ID: 978837183

View in Genome Browser
Species Human (GRCh38)
Location 4:113164969-113164991
Sequence CAACCACCTATAACAACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978837183 Original CRISPR CAACCACCTATAACAACATT TGG (reversed) Intronic
901348711 1:8571988-8572010 CAAGCACCAACAACAACATACGG + Intronic
902591633 1:17479120-17479142 CAACCATATATAACAAAATTCGG - Intergenic
910738340 1:90487460-90487482 CCACCACCAATATCAACCTTGGG - Intergenic
916213615 1:162377813-162377835 CAACCACTGAAAACAATATTTGG - Intronic
916352836 1:163871366-163871388 CTACCACCTATTATAACATCAGG + Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918432211 1:184473124-184473146 CAAGCACCTCTAAAAACATGAGG - Intronic
918889852 1:190253003-190253025 CTACCACCTATGAGAACATATGG + Intronic
919621885 1:199872442-199872464 CAACCACTTTGAAAAACATTTGG + Intergenic
920076343 1:203340093-203340115 TAAGCACCTATCACAACATCTGG + Intergenic
920634179 1:207682768-207682790 CAACCATCTATCACAACAGAGGG + Intronic
923582647 1:235232799-235232821 GAACCAACTTTAACAAAATTGGG - Intronic
1064293094 10:14053345-14053367 CAAACACCTCTCACAACATGAGG + Intronic
1064810195 10:19188219-19188241 TGACCACCTGTAACAAGATTGGG + Intronic
1067804787 10:49385130-49385152 CAACCCCATAGAGCAACATTGGG - Intronic
1068606625 10:59012057-59012079 CAACCACCTATAATAGTATTTGG - Intergenic
1075448928 10:122533935-122533957 CAAGGACCAAGAACAACATTGGG - Intergenic
1077925873 11:6681725-6681747 CAACCACCTCTGGCAACATTTGG + Exonic
1078131423 11:8617300-8617322 CAGCCACCTATGTCAACATCAGG + Exonic
1079526140 11:21390707-21390729 CAAACAGCAATAACAAAATTAGG - Intronic
1086354995 11:85987039-85987061 CAAACACCTTTTACAAAATTTGG + Intronic
1086725338 11:90175701-90175723 CACCAACCTATAACAAGAATTGG - Intronic
1087260364 11:96003966-96003988 CTACCAACTAAAACAAGATTAGG + Intronic
1091930709 12:4393147-4393169 CAACCTCCTATCACAACTTCAGG + Intergenic
1104157507 12:126148086-126148108 GAAACACCTATAACAATATCAGG - Intergenic
1107096689 13:36545257-36545279 CTACTACCTACAACAACCTTGGG + Intergenic
1109151143 13:58848591-58848613 TTACCATCTATAACAACATCTGG - Intergenic
1115360654 14:32497241-32497263 CAAACACCTATATAAACATGAGG - Intronic
1115885661 14:37969032-37969054 TAACCACCCATAACACTATTTGG + Intronic
1116012564 14:39367837-39367859 CAACCACAGATCACAATATTTGG - Intronic
1120473228 14:84953496-84953518 CAACAACAAATAACAACAATGGG - Intergenic
1138810445 16:60143838-60143860 CAAACACTTAAAGCAACATTGGG - Intergenic
1138996881 16:62465938-62465960 CTACAACCTAAAACAAAATTTGG - Intergenic
1140070610 16:71646387-71646409 CTACCACACAGAACAACATTTGG + Exonic
1143716978 17:8780309-8780331 CCACCACCAATAACAACAAGAGG + Intergenic
1147954277 17:44123625-44123647 CCGCCACCAACAACAACATTCGG + Exonic
1149489834 17:57076482-57076504 CAACCACTTTGCACAACATTTGG - Intergenic
