ID: 978833150

View in Genome Browser
Species Human (GRCh38)
Location 4:113113758-113113780
Sequence TTGTCTGTGCAGAGGTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978833146_978833150 -1 Left 978833146 4:113113736-113113758 CCTGGAATTGGAACCTGGTGCCT 0: 1
1: 0
2: 3
3: 20
4: 185
Right 978833150 4:113113758-113113780 TTGTCTGTGCAGAGGTCAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978833150 Original CRISPR TTGTCTGTGCAGAGGTCAGC TGG Intronic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
901034827 1:6330201-6330223 CTGTCTGTAGAAAGGTCAGCGGG + Intronic
901935005 1:12620796-12620818 GTGTGTGTGCACAGTTCAGCAGG + Intergenic
902042416 1:13502464-13502486 TTGTGTGTGCAGGAGTCAGAGGG - Intronic
902376170 1:16030880-16030902 GTGTCTGTCTAGGGGTCAGCTGG + Intronic
902381095 1:16052606-16052628 GTGTCTGTCTAGGGGTCAGCTGG + Intronic
903054344 1:20625129-20625151 TTGTTTGTGCAGTGGGCAGGAGG - Intergenic
903709749 1:25314653-25314675 TTGTCTATACAGAAGTTAGCTGG - Intronic
904824431 1:33265367-33265389 CTGTCTGTGCCCAGGTCAGTGGG - Intronic
905551184 1:38841018-38841040 TTGTCTCTGCAGATTTCAGTAGG - Intronic
908227028 1:62066647-62066669 TTGTCTGTGCAGTTGGCAGGAGG - Intronic
908474068 1:64471076-64471098 GGGTCTGTGCAGAGGACAGAGGG - Intronic
908616351 1:65927618-65927640 TTGGCTGTGCAGAAGACAGATGG - Intronic
908796590 1:67835937-67835959 TTGCCTGGGCACAGGGCAGCTGG + Intergenic
909026541 1:70487889-70487911 TTGACTGTGCAGAGGCATGCTGG + Intergenic
910910722 1:92230913-92230935 CTGTGTGTGCAGATGTCACCTGG + Intronic
914435971 1:147659572-147659594 TTCTCTGGGCTGAGTTCAGCAGG - Intronic
916078729 1:161218691-161218713 TTGTCTCTGCAGAAATCAGATGG + Exonic
917334624 1:173914833-173914855 TTGGCTGTGCAGATGTCCACAGG + Exonic
917627925 1:176864359-176864381 TTGACTGGGCGGAGCTCAGCCGG - Exonic
917942513 1:179936405-179936427 TTGTCTATGCAAAGATCTGCTGG + Intergenic
919540816 1:198843195-198843217 TTTTCTGTGCAGTGGGCAGGAGG - Intergenic
920723778 1:208414584-208414606 TTCTCTGTTGAGAGTTCAGCAGG + Intergenic
920764009 1:208813585-208813607 CTCTCTGTGCAGTGGGCAGCAGG - Intergenic
922334366 1:224606755-224606777 TTGTTTGTGCAGGGGGCAGGAGG + Intronic
922555947 1:226532015-226532037 GTGTGTGTGCAGGGGTCAGTGGG + Intergenic
922812740 1:228426875-228426897 ATGTATGTGCAGAGGTCACAGGG - Intergenic
923199431 1:231697064-231697086 TTGTCTGTGATGAGGTGGGCTGG + Intronic
923887753 1:238177697-238177719 ATGTCTGTGCAGAGTTCATATGG - Intergenic
924090755 1:240498546-240498568 TTGGCTGTGCAGAGTTCACCAGG + Intronic
924880862 1:248160836-248160858 TGGCCTGTGCAGAAGTCAGATGG - Intergenic
1064784246 10:18876464-18876486 TTGCCTGTGCAGAAGACAGATGG + Intergenic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1067908693 10:50321756-50321778 TTGTCAGTGTAGAGGGCACCTGG + Intronic
