAACACTTTTACACTGTTGG + Intergenic
1025618401 7:63144532-63144554 CAGGAACACTTTTACACTGTTGG - Intergenic
1025629913 7:63261910-63261932 CAGGAACACTTTTACACTGTTGG - Intergenic
1025651273 7:63471871-63471893 CAGGAACACTTTTACACTGTTGG + Intergenic
1025714968 7:63947119-63947141 TAGGAACACTTTTACACTGATGG + Intergenic
1025843586 7:65175029-65175051 CAGGAACACTTTTACACTGTTGG - Intergenic
1025862215 7:65341089-65341111 CAGGAACACTTTTACACTGTTGG + Intergenic
1025893980 7:65681651-65681673 CAGGAACACTTTTACACTGTTGG - Intergenic
1027147582 7:75707246-75707268 CAGGAACACTTTTACACTGTTGG - Intronic
1027289901 7:76695551-76695573 CAGGAACACTTTTACACTGTTGG + Intergenic
1027493164 7:78855868-78855890 CAGGAACACTTTTACACTGTTGG - Intronic
1027496453 7:78893257-78893279 CAGGAACACTTTTACACTGTTGG + Intronic
1027539117 7:79445693-79445715 CAGGAACACTTTTACACTGTTGG + Intronic
1027667650 7:81058501-81058523 CAGGAACACTTTTACACTGTTGG + Intergenic
1027811201 7:82901953-82901975 CAGGAACACTTTTACACTGTTGG + Intronic
1027961930 7:84956981-84957003 CAGGAACACTTTTACACTGTTGG + Intergenic
1028076746 7:86525868-86525890 TAGGATCACTTTTACACTGTTGG + Intergenic
1028275787 7:88855217-88855239 TAGGAACACTTTTACAATGTTGG - Intronic
1028295699 7:89128835-89128857 CAGGGTCTCTTTTACAGAGCTGG - Intronic
1028511390 7:91628890-91628912 CATGTTCACTTTTCCCAAGAGGG + Intergenic
1028521405 7:91735282-91735304 CAGGAACACTTTTACACTGTTGG + Intronic
1028537325 7:91904292-91904314 CAGGAACACTTTTACACTGTTGG - Intergenic
1028581061 7:92409996-92410018 CAGGAACACTTTTACACTGTTGG + Intergenic
1028955705 7:96687163-96687185 CAGGAACACTTTTACACTGTTGG + Intronic
1029062779 7:97815861-97815883 TAGGAACACTTTTACACAGTTGG + Intergenic
1029310059 7:99654695-99654717 CAGGAACACTTTTACACTGTTGG - Intronic
1030017664 7:105240970-105240992 CAGTATCATTTTTACAAAATTGG + Intronic
1030023667 7:105300894-105300916 CAGGAACACTTTTACACTGTTGG + Intronic
1030178960 7:106684995-106685017 CAGGAACACTTTTACACTGTTGG - Intergenic
1030540608 7:110826214-110826236 CAGGAACACTTTTACACTGTTGG + Intronic
1030739448 7:113090892-113090914 CAGGAACACTTTTACACTGTTGG + Intergenic
1030919351 7:115361724-115361746 CAGGAACACTTTTACACTGTTGG - Intergenic
1031178690 7:118387172-118387194 TAGGATCAATTTTATAAAAATGG - Intergenic
1031189255 7:118525707-118525729 CAGGAACACTTTTACACTGTTGG - Intergenic
1031441418 7:121799346-121799368 CAGTTTCACTATTATAAAGAGGG - Intergenic
1031767343 7:125797997-125798019 CATAAACACATTTACAAAGAAGG - Intergenic
1031831492 7:126632409-126632431 CAGGAACACTTTTACACTGTTGG + Intronic
1032728741 7:134616575-134616597 CAGGAGCAGTTTTACAGAGGTGG + Intergenic