1155012418 18:21792965-21792987 CAAACATCTATAACAAAACTAGG + Intronic
1161923482 19:7283757-7283779 CTACCACCAATAACAAGAATCGG - Intronic
1168433075 19:56296556-56296578 CTAACACCTAGAATAACATTTGG - Intronic
925207410 2:2018777-2018799 CAGCCTCCTATACAAACATTGGG - Intronic
927760314 2:25747129-25747151 CAACCACCTATCGCAATATTTGG - Intronic
928971173 2:37031028-37031050 CAGCCCCCAATAAAAACATTGGG + Intronic
929153228 2:38766973-38766995 CAACCAACTAAAACAAGATGAGG + Intronic
929425727 2:41842865-41842887 TAACCAGCTACAACAAAATTGGG - Intergenic
931783330 2:65599404-65599426 CACCCACCAAAAGCAACATTTGG - Intergenic
934722777 2:96593165-96593187 AAAACACCAAAAACAACATTTGG - Exonic
934749037 2:96780274-96780296 GAACAACCTATAACAAACTTTGG - Intronic
935394393 2:102590513-102590535 GAACCACCTGAAACAAAATTTGG - Intergenic
944404083 2:199362043-199362065 CAACCATTTCTATCAACATTTGG + Intronic
944479929 2:200145920-200145942 CAAACATCTACAACAGCATTTGG - Intergenic
945114565 2:206398654-206398676 CAAACACCTAGAACAGCACTCGG - Intergenic
1179377289 21:40862002-40862024 CAACCACTTAGCACAAGATTTGG - Intergenic
1181017249 22:20078324-20078346 CAACCCCCTACAAAAAAATTAGG - Intergenic
1182725872 22:32445099-32445121 CAAGCACCTACCACAATATTTGG + Intronic
949887931 3:8711268-8711290 AAAGCACCTAGAACAACTTTTGG + Intronic
953154545 3:40357247-40357269 CACACAACTACAACAACATTAGG + Intergenic
954910266 3:54100107-54100129 AAACCACCTAAACCAAAATTTGG + Intergenic
956541697 3:70347619-70347641 CAAGTACCTAGAACAATATTTGG - Intergenic
956574320 3:70734746-70734768 CATCAACCTATAAGACCATTTGG - Intergenic
956786385 3:72646114-72646136 CCACCACCAAGAACAACATAAGG + Intergenic
959728924 3:109578065-109578087 CAACCAACTACAATAAAATTTGG + Intergenic
960253725 3:115487655-115487677 CAACAACCCAAAACAAAATTGGG + Intergenic
960480521 3:118182557-118182579 CTACCACTTATAAGAACATGTGG + Intergenic
966870172 3:184285178-184285200 CAGCCACACAGAACAACATTTGG + Intronic
967086274 3:186097835-186097857 CAACCAACTCAAACAACACTGGG - Intronic
967610940 3:191505321-191505343 AAACCACCTACAACAACAGAAGG + Intergenic
968788041 4:2638690-2638712 TAAACACCTATAAACACATTTGG - Intronic
974406922 4:61484846-61484868 AAACCACCTATTACATAATTTGG + Intronic
977801815 4:101243339-101243361 GAACCACGTATAAAAGCATTAGG + Intronic
978837183 4:113164969-113164991 CAACCACCTATAACAACATTTGG - Intronic
979469420 4:121076570-121076592 CAATGACATATATCAACATTTGG + Intergenic
981392449 4:144207371-144207393 AAACTACTAATAACAACATTTGG - Intergenic
981411805 4:144441003-144441025 CATCAACCTGTAACGACATTAGG - Intergenic
983687468 4:170428894-170428916 CATCCAGCTATAGCAACAGTGGG + Intergenic
986441429 5:7785854-7785876 CAACGACCAATAACAAAGTTGGG - Intronic
988180101 5:27779944-27779966 CACCCACCTATCTGAACATTAGG - Intergenic
988643445 5:33067442-33067464 CACCCAACTATCACAACACTTGG - Intergenic