1068735342 10:60408011-60408033 TTGCCTGAGCAGATGGCAGCAGG - Intronic
1068789514 10:61011830-61011852 TTATTTGCCCAGAGGTCAGCTGG + Intergenic
1069145616 10:64889275-64889297 TAGTCTGTGCAGAAGACAGATGG + Intergenic
1070814828 10:79316600-79316622 TTGTGTGTGCAGAGGGTAACAGG - Intergenic
1071475135 10:86019292-86019314 ATGCCTGTGCAGAGCACAGCTGG - Intronic
1071937585 10:90548441-90548463 TGGCCTGTGCAGAGGACAGGTGG + Intergenic
1072588405 10:96803442-96803464 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1072663737 10:97379518-97379540 GTGTCAGTGCAGGGCTCAGCAGG - Intronic
1075608738 10:123834922-123834944 TTGTGTGTGCAGAGATCACATGG - Intronic
1077520774 11:3032555-3032577 TTGTCGGGGCAGAGGTGGGCTGG + Intronic
1077748187 11:4932633-4932655 TAATTTGTGCAGAGCTCAGCAGG - Intronic
1081684763 11:45034535-45034557 TTGACTGTGCTGTGGACAGCAGG - Intergenic
1081687516 11:45053293-45053315 TAGCCTGTGCTGATGTCAGCAGG + Intergenic
1082671585 11:56042148-56042170 TGGCCTGTGCAGAAGTCAGATGG + Intergenic
1082972419 11:59037572-59037594 TTTTCTGTGCAGTGAGCAGCTGG + Intronic
1082976892 11:59081474-59081496 TTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1083621049 11:64049593-64049615 ATGTCTGTGCGGGAGTCAGCAGG - Intronic
1085384310 11:76148367-76148389 GGGCCTGTGCTGAGGTCAGCAGG - Intergenic
1086615634 11:88815633-88815655 TTGTATGTGCAGAGATCACAAGG + Intronic
1086970223 11:93073346-93073368 TTGTTTGTGCAGCAGTCAGGAGG + Intergenic
1089423869 11:118353491-118353513 TTGTCTCTGAAGAGGGCAACAGG - Exonic
1090334081 11:125951131-125951153 ATGACTGTGCAGAGGGCAGGCGG - Intergenic
1091017451 11:132065060-132065082 TTGTCTGTGCACAGGAGTGCAGG + Intronic
1091369856 11:135048833-135048855 TTCTCTGTTCAGTGGTCACCAGG + Intergenic
1091564832 12:1640641-1640663 TTGTATGTGCAGAGCACACCTGG + Intronic
1093031976 12:14296850-14296872 TGGCCTGTGCAGAGGACAGCTGG - Intergenic
1093261373 12:16941192-16941214 TTGCCAGTCCAGAGGTCTGCAGG + Intergenic
1093659889 12:21744079-21744101 TTCTCTGAGCAGATGCCAGCAGG - Intronic
1095924667 12:47566698-47566720 TTCTGTGGGCACAGGTCAGCTGG + Intergenic
1095974494 12:47929918-47929940 ATGTCTGTGCAGAGTCCATCAGG + Intronic
1097954029 12:65464792-65464814 ATGTCTCTCCAGAGGTCACCTGG - Exonic
1098155547 12:67594074-67594096 TTTTCTGAGCAGGGTTCAGCTGG - Intergenic
1098357673 12:69626796-69626818 TTGTCTGTGCAGTGGGTAGCTGG - Intergenic
1099634737 12:85199391-85199413 TTGACTTTGTAGAGGTCAGATGG + Intronic
1099888966 12:88566211-88566233 ATGTGTCTGCTGAGGTCAGCAGG + Intronic
1101875717 12:108595915-108595937 TTCTCACTGCAGAGGGCAGCTGG + Intronic
1102328526 12:112010643-112010665 TTGTCTCTGCAGCTGTCAGCAGG + Intronic
1102963040 12:117105959-117105981 TTGTCTGTGCAGTGGGCAGGAGG + Intergenic