1032915959 7:136490291-136490313 CAGCATTACTTTTTCAAACAAGG + Intergenic
1033041806 7:137926108-137926130 CAGGAACACTTTTACACTGTTGG + Intronic
1033543357 7:142377105-142377127 CAGAATACCTTATACAAAGAAGG - Intergenic
1033863878 7:145664065-145664087 TAGGATCACTTTTACACTGTTGG + Intergenic
1033875970 7:145818683-145818705 CAGGAACAATTTTACAATGTTGG - Intergenic
1033952646 7:146804182-146804204 CAGTATCTCTTTTACAGAGGAGG - Intronic
1035532780 8:367180-367202 CAGGAACACTTTTACACTGTTGG - Intergenic
1035894306 8:3380266-3380288 CAGGAACACTTTTACACTGTTGG + Intronic
1036097406 8:5739205-5739227 CAGGAACACTTTTACACTGCTGG - Intergenic
1036119911 8:6004585-6004607 CAGAATGAATTCTACAAAGAAGG + Intergenic
1036715675 8:11121562-11121584 CAGGAACACTTTTACACTGTTGG + Intronic
1037093231 8:14948620-14948642 CAGGAGCACTTTTATTAAAAAGG - Intronic
1037133534 8:15435149-15435171 TAGGAACACTTTTACAATGTTGG - Intronic
1037146278 8:15576925-15576947 CAGGAACACTTTTACACTGTTGG - Intronic
1037214404 8:16431017-16431039 CAGGAACACTTTTACACTGTTGG + Intronic
1037465545 8:19156336-19156358 CAGGAGCACTTTTACAGTGTTGG - Intergenic
1038031500 8:23645804-23645826 CAGGAACACTTTTACACTGTTGG - Intergenic
1038099750 8:24360155-24360177 CAGGAACACTTTTACACTGTTGG + Intergenic
1038107163 8:24449266-24449288 CAGGAACACTTTTACATTGTTGG - Intronic
1038236453 8:25761915-25761937 CAGGAACACTTTTACACTGTTGG + Intergenic
1038253047 8:25924355-25924377 GAGGATCACTTTTACTGAGTAGG - Intronic
1038266957 8:26045296-26045318 CAGGATCAGTTGTAAAAAGAAGG + Exonic
1038786680 8:30623629-30623651 CAGGAACACTTTTACACTGTTGG - Intronic
1038946895 8:32371409-32371431 AAGGATCAGTTTTTAAAAGATGG + Intronic
1039004584 8:33019800-33019822 CAGGAACACTTTTACACTGTTGG - Intergenic
1039019632 8:33190693-33190715 CAGGAACACTTTTACACTGTTGG + Intergenic
1039291417 8:36098001-36098023 CAGGAACACTTTTACACTGTTGG - Intergenic
1039859313 8:41443099-41443121 TAGGAACACTTTTACACTGATGG - Intergenic
1039863737 8:41482616-41482638 CAGGAACACTTTTACACTGTTGG + Intergenic
1040085747 8:43339012-43339034 CAGGAACACTTTTACACTGTTGG + Intergenic
1040347165 8:46515929-46515951 TAGGAACACTTTTACACAGTTGG - Intergenic
1040394557 8:46984422-46984444 TAGGAACACTTTTACACAGTTGG - Intergenic
1040426919 8:47298071-47298093 CAGGAACACTTTTACACTGTTGG - Intronic
1040428367 8:47312333-47312355 CAGGAACACTTTTACACTGTTGG - Intronic
1040445617 8:47490375-47490397 CAGGAACACTTTTACAGTGTTGG + Intronic
1040608059 8:48954516-48954538 CAGGAACACTTTTACACTGTTGG - Intergenic
1040679408 8:49790618-49790640 CAGGAACACTTTTACACTGTTGG + Intergenic
1040814952 8:51497808-51497830 CAGGAACACTTTTACACTGTGGG + Intronic