989723495 5:44558397-44558419 CTAAAACCCATAACAACATTTGG - Intergenic
993329750 5:86583848-86583870 CAACCACTTTTAAAAATATTTGG + Intergenic
993767175 5:91875124-91875146 CAACCACTTATAAACAAATTAGG - Intergenic
994267134 5:97731039-97731061 CAAACAACAACAACAACATTGGG + Intergenic
995430400 5:112068245-112068267 CACCTACAAATAACAACATTTGG + Intergenic
996734082 5:126742870-126742892 CACCCACCCATAACAATAGTGGG + Intergenic
998794357 5:145802362-145802384 CAACCATTTAGAAAAACATTTGG - Intronic
1000194088 5:158941014-158941036 CAACCACCTTGAAGATCATTAGG + Intronic
1003479819 6:6520639-6520661 CATCCACATATATCAACACTTGG + Intergenic
1005889229 6:30123030-30123052 CAACCAGCAATAACAACTATTGG - Intergenic
1006955464 6:37866360-37866382 CCACATCATATAACAACATTGGG - Intronic
1007816592 6:44529497-44529519 CCACCACCTATCACCACATCTGG - Intergenic
1011059519 6:83248655-83248677 CAAACACTTATAAAACCATTAGG - Intronic
1019617405 7:1971459-1971481 CAAAAACCTATAAAAACATGGGG + Intronic
1021145750 7:17086655-17086677 CAAGCACATAGAAAAACATTAGG + Intergenic
1021169536 7:17382018-17382040 CCAGAACCTATAACAACATCAGG + Intergenic
1021750390 7:23793798-23793820 CAACCACTTTGAAAAACATTTGG + Intronic
1022631932 7:32093604-32093626 CAAACACTTATGCCAACATTGGG + Intronic
1023424628 7:40022545-40022567 CAAACACCTAGAACAATGTTTGG - Intronic
1028392504 7:90333581-90333603 TAACTACCTATAACAAAATAAGG - Intergenic
1030726370 7:112930725-112930747 AAAGCACTTAAAACAACATTTGG - Intronic
1032929794 7:136653318-136653340 CCACCACCTAAAACAAAAGTGGG + Intergenic
1032986306 7:137341664-137341686 AAGCCACATATAACAGCATTAGG - Intronic
1036805419 8:11828761-11828783 CAATCACCTAGGACCACATTTGG - Intronic
1043064587 8:75551823-75551845 CAACCAGCTACCACAACTTTTGG + Intronic
1043151842 8:76727598-76727620 AAACCAGCTAAAACAACTTTTGG + Intronic
1043189221 8:77196330-77196352 CAATCATATATAACAACATTCGG - Intergenic
1046799018 8:118404451-118404473 CAACCACCTATCACATCAAATGG - Intronic
1047986118 8:130235587-130235609 CCAAGACCTAAAACAACATTTGG + Intronic
1048633264 8:136267782-136267804 CACCCATCTATAACTATATTAGG + Intergenic
1050184932 9:2963255-2963277 CAACCACCTTTTCCATCATTAGG + Intergenic
1052621258 9:30912904-30912926 CAATCAGCTATATCTACATTAGG - Intergenic
1056675586 9:88674200-88674222 CAACCACCTCTCAGAATATTTGG + Intergenic
1058693357 9:107538044-107538066 CAATCACCTTTAAAACCATTTGG + Intergenic
1186873029 X:13791100-13791122 AAACCAGCAATGACAACATTGGG + Intronic
1187820654 X:23284458-23284480 CAACCACTTATAACAACGCTGGG + Intergenic
1190709302 X:53054865-53054887 CATCCACATATAACCACACTTGG - Intronic
1196257759 X:113542201-113542223 CAAACACTTAGAAGAACATTTGG + Intergenic
1197949057 X:131874536-131874558 CAGCTACCTCTAACATCATTGGG + Intergenic
1199217265 X:145274497-145274519 CAACCACTTTGAAAAACATTTGG - Intergenic
1201433841 Y:13934327-13934349 CAACTTGCTATAACAACATCAGG - Intergenic