1103035496 12:117653147-117653169 TGGTCTGTGCAGAAGACAGATGG + Intronic
1103285007 12:119793556-119793578 TGGTCTGAGCTGAGGTCATCAGG - Intronic
1103798864 12:123523994-123524016 CTGTCTGTCCAGAGATCAGGGGG - Intronic
1106097493 13:26660930-26660952 CTGTGTGTGCAGAGGTCACATGG + Intronic
1106352191 13:28942787-28942809 TTATCTGTAGAGAGGACAGCAGG + Intronic
1111690890 13:91561457-91561479 TGGTCTGTGCAGAAGTTAGGTGG + Intronic
1111690903 13:91561678-91561700 TGGTCTGTGCAGAAGTTAGGTGG + Intronic
1112580435 13:100673385-100673407 AAGGCTGGGCAGAGGTCAGCAGG - Intronic
1113396081 13:109948950-109948972 TGGTCTGTGCAGAAGACAGATGG + Intergenic
1114538625 14:23438627-23438649 TTGTTTGTGCACAGGGCAGAGGG + Intergenic
1115742027 14:36398677-36398699 GTGTGTGTGCAGAAGTCACCAGG + Intergenic
1117229655 14:53702811-53702833 TTGTCAGTGCTGAGTTTAGCTGG - Intergenic
1117324728 14:54658581-54658603 TTGACTGTGATGAGGCCAGCTGG - Intronic
1119212802 14:72845483-72845505 GTGCCTGTGGAGAGGCCAGCAGG - Intronic
1119653615 14:76400859-76400881 TGCTCTGTGCAGAGGGCAGCTGG + Intronic
1120658688 14:87227541-87227563 TGGTTTGTGCAGAGGTCACATGG + Intergenic
1120937290 14:89909814-89909836 GTGCATCTGCAGAGGTCAGCGGG - Intronic
1122091121 14:99341264-99341286 TTCTCTGCAGAGAGGTCAGCAGG + Intergenic
1122838893 14:104444975-104444997 TTCCCTGTGCAGAGGAAAGCCGG + Intergenic
1123482292 15:20643300-20643322 TTGTCTGTGCAGCAGGCAGGGGG - Intergenic
1123895167 15:24821383-24821405 TTGTGTGTGCAGAGATCACATGG - Intergenic
1123990152 15:25677476-25677498 TTGTCTGTGCAAGGATCATCTGG + Exonic
1126517956 15:49556834-49556856 TAGCCTGTGCAGAGGCCAGAGGG - Intronic
1126934731 15:53694203-53694225 TGGTCTGTGCAGAGATCTGTAGG + Intronic
1128289065 15:66462978-66463000 TTCTCTGTCCAGAGGGCAGGAGG + Intronic
1128496232 15:68200135-68200157 TTGTGTTTGCAGAGGTCCCCTGG - Intronic
1131622471 15:94082256-94082278 TTGTCTGAGAAGAGGTTACCTGG + Intergenic
1131984920 15:98033517-98033539 CTGTCTGTGCAGAGATCACATGG + Intergenic
1132479114 16:157675-157697 TTCTGTGTTCAGAGGTCACCTGG - Intronic
1133034379 16:3026860-3026882 TTGGCTGTGCGCAGGTCTGCGGG - Exonic
1134085821 16:11356870-11356892 TTTTCTGTGCATAGACCAGCAGG - Intergenic
1136527890 16:30844510-30844532 TGGCCTGTGCAGAAGTCAGATGG - Intronic
1136568310 16:31082710-31082732 TTGTCAGAGCAGAGGGCAGGTGG + Intronic
1141709738 16:85691100-85691122 TTGTTTGTCCAGACGTCAGTTGG - Intronic
1141912937 16:87072318-87072340 TTGCCTTTCCAGATGTCAGCTGG + Intergenic
1145061689 17:19738073-19738095 TGGGGTGTGCACAGGTCAGCAGG + Exonic
1145183454 17:20773352-20773374 CTTTCTGTGCAGAGAGCAGCAGG + Intergenic
1147598802 17:41733582-41733604 TTGCGTGTGCAGAGGACAGGAGG + Intronic
1150301447 17:64050316-64050338 TTGTCTGTGCTGGGGACAGCAGG - Intronic