1040820568 8:51552208-51552230 AAGGAACACTTTTACAATGCTGG + Intronic
1040951712 8:52943818-52943840 TTGGATCACTTTTCCAATGAAGG - Intergenic
1041025620 8:53683007-53683029 CAGGAACACTTTTACACTGTTGG + Intergenic
1041112941 8:54504442-54504464 CAGGAACACGTTTACACAGTTGG + Intergenic
1041128457 8:54669404-54669426 TAGGAACACTTTTACAATGTTGG + Intergenic
1041410907 8:57553525-57553547 TAGGAACACTTTTACACAGTTGG + Intergenic
1041424035 8:57700622-57700644 CAGGAACACTTTTACACTGTTGG + Intergenic
1041665369 8:60439240-60439262 TAGGAACACTTTTACACAGTTGG - Intergenic
1042016337 8:64317332-64317354 CAGGAACACTTTTACACTGTTGG - Intergenic
1042027264 8:64437510-64437532 CAGGAACACTTTTACACTGTTGG + Intergenic
1042259753 8:66846145-66846167 CAGAAACATTTTTCCAAAGAGGG - Intronic
1042270385 8:66949719-66949741 CAGGAACACTTTTACACTGTTGG - Intronic
1042753991 8:72189691-72189713 CAGGAACACTTTTACACTGTTGG + Intergenic
1042821038 8:72930413-72930435 CAGGAACACTTTTACACTGTTGG - Intronic
1042888070 8:73574283-73574305 CAGGAACACTTTTACACTGTAGG + Intronic
1042969905 8:74396969-74396991 CAGGAACACTTTTACACTGTTGG - Intronic
1042976077 8:74470867-74470889 CAGGAACACTTTTACACTGTTGG - Intronic
1042980109 8:74517539-74517561 CAGGAACACTTTTACACTGTTGG - Intergenic
1042980532 8:74521856-74521878 CAGGAACACTTTTACACTGTTGG + Intergenic
1042994485 8:74680590-74680612 CAGGAACACTTTTACACTGTTGG + Intronic
1043194531 8:77275318-77275340 CAGGAACACTTTTACACTGTTGG - Intergenic
1043274990 8:78381696-78381718 CAGGAACACTTTTACACTGTTGG - Intergenic
1043335237 8:79167857-79167879 CAGGAACACTTTTACACTGTTGG - Intergenic
1043481225 8:80654718-80654740 CAGGAACACTTTTACACTGTTGG + Intronic
1043482394 8:80666578-80666600 CAGGAACACTTTTACACTGTTGG - Intronic
1043629807 8:82315635-82315657 AAGGAACACTTTTACACAGTTGG - Intergenic
1044196202 8:89379438-89379460 CAGGAACACTTTTACACTGTTGG + Intergenic
1044366710 8:91356342-91356364 CAGGAACACTTTTACACTGTTGG - Intronic
1044936764 8:97300995-97301017 CAGGAACACTTTTACACTGTTGG + Intergenic
1045122254 8:99050647-99050669 CAGGAACACTTTTACACTGTTGG - Intronic
1045125251 8:99082075-99082097 CAGGAACACTTTTACACTGTTGG - Intronic
1045148296 8:99372691-99372713 TAGGAACACTTTTACACAGTTGG + Intronic
1045688921 8:104740466-104740488 CAGGAACACTTTTACACTGTTGG - Intronic
1046028007 8:108748177-108748199 AAGCAACACTTTTACACAGATGG - Intronic
1046209753 8:111054359-111054381 CAGAATCAATTTAACCAAGAAGG - Intergenic
1046562291 8:115853102-115853124 CAGGAACACTTTTACAATGTTGG - Intergenic
1046894336 8:119456813-119456835 TAGGATCACTTTTACACTGTTGG - Intergenic
1046901282 8:119526536-119526558 TAGGAACACTTTTACACAGTTGG + Intergenic