1150584898 17:66508589-66508611 TCCTGTGTGCAGAGGACAGCTGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1152375974 17:79919245-79919267 GAGGGTGTGCAGAGGTCAGCGGG - Intergenic
1152491417 17:80637113-80637135 TGGTCTGTGCTGATGTCAGAGGG + Intronic
1152896168 17:82912655-82912677 TGGTCTGAGCAGAGGAGAGCAGG + Intronic
1159139825 18:64380048-64380070 GTGTGTGTGAAGAGGTCATCAGG + Intergenic
1160399582 18:78600242-78600264 TTGTCTGTTCAGAGTGGAGCTGG - Intergenic
1160421257 18:78747278-78747300 TTGTATTTGCAGAGTTGAGCAGG + Intergenic
1160892136 19:1384479-1384501 TTATCTGAGCAGAGGTCCGCAGG - Intronic
1161060351 19:2211548-2211570 TTGGCTGCGCAGGGGTCAGAGGG + Intronic
1161064790 19:2232310-2232332 CAGTCTGTTCAGTGGTCAGCAGG + Exonic
1164952934 19:32353958-32353980 TTTTCTGTGCTGATGTAAGCAGG - Exonic
1165230463 19:34383374-34383396 ATGTATGTGCATATGTCAGCCGG + Intronic
1166673475 19:44725280-44725302 TGGTTGGTGCAGAGGCCAGCAGG - Intergenic
1168616836 19:57844646-57844668 TTGTGGGTTCATAGGTCAGCTGG + Exonic
1168620071 19:57871268-57871290 TTGTGGGTTCATAGGTCAGCTGG - Intronic
925130979 2:1493849-1493871 ATGGCTGTGCTCAGGTCAGCGGG - Exonic
925305018 2:2842107-2842129 TTGGCTGAGCAGAGGGCTGCAGG + Intergenic
925571334 2:5315795-5315817 TGGTCTGGGCAGAGCTCTGCAGG - Intergenic
925881948 2:8360080-8360102 TTGTCTGAGCGGTGGGCAGCTGG + Intergenic
926094869 2:10074530-10074552 TTGTCTCTGGAGAGGGGAGCTGG + Intronic
927035758 2:19174488-19174510 TTTTCTGTGCAGGGGTCTGGAGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
928696114 2:33851876-33851898 TTTTCTGTGCAGTGAACAGCAGG - Intergenic
929774821 2:44922789-44922811 TTGCATGTGTAGAGGTGAGCTGG + Intergenic
930014885 2:46963513-46963535 TTGGCTGGGCTGAGGTCAGGTGG - Intronic
930090675 2:47529104-47529126 TTGACAGTGCAGAGCCCAGCAGG - Intronic
930099989 2:47596162-47596184 TTGTCTGGGCCCAAGTCAGCAGG - Intergenic
933799114 2:85945728-85945750 TGGCCTGTGCAGAGATCAGATGG + Intergenic
934716564 2:96548089-96548111 TGGTCTGTGCAGACCTCAGAAGG - Intronic
936497070 2:113031638-113031660 TTGTCTTTGATGAGGTCAGATGG + Intronic
936796034 2:116204767-116204789 CAGTCTGTGCAGAGCTCAGAAGG - Intergenic
941810779 2:169754234-169754256 TTGTGTGTGCAGAGATCACATGG - Intronic
942164375 2:173227925-173227947 TTGTCTCTTCACAGGGCAGCTGG - Intronic
943219526 2:185087649-185087671 TTATCTTGGCAGAGATCAGCTGG + Intergenic
945544767 2:211137270-211137292 TGGTCTGTGCAGAAGACAGGTGG + Intergenic
946063679 2:216968017-216968039 TTGGCTGGACAGAGGCCAGCAGG + Intergenic
947530128 2:230903779-230903801 TTGTGAGTCCAAAGGTCAGCCGG + Intergenic
947948349 2:234125879-234125901 TTGTCAATGCACAGGACAGCTGG + Intergenic
947977129 2:234376439-234376461 GTGTCTGTGCTGAGGACAACAGG + Intergenic
948786536 2:240355732-240355754 TTGTCTCTGCAGAGCTCATGGGG - Intergenic