1047008373 8:120644776-120644798 CAGGAACACTTTTACACTGTTGG - Intronic
1047296148 8:123572111-123572133 CTAGATGACTTTTACAAAGGGGG + Intergenic
1047842173 8:128765360-128765382 TAGGAACACTTTTACACAGTTGG + Intergenic
1047948475 8:129906977-129906999 CAGGAACACTTTTACACTGTTGG + Intronic
1048227360 8:132601300-132601322 CAGGAACACTTTTACACTGTTGG + Intronic
1048519934 8:135144155-135144177 CAGGGTCACTTTTCCTAATAAGG - Intergenic
1048562050 8:135550193-135550215 CAGATTCTCTTTTCCAAAGATGG + Intronic
1048661808 8:136612235-136612257 CAGGAACACTTTCACATAGTTGG - Intergenic
1048699398 8:137071205-137071227 TAGGAACACTTTTACACAGTTGG + Intergenic
1048785802 8:138048945-138048967 TAGGAACACTTTTACACAGTTGG + Intergenic
1048805698 8:138239173-138239195 CAGGAACACTTTTACACTGTTGG - Intronic
1049485342 8:142855451-142855473 TAGGAACACTTTTACACAGTTGG + Intronic
1049952826 9:661738-661760 CAGGAACACTTTTACACAGTTGG - Intronic
1050007636 9:1149722-1149744 CAGGAACACTTTTACACTGTTGG + Intergenic
1050173719 9:2849046-2849068 CAGGAACACTTTTACACTGCTGG + Intergenic
1050178746 9:2897684-2897706 CAGGAACACTTTTACACTGTTGG + Intergenic
1050330035 9:4536570-4536592 CAGGAACACTTTTACACTGTTGG + Intronic
1050392085 9:5154852-5154874 CAGGAACACTTTTACACTGTTGG + Intronic
1050534221 9:6617767-6617789 CAGGATTACATTTGCAATGATGG + Intronic
1050750401 9:8930575-8930597 CAGGAACACTTTTACACTGTTGG - Intronic
1050956313 9:11665876-11665898 CAGGAACACTTTTACACTGTTGG - Intergenic
1051199595 9:14601523-14601545 CAGGAACACTTTTACACTGCTGG + Intergenic
1051205589 9:14685581-14685603 CAGGAACACTTTTACACTGCTGG + Intronic
1051392826 9:16584593-16584615 CAGGATCTCTCTTCCAAACATGG + Intronic
1051725096 9:20081005-20081027 TAGGAACACTTTTACAATGTTGG + Intergenic
1051790467 9:20796428-20796450 CAGGAACACTTTTACACTGTTGG - Intronic
1051819085 9:21143595-21143617 CAGGAACACTTTTACACTGTTGG - Intergenic
1051870526 9:21732153-21732175 CAGGAACACTTTTACACTGTTGG - Intergenic
1051984559 9:23068210-23068232 TAGGAACACTTTTACAATGTTGG + Intergenic
1052165283 9:25318993-25319015 CAGGAACACTTTTACACTGTTGG + Intergenic
1052219491 9:26002119-26002141 TAGGAACACTTTTACAACGTTGG - Intergenic
1052408437 9:28092073-28092095 CAGGAACACTTTTACACCGTTGG + Intronic
1052451457 9:28636437-28636459 CAGGAACACTTTTACACTGTTGG - Intronic
1052588356 9:30458185-30458207 CAGGAACACTTTTACACTGCTGG + Intergenic
1052845424 9:33331710-33331732 CAGGATAATTTTTACGAAGAGGG + Intronic
1053699602 9:40676331-40676353 CAGGAACACTTTTACACTGTTGG - Intergenic
1054148859 9:61584717-61584739 TAGGTTCAGTTTTGCAAAGATGG - Intergenic