1169624388 20:7547662-7547684 TTCTCTGTGAAGTGGTGAGCTGG + Intergenic
1169626860 20:7580896-7580918 TTGTCTGTGCAGAAGACAGATGG - Intergenic
1170797074 20:19557270-19557292 ATGTCTGTGCAGTGGTGTGCTGG + Intronic
1173441697 20:43083126-43083148 CTGTCTGTGCAGCGAACAGCAGG + Intronic
1175340710 20:58227616-58227638 TTGTGGGTCCTGAGGTCAGCAGG + Intronic
1175700661 20:61134644-61134666 TTGTCTGTGAAGATGTCAAAGGG + Intergenic
1176257729 20:64160843-64160865 GGGTGTGTGCAGAGGCCAGCTGG + Intronic
1177170206 21:17647018-17647040 TTGTCTGAGCAGAGGAGATCCGG - Intergenic
1177603865 21:23354078-23354100 TTTTCTGTGCAGTGAACAGCAGG - Intergenic
1179515939 21:41906983-41907005 TTGTCTCACCAGAGCTCAGCGGG + Exonic
1179554232 21:42162404-42162426 ATGGCTGTGCAGGGGTGAGCTGG + Intergenic
1179554383 21:42163094-42163116 ATGTCTGTGCAGGGGTTAGTCGG + Intergenic
1180195990 21:46194637-46194659 CTGCCTGTGCAGAGGTCTCCCGG - Exonic
1181274129 22:21677851-21677873 TTGTGTGTGTAGAGCACAGCAGG + Intronic
1181547335 22:23609567-23609589 CTGTTTGTGCAGGTGTCAGCAGG + Intronic
1181729997 22:24838229-24838251 CTTTCTGTGCAGTGATCAGCAGG - Intronic
1184251250 22:43261590-43261612 CTTTCTGTGGAGAGGACAGCTGG - Intronic
1185078447 22:48695930-48695952 CTGTCTGTGTGGTGGTCAGCAGG - Intronic
949675333 3:6447215-6447237 ATGTGTCTGGAGAGGTCAGCTGG - Intergenic
951122470 3:18944656-18944678 TGGTCTGTGCAGAAGACAGATGG + Intergenic
952942441 3:38454565-38454587 TTGTCTGTGCAGTCATCTGCGGG + Intronic
955692908 3:61607670-61607692 TTCTCTGTGGAGAGGCCAGGAGG + Intronic
956306758 3:67834712-67834734 TGGTCTGTGCAGAAGACAGATGG + Intergenic
958025296 3:88042036-88042058 TGGCCTGTGCAGAGGACAGATGG - Intergenic
960051247 3:113241355-113241377 TTGTGTGTGCAGATGTGTGCAGG - Intronic
961175810 3:124834310-124834332 TTGTGTGCGCAGTGGTCAGAGGG + Intronic
961234769 3:125356968-125356990 ACGTCTGTGAAAAGGTCAGCAGG - Intronic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
963141865 3:141952842-141952864 CTGTCTGTGTAGGGGTGAGCCGG - Intronic
967083858 3:186076399-186076421 TTGTCTAAGCAGAGGTGAGCTGG - Intronic
968446706 4:655762-655784 GTGTGTGTGCAGGGGTCAGAGGG - Intronic
968446715 4:655802-655824 GTGTGTGTGCAGGGGTCAGAGGG - Intronic
968507747 4:979547-979569 TTGGCTGTGGAGACGTCAGCGGG - Intronic
968553057 4:1233919-1233941 GTGGCTGTGGAGAGGGCAGCGGG - Intronic
969721927 4:8896775-8896797 TTGTGTGTGCAGAGGCTAGGTGG - Intergenic
970316384 4:14832088-14832110 TAGTCTGGGCAGGGGTTAGCAGG + Intergenic
971702540 4:29997361-29997383 TTGGCTGAGCAGAGCTCAGCTGG + Intergenic
972771046 4:42197111-42197133 ATTTCTGTGCAGAGGTGTGCTGG - Intergenic
974124374 4:57677522-57677544 TTTTCTGTGCAGTGAGCAGCAGG + Intergenic
977031956 4:91894206-91894228 TTGTTTCTGCAGTGGTCAGGTGG - Intergenic
977864199 4:102003435-102003457 AGGTCTGGGCTGAGGTCAGCTGG + Intronic
978833150 4:113113758-113113780 TTGTCTGTGCAGAGGTCAGCTGG + Intronic
980283569 4:130753831-130753853 TTGCCTGTGCAGAAGACAGATGG + Intergenic
984943589 4:184954389-184954411 TTCTCTGGGCTGAGGTCTGCTGG - Intergenic
985552711 5:541548-541570 GTGTCTGTGCAGACATCAGAGGG - Intergenic
986190467 5:5492219-5492241 CTTTCAGTGCAGAGGTAAGCAGG + Intergenic
986302649 5:6490419-6490441 TTGTCTCTGCAGTGGTCAAAAGG - Intronic
986598181 5:9444887-9444909 TTGTCTGTGCACAGCTTGGCTGG - Intronic
988044391 5:25931299-25931321 TTGTGTGTGCTGAGGTTTGCAGG + Intergenic
988096422 5:26617435-26617457 TTGGCTGTGCTGTGCTCAGCTGG - Intergenic
988425425 5:31058018-31058040 CTGTATGTGCAGATGTCATCTGG + Intergenic
989343214 5:40400442-40400464 TTGTCCCTGCACAGGTCAGATGG - Intergenic
990574602 5:57112159-57112181 TTATCTCTGCAGAGGTCAGAGGG - Intergenic
991699112 5:69300751-69300773 CTGTGTGTGCAGATCTCAGCTGG + Intronic
991902839 5:71477594-71477616 TTGTCTGAACATGGGTCAGCTGG - Intronic
991946030 5:71899226-71899248 TGGTCTGTGCAGAAGACAGATGG + Intergenic
992109968 5:73483786-73483808 TGGTCTGTGCAGAAGACAGACGG - Intergenic
996102351 5:119457034-119457056 TTGTTTGTGGAGGGGTCAGATGG + Intronic
997018484 5:129966315-129966337 TTTTCAGTGCACAGCTCAGCAGG + Intronic
997236085 5:132272648-132272670 CTGTGTGTGCAAAGGTGAGCTGG + Exonic
997729135 5:136152619-136152641 TTGGCTGTGCAGCGATCTGCAGG + Intronic
999367988 5:151035266-151035288 TGGTCTGTGCACAGGTCAAGAGG + Intronic
999600007 5:153252381-153252403 TGGTGTGTGCAGAGATCAGATGG + Intergenic
1000131628 5:158305692-158305714 TTGTCTCTGAAGAGGAGAGCTGG - Intergenic
1002961625 6:1920307-1920329 TTGTCTTTGCAGAGCTCTGGTGG - Intronic
1003186793 6:3839196-3839218 TGGTATGTGCAGAGGTCACATGG + Intergenic
1003255877 6:4474506-4474528 TTGTGGGTGGAGATGTCAGCAGG - Intergenic
1003447239 6:6195788-6195810 TTGTTTTTGCAGAGGTAAGCAGG - Exonic
1003568772 6:7242250-7242272 TTGTGTCTGCAGATGTCAGCAGG - Intronic
1003758498 6:9149167-9149189 TGGCCTGTGCAGAAGACAGCTGG + Intergenic
1004604765 6:17183553-17183575 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1005298503 6:24449243-24449265 TTGAGTCTGCAGAGGGCAGCTGG + Intronic
1006837760 6:37009177-37009199 TGGTGTGATCAGAGGTCAGCTGG + Intronic
1008211026 6:48726318-48726340 TTACCTGTGCAGAGATCTGCTGG - Intergenic
1008308799 6:49939221-49939243 ATATGTGTGCAGAGGTCACCTGG - Intergenic
1008617650 6:53241737-53241759 TGGTCTGTGTAGAGTTCAGCAGG - Intergenic
1010819565 6:80397044-80397066 TTGCCTGGGCACAGGTAAGCGGG - Intergenic
1011103874 6:83757778-83757800 TTGTATGTGCAGAGACCTGCTGG - Intergenic
1011415705 6:87118142-87118164 ATCTCTGTGCAGAGGTGAGGTGG + Intergenic
1011490025 6:87882153-87882175 TTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1013000276 6:106015036-106015058 TAGTCTGAGCAGTGGTCATCTGG + Intergenic