1054184728 9:61942215-61942237 TAGGTTCAGTTTTGCAAAGATGG + Intergenic
1054310891 9:63475732-63475754 CAGGAACACTTTTACACTGTTGG - Intergenic
1054334822 9:63796898-63796920 CAGGAACACTTTTACACTGTTGG + Intergenic
1054409679 9:64799883-64799905 CAGGAACACTTTTACACTGTTGG - Intergenic
1054468622 9:65515826-65515848 TAGGTTCAGTTTTGCAAAGATGG - Intergenic
1054653779 9:67646282-67646304 TAGGTTCAGTTTTGCAAAGATGG - Intergenic
1054816692 9:69482500-69482522 CAGGAACACTTTTACACTGTTGG + Intronic
1054849951 9:69837344-69837366 CAGGAACACTTTTACACTGTTGG - Intronic
1054880480 9:70139734-70139756 CAGGAACACTTTTACACTGTTGG - Intronic
1055005177 9:71497932-71497954 TAGGATCACTTTTACACTGTTGG + Intergenic
1055048680 9:71957824-71957846 CAGCATCACTTCCACAAATAAGG + Intronic
1055374249 9:75632025-75632047 CAGGAACACTTTTACACTGTTGG + Intergenic
1055537379 9:77263047-77263069 CAGGAACACTTTTACACTGCTGG - Intronic
1055616671 9:78080493-78080515 CAGGAACACTTTTACACTGTTGG + Intergenic
1055675332 9:78653453-78653475 CAGGAACACTTTTACACTGTTGG + Intergenic
1055784203 9:79854833-79854855 CAGGAACACTTTTACACTGTTGG + Intergenic
1056727465 9:89133288-89133310 CAGGAACACTTTTACAGTGTTGG + Intronic
1057324191 9:94045457-94045479 CAGGAACACTTTTACACTGTTGG - Intronic
1057515365 9:95715906-95715928 CTGGGTCATTTTCACAAAGAAGG + Intergenic
1057539998 9:95958469-95958491 CAGGAACACTTTTACACTGTTGG - Intronic
1057647801 9:96893405-96893427 CAGGAACACTTTTACACTGTTGG + Intergenic
1058253779 9:102735498-102735520 TAGGATCACTTTTACACTGTTGG - Intergenic
1058284677 9:103162213-103162235 CAGGAACACTTTTACACTGTTGG + Intergenic
1058350496 9:104015750-104015772 CAGGAACACTTTTACACTGTTGG + Intergenic
1058494728 9:105544046-105544068 CAGGAACACTTTTACACTGTTGG - Intronic
1058497574 9:105576781-105576803 CAGGAACACTTTTACACTGTTGG - Intronic
1058749693 9:108027199-108027221 CAGGAACACTTTTACACTGTTGG - Intergenic
1058791216 9:108447701-108447723 CAGGAACACTTTTACACTGTTGG + Intergenic
1059007819 9:110422497-110422519 CAGGAACACTTTTACACTGTTGG + Intronic
1059028112 9:110659078-110659100 CAGGAACACTTTTACACTGTTGG + Intergenic
1059462087 9:114438380-114438402 CAGGCACACTTTTACACAGCTGG + Intronic
1059869564 9:118556962-118556984 CAGGAACACTTTTACATTGTTGG + Intergenic
1203381555 Un_KI270435v1:52659-52681 TAGGAACACTTTTACACAGTGGG + Intergenic
1203398219 Un_KI270519v1:47911-47933 CAGGAACACTTTTACACTGTTGG + Intergenic
1186678057 X:11841360-11841382 CAGGAACACTTTTACACTGTTGG - Intergenic
1186726319 X:12362819-12362841 CAGGAACACTTTTACACTGTTGG - Intronic
1186931521 X:14396215-14396237 CAGGAACACTTTTACACTGTTGG + Intergenic
1187189111 X:17016025-17016047 CAGGAACACTTTTACACTGTTGG - Intronic
1187672249 X:21679457-21679479 CAGGTTTAATTTTCCAAAGATGG - Intergenic
1187778884 X:22794926-22794948 CAGGAACACTTTTACACTGTTGG + Intergenic
1188608908 X:32071278-32071300 CAGGAACACTTTTACACTGTTGG - Intronic
1188610201 X:32086468-32086490 CTGGATCACTTGTGCAATGAGGG - Intronic
1188719961 X:33510243-33510265 CAGGAACACTTTTACACTGTTGG + Intergenic
1188730627 X:33641406-33641428 CAGGAACACTTTTACACTGTTGG + Intergenic
1188741520 X:33789079-33789101 AAGGCTAATTTTTACAAAGAAGG - Intergenic
1188821144 X:34776432-34776454 TAGGAACACTTTTACACTGATGG - Intergenic
1189045112 X:37582396-37582418 CAGGAACACTTTTACACTGTTGG - Intronic
1189742921 X:44140273-44140295 CAGGAACACTTTTACACTGTTGG + Intergenic
1190004157 X:46718824-46718846 CAGGAACACTTTTACACTGTTGG + Intronic
1190516399 X:51227948-51227970 CAGGAACACTTTTACACTGTTGG + Intergenic
1190585281 X:51933601-51933623 CAGGAACACTTTTACACTGTTGG - Intergenic
1190591627 X:52008352-52008374 CAGGAACACTTTTACACTGTTGG - Intergenic
1190603483 X:52116634-52116656 TAGGAACACTTTTACACAGTTGG + Intergenic
1190608042 X:52165430-52165452 CAGGAACACTTTTACACAGTTGG + Intergenic
1190609123 X:52176294-52176316 TAGGAACACTTTTACACAGTTGG + Intergenic
1191023314 X:55886317-55886339 TAGGATCACTTTTACACTGTTGG - Intergenic
1191037947 X:56047879-56047901 CAGGAACACTTTTACACTGTTGG - Intergenic
1191047519 X:56154982-56155004 CAGGAACACTTTTACACTGTTGG + Intergenic
1191118684 X:56879353-56879375 TAGGAACACTTTTACACAGTTGG - Intergenic
1191137259 X:57078823-57078845 CAGGAACACTTTTACACTGTTGG + Intergenic
1191158441 X:57300989-57301011 TAGGAACACTTTTACAATGTTGG + Intronic
1191160366 X:57323447-57323469 TAGGAACACTTTTACAATGTTGG - Intronic
1191194507 X:57706714-57706736 TAGGAACACTTTTACACAGTTGG + Intergenic
1191798739 X:65053721-65053743 CAGGAACACTTTTACACTGTTGG - Intergenic
1191809036 X:65166658-65166680 CAGGAACACTTTTACATTGTTGG - Intergenic
1191992703 X:67056281-67056303 CAGGAACACTTTTACACTGTTGG - Intergenic
1191993072 X:67060620-67060642 CAGGAACACTTTTACACTGTTGG - Intergenic
1192015889 X:67330489-67330511 AAGGAACACTTTTACATTGATGG + Intergenic
1192058648 X:67800163-67800185 CAGGAACACTTTTACACTGTTGG + Intergenic
1192112376 X:68378044-68378066 CAGGAACACTTTTACACTGTTGG - Intronic
1192142324 X:68656382-68656404 TAGGATCACTTTTACACTGTTGG + Intronic
1192155322 X:68741768-68741790 CAGGAACACTTTTACACTGTTGG + Intergenic
1192374658 X:70547796-70547818 CAGGAACACTTTTACACTGTTGG + Intronic
1192384088 X:70647790-70647812 CAGGAACACTTTTACACTGTTGG + Intronic
1192628507 X:72755476-72755498 CAGGAACACTTTTACACTGTTGG - Intergenic
1192653200 X:72965337-72965359 CAGGAACACTTTTACACTGTTGG + Intergenic