1014686418 6:124506884-124506906 TTGTCTGTGTAGATATCACCTGG + Intronic
1015860539 6:137674073-137674095 TTGGCTCTGCAGAAGGCAGCAGG - Intergenic
1016985998 6:149896349-149896371 TTGTCTGCTCAGAGGACAGTGGG + Intronic
1018107445 6:160502708-160502730 TGGCCTGTGCAGAGGACAGATGG - Intergenic
1018195954 6:161356296-161356318 CTGACTGAGAAGAGGTCAGCTGG + Intronic
1018732139 6:166659339-166659361 AGAACTGTGCAGAGGTCAGCAGG - Intronic
1020244589 7:6420866-6420888 TTCTCTGTGCAGATGGCAGATGG - Intronic
1021452697 7:20797727-20797749 TTGTCTGTGCAGCAGTCAGAGGG + Intergenic
1021488337 7:21191166-21191188 TTGTGTGTGCAGAACTCCGCTGG + Intergenic
1022042669 7:26595178-26595200 TTATGTGTGCAGAGGTCTTCTGG + Intergenic
1023202423 7:37712848-37712870 GTGGCTCTGCAGAGCTCAGCTGG + Intronic
1024576394 7:50767962-50767984 TTCTCTGTGCAGAGGGCCTCAGG + Intronic
1025025429 7:55512778-55512800 CCCTCTGTGCAGAAGTCAGCTGG - Intronic
1026028900 7:66771871-66771893 TTGTTTGTTCAGTGGTTAGCAGG + Exonic
1026118016 7:67512589-67512611 TGGTGTGTGAAGAGCTCAGCTGG - Intergenic
1026308916 7:69167016-69167038 TGGTGTGTGCAGAGATCACCTGG + Intergenic
1027542130 7:79480010-79480032 TAATTTGTGCAGAGCTCAGCAGG + Intergenic
1032311591 7:130792435-130792457 ATGTATGTGCAGAGGTCTGTGGG - Intergenic
1032543626 7:132724483-132724505 ATGTGTGAGCAGAGGTCAGCAGG - Intronic
1033280076 7:139999981-140000003 GTGTGTGTGCAGATGTCATCTGG - Intronic
1033541389 7:142358933-142358955 TTTTTTGTGCAGAGAGCAGCTGG - Intergenic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1034745979 7:153524298-153524320 TGGTCTCTGCAGAGGTGGGCGGG - Intergenic
1035241979 7:157538107-157538129 GTGTGTGTGCAGAGCTCAGATGG - Intergenic
1035467598 7:159090049-159090071 GTGTCTGTGCTGAGGTCACCGGG - Intronic
1035467612 7:159090116-159090138 GTGTCTGTGCTGAGGTCACCGGG - Intronic
1035467637 7:159090250-159090272 ATGTCTGTGCTGAGGTCACTGGG - Intronic
1035467652 7:159090317-159090339 GTGTCTGTGCCGAGGTCACTGGG - Intronic
1035467667 7:159090385-159090407 GTGTCTCTGCTGAGGTCACCGGG - Intronic
1035467679 7:159090452-159090474 GTGTCTGTGCTGAGGTCACCGGG - Intronic
1035467693 7:159090519-159090541 GTGTCTGTGCTGAGGTCACCGGG - Intronic
1035467707 7:159090586-159090608 GTGTCTGTGCTGAGGTCACCGGG - Intronic
1035467730 7:159090720-159090742 ATGTCTGTGCTGAGGTCACTGGG - Intronic
1035467745 7:159090787-159090809 GTGTCTGTGCCGAGGTCACTGGG - Intronic
1035467760 7:159090855-159090877 GTGTCTCTGCTGAGGTCACCGGG - Intronic
1035467772 7:159090922-159090944 GTGTCTGTGCTGAGGTCACCGGG - Intronic
1035467786 7:159090989-159091011 GTGTCTGTGCTGAGGTCACCGGG - Intronic
1036720583 8:11171611-11171633 TTGTGTGTGCAGAGATCACACGG - Intronic
1037056274 8:14445550-14445572 TTTTCAGTGGAGAGGGCAGCTGG - Intronic