1192669263 X:73122305-73122327 TAGGAACACTTTTACACAGTTGG + Intergenic
1192770365 X:74182916-74182938 CAGGAACACTTTTACACTGTTGG + Intergenic
1192850652 X:74952618-74952640 TAGGAACACTTTTACACAGTTGG - Intergenic
1192874863 X:75218415-75218437 CAGGAACACTTTTACACTGTTGG + Intergenic
1192876722 X:75237326-75237348 CAGGAACACTTTTACACTGTTGG + Intergenic
1192883592 X:75314135-75314157 CAGGAACACTTTTACACTGTTGG - Intergenic
1192953822 X:76047409-76047431 CAGGAACACTTTTACACTGTTGG - Intergenic
1192959557 X:76112983-76113005 CAGGAACACTTTTACACTGTTGG - Intergenic
1192992939 X:76481618-76481640 CAGGAACACTTTTACACTGTTGG - Intergenic
1193047929 X:77071843-77071865 TAGGATCACTTTTACACTGTTGG - Intergenic
1193051108 X:77100693-77100715 CAGGAACACTTTTACACTGTTGG - Intergenic
1193054200 X:77132597-77132619 CAGGAACACTTTTACACTGTTGG - Intergenic
1193072828 X:77324398-77324420 CAGGAACACTTTTACACTGTTGG + Intergenic
1193203439 X:78719701-78719723 CAGGAACACTTTTACACTGTTGG + Intergenic
1193226849 X:78993667-78993689 CAGGAACACTTTTACACTGTTGG - Intergenic
1193261243 X:79408933-79408955 AAGGATCACTTTTACACTGTTGG + Intergenic
1193282667 X:79672419-79672441 CAGGAACACTTTTACACTGTTGG + Intergenic
1193296701 X:79842040-79842062 TAGGAACACTTTTACACTGATGG + Intergenic
1193362868 X:80596594-80596616 CAGGAACACTTTTACACTGTTGG - Intergenic
1193615517 X:83683541-83683563 TAGGAACACTTTTACACAGTTGG - Intergenic
1193786628 X:85767505-85767527 TAGGAACACTTTTACACAGTTGG - Intergenic
1193948331 X:87765272-87765294 TAGGAACACTTTTACACTGATGG - Intergenic
1193991840 X:88317721-88317743 CAGGAACACTTTTACACTGTTGG - Intergenic
1194782640 X:98043998-98044020 CAGGAACACTTTTACAGTGTTGG - Intergenic
1194892869 X:99402356-99402378 CAGGAACACTTTTACACTGTTGG - Intergenic
1194907374 X:99594603-99594625 CAGGAACACTTTTACACTGTTGG - Intergenic
1195213633 X:102674761-102674783 CAGGAACACTTTTACACTGTTGG - Intergenic
1195342974 X:103922820-103922842 CAGGAACACTTTTACACTGTTGG - Intronic
1195469541 X:105217477-105217499 CAGGAACACTTTTACACTGTTGG + Intronic
1195481529 X:105351150-105351172 CAGGAACACTTTTACACTGTTGG + Intronic
1195601781 X:106757111-106757133 CAGGAACACTTTTACACTGTTGG + Intronic
1195809386 X:108813265-108813287 CAGGACCACTTTTACACTGTTGG - Intergenic
1196005398 X:110831856-110831878 TAGGAACACTTTTACACAGTTGG - Intergenic
1196037407 X:111161079-111161101 TAGGAACACTTTTACACAGTTGG - Intronic
1196180528 X:112684879-112684901 CAGGAACACTTTTACACTGTTGG - Intergenic
1196775790 X:119335707-119335729 CACACACACTTTTACAAAGATGG + Intergenic
1196930689 X:120679001-120679023 TAGGATGACTATTACAAAAAAGG - Intergenic
1197032008 X:121827938-121827960 CAGGAACACTTTTACACTGTTGG + Intergenic
1197408667 X:126088360-126088382 CAGAAACACTTTTACACAGCTGG + Intergenic
1197438793 X:126464652-126464674 CAGGAACACTTTTACACTGTTGG + Intergenic
1197834515 X:130680214-130680236 CAGGATTAATTTGACAATGATGG + Intronic
1197909627 X:131466674-131466696 CAGGAACACTTTTACACTGTTGG + Intergenic
1197911511 X:131487906-131487928 CAGGAACACTTTTACACTGTTGG + Intergenic
1197912331 X:131496781-131496803 CAGGAACACTTTTACACTGTTGG - Intergenic
1197915488 X:131529996-131530018 CAGGAACACTTTTACACTGTTGG + Intergenic
1197918067 X:131557557-131557579 CAGGAACACTTTTACACTGTTGG + Intergenic
1197920183 X:131584095-131584117 CAGGAACACTTTTACACTGTTGG + Intergenic
1197957343 X:131965976-131965998 CAGGAACACTTTTACACTGTTGG + Intergenic
1197973337 X:132138124-132138146 CAGGAACACTTTTACACTGTTGG + Intergenic
1197974928 X:132156758-132156780 CAGGAACACTTTTACACTGTTGG - Intergenic
1198886953 X:141349733-141349755 CAGGAACACTTTTACACTGTTGG + Intergenic
1199376452 X:147116034-147116056 CACGATCATCTTTGCAAAGATGG - Intergenic
1199734274 X:150669482-150669504 CAGGAACACTTTTACACTGTTGG - Intronic
1199928041 X:152490253-152490275 CAGGAACACTTTTACACTGTCGG + Intergenic
1200298229 X:154944547-154944569 TAGGAACACTTTTACAATGTTGG + Intronic
1200387081 X:155903733-155903755 TAGGAACACTTTTACACAGTTGG + Intronic
1200389652 X:155931324-155931346 CAGGAACACTTTTACACTGTTGG - Intronic
1200574570 Y:4871889-4871911 CAGGAACACTTTTACACTGTTGG + Intergenic
1200735945 Y:6795518-6795540 TAGGAACACTTTTACACAGTTGG - Intergenic
1201252242 Y:12071008-12071030 CAGGAACACTTTTACACTGTTGG - Intergenic
1201353949 Y:13077272-13077294 CAGGAACACTTTTACAGTGTTGG + Intergenic
1201397020 Y:13559887-13559909 CAGGAACACTTTTACACTGTTGG - Intergenic
1201459978 Y:14211753-14211775 CAGGAACACTTTTACACTGTTGG + Intergenic
1201483181 Y:14462893-14462915 TAGGAACACTTTTACACAGTTGG + Intergenic
1201529058 Y:14971760-14971782 CAGGAACACTTTTACACTGTTGG - Intergenic
1201596543 Y:15676619-15676641 CAGGAACACTTTTACATGGTTGG + Intergenic
1201709132 Y:16970271-16970293 CAGGAACACTTTTACACTGTTGG - Intergenic
1202249979 Y:22860328-22860350 CAGGAACACTTTTACACTGTTGG + Intergenic
1202278448 Y:23150068-23150090 CAGGAACACTTTTACACTGTTGG + Intronic
1202286755 Y:23258699-23258721 CAGGAACACTTTTACACTGTTGG - Intronic
1202402968 Y:24494076-24494098 CAGGAACACTTTTACACTGTTGG + Intergenic
1202431272 Y:24781406-24781428 CAGGAACACTTTTACACTGTTGG + Intronic
1202438696 Y:24876756-24876778 CAGGAACACTTTTACACTGTTGG - Intronic
1202467814 Y:25176007-25176029 CAGGAACACTTTTACACTGTTGG - Intergenic