1037596925 8:20361954-20361976 TTGTCTATCCAGAAGCCAGCTGG - Intergenic
1039269719 8:35867742-35867764 ATTTCTGTGCAGAGAGCAGCAGG - Intergenic
1039432261 8:37534138-37534160 TTCTCTCTGCAGAGACCAGCAGG - Intergenic
1040093659 8:43421725-43421747 TTATGTGTGCAGAGGTAGGCTGG + Intergenic
1040500223 8:47998835-47998857 TTGACTGTTAAGGGGTCAGCCGG - Intergenic
1041335058 8:56772769-56772791 TTGTCTGTGCACAGATGAGGAGG + Intergenic
1041458313 8:58084109-58084131 CTGTCTTTCCTGAGGTCAGCAGG + Intronic
1043257893 8:78158447-78158469 TTGCCTGTGCAGAAGACAGATGG + Intergenic
1043442103 8:80285288-80285310 CTGTCTGTGCAGATGTCAGAAGG + Intergenic
1044133651 8:88558074-88558096 TTGCCTGTGCAGAAGACAGATGG + Intergenic
1045178344 8:99751893-99751915 CTGTGTGTGCAGACATCAGCTGG - Intronic
1047080832 8:121458524-121458546 CTTTCTGTGCAGAGAGCAGCAGG - Intergenic
1048432260 8:134381527-134381549 CTGTCAGTGCTGAGCTCAGCAGG + Intergenic
1052274207 9:26659346-26659368 TTGTCTGTGCTGAGGGCAAGAGG + Intergenic
1052567688 9:30178750-30178772 TTGCCTATGCAGATGTGAGCAGG - Intergenic
1052763819 9:32620067-32620089 TAGTATGCTCAGAGGTCAGCAGG + Intergenic
1056794029 9:89644626-89644648 TTGTCTTTGCAGAGTCTAGCTGG + Intergenic
1056885439 9:90438794-90438816 ATGTCTGTGCAGGGGAAAGCTGG - Intergenic
1056977584 9:91273190-91273212 TTGTCTCTGCCCAGGGCAGCAGG - Intronic
1057524793 9:95788963-95788985 CTGTCCGTGCAGAGCTCAGCCGG + Intergenic
1058510833 9:105714148-105714170 TTGTCTCTGCAGCTCTCAGCAGG - Intronic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1059985672 9:119818136-119818158 TTGTCTGAGCAGACTGCAGCAGG - Intergenic
1060324450 9:122599186-122599208 TTGTTTGTACAGAGATCTGCTGG - Intergenic
1061080078 9:128364787-128364809 TTGCCTGTCCCGAGGGCAGCTGG - Intergenic
1061298035 9:129687543-129687565 TTGAGTGTGCAGAGGGAAGCCGG - Intronic
1185519780 X:729733-729755 TTGTCTGTGGTGAGCTCTGCTGG - Intergenic
1187288509 X:17929897-17929919 TTATCTGTACAGAGGTCTTCAGG + Intergenic
1189626416 X:42902022-42902044 TTGTCTGTGCAGGTGGCTGCTGG - Intergenic
1189641280 X:43074235-43074257 TTGTCTGTGTAGAGATCCCCAGG - Intergenic
1190618582 X:52263110-52263132 TTTTCTGTTGAGAGGTGAGCAGG - Intergenic
1198369770 X:135979147-135979169 TTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1198701182 X:139399380-139399402 TGGTCTGTGCAGAAGACAGATGG + Intergenic
1199010176 X:142748781-142748803 TTGCCTCTGGGGAGGTCAGCTGG - Intergenic
1200001472 X:153063619-153063641 TTGGCTGTGGAGAGCTCACCAGG - Intergenic
1201794194 Y:17876960-17876982 TTATCTGTGATGAGGTAAGCAGG - Intergenic
1201807360 Y:18029025-18029047 TTATCTGTGATGAGGTAAGCAGG + Intergenic
1202355576 Y:24044779-24044801 TTATCTGTGATGAGGTAAGCAGG - Intergenic
1202515202 Y:25625330-25625352 TTATCTGTGATGAGGTAAGCAGG + Intergenic