ID: 978841084

View in Genome Browser
Species Human (GRCh38)
Location 4:113213474-113213496
Sequence CTCAAATATAAGTCTTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978841079_978841084 22 Left 978841079 4:113213429-113213451 CCATGCAACACCTGCTATTTGGG 0: 1
1: 0
2: 1
3: 9
4: 198
Right 978841084 4:113213474-113213496 CTCAAATATAAGTCTTGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 193
978841081_978841084 12 Left 978841081 4:113213439-113213461 CCTGCTATTTGGGCAAATACTAT 0: 1
1: 0
2: 6
3: 101
4: 504
Right 978841084 4:113213474-113213496 CTCAAATATAAGTCTTGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978841084 Original CRISPR CTCAAATATAAGTCTTGAGA AGG Intronic
901147831 1:7079231-7079253 ATTAAAAATAAGCCTTGAGAGGG + Intronic
908152558 1:61318226-61318248 TTCAAAACTAAGTCTGGAGAAGG + Intronic
909313150 1:74179611-74179633 AACAAAAATAACTCTTGAGAAGG - Intronic
910753575 1:90661402-90661424 CTAAAATGTAAGTATTGAAAAGG + Intergenic
913476190 1:119240648-119240670 CTAAAATCTAAGTGTTGACAGGG - Intergenic
915452154 1:156013518-156013540 CTCAAAGCTGGGTCTTGAGAAGG + Intronic
916895372 1:169156924-169156946 CTGAAATATCAGGTTTGAGAAGG + Intronic
919933568 1:202236953-202236975 CCTAAATATCAGTCATGAGAAGG - Intronic
920752237 1:208689912-208689934 CTGAAATATAAGTCTAATGATGG + Intergenic
920839284 1:209540504-209540526 CTCAAAAATCAGTCTTTTGAAGG - Intergenic
921704577 1:218307674-218307696 CTCTAAAACTAGTCTTGAGATGG + Intronic
924072703 1:240298358-240298380 TTAAAAAATAAGTCTTGGGAAGG + Intronic
1064391767 10:14948348-14948370 TTCAAATATGTATCTTGAGAAGG + Intronic
1065031360 10:21589642-21589664 ATAAAATATATGTCTGGAGATGG - Intronic
1065713491 10:28540521-28540543 TTCAAAAATAAGTTTTGACATGG + Intronic
1067901480 10:50245971-50245993 ATTAAAAATAAGTCTTCAGAAGG - Intronic
1068033708 10:51734532-51734554 CCCAAATGTAGGCCTTGAGAAGG + Intronic
1069494177 10:68888102-68888124 CACACATATATGTTTTGAGATGG + Intronic
1070993142 10:80750664-80750686 CCCACAGATAAGTCTTAAGATGG - Intergenic
1071213068 10:83366735-83366757 CTCTAATAGAAGTCTGGGGATGG - Intergenic
1075111265 10:119586759-119586781 AGCAAATACAAGTCTTGAGTTGG - Intronic
1079593802 11:22215444-22215466 CTCAAATTTGAGAATTGAGATGG - Intronic
1079705155 11:23606669-23606691 AACAAAAACAAGTCTTGAGAAGG - Intergenic
1080660219 11:34289909-34289931 CTCAAATATAAACCTTAAAAAGG - Intronic
1082607618 11:55261110-55261132 CTTGAATATAAGTCTTGTGGGGG + Intergenic
1085796005 11:79540614-79540636 TTAAAATATAAGGCTTGACATGG + Intergenic
1086222278 11:84462607-84462629 GTAAAATATAAGTATTAAGAGGG + Intronic
1086703001 11:89921477-89921499 CTTGAATATAAGTCTTGTGGGGG - Intronic
1087523535 11:99276694-99276716 CTCAAATAAAAATTTTCAGAAGG - Intronic
1089025533 11:115265823-115265845 CTCAAAGAAAAGACCTGAGAGGG - Intronic
1089748388 11:120632941-120632963 CTCACAAATAAGCCATGAGATGG + Intronic
1090082431 11:123622958-123622980 CTCAAAAAGAAGTCTTAAGACGG + Intronic
1092641957 12:10521995-10522017 CTCAAAAGTTATTCTTGAGATGG - Intronic
1093128963 12:15366627-15366649 CTCAAAAATAAGTATTAATATGG - Intronic
1093351424 12:18107492-18107514 CTAAGTTAAAAGTCTTGAGATGG + Intronic
1094301661 12:28970998-28971020 GTCAACCATAAGTCTTGTGATGG + Intergenic
1094775070 12:33717238-33717260 CTCAAAAATAATTCCTCAGATGG - Intergenic
1096204755 12:49711798-49711820 CTCAAATTAAAGTGTTGACAGGG - Intronic
1096925855 12:55145337-55145359 ATCAAATATAAATTTTGATACGG + Intergenic
1097533363 12:60834439-60834461 TTCAAATATATCTCTAGAGAAGG - Intergenic
1098551953 12:71772340-71772362 CTCAGACTTAAGTCTTAAGAAGG - Intronic
1099123039 12:78716643-78716665 CTTAAATATGAATCTTTAGAAGG + Intergenic
1101307094 12:103539261-103539283 CACAGATATATGTCTAGAGATGG - Intergenic
1106962179 13:35011380-35011402 TTCATTTAAAAGTCTTGAGATGG - Intronic
1107191103 13:37587278-37587300 CTAAAATTTAAGTTTTGAGAGGG + Intronic
1109040011 13:57321130-57321152 CTTAAATATAATACATGAGAGGG - Intergenic
1109207186 13:59495624-59495646 CTCAAATAGACCACTTGAGATGG - Intergenic
1109467813 13:62761449-62761471 ATTAAATATAAGTATGGAGAGGG + Intergenic
1110380246 13:74841921-74841943 CTTAAATAAATGACTTGAGAAGG + Intergenic
1110833386 13:80057138-80057160 CTCATGTAGAAGTCTGGAGATGG + Intergenic
1113221293 13:108106237-108106259 CTTAAATATAAGACCTGAAATGG + Intergenic
1113275866 13:108729095-108729117 CTGAAATATAAATTTTTAGAGGG + Intronic
1113912451 13:113849494-113849516 CTGAAATAAAAGACTTGCGAGGG + Intronic
1118998151 14:70856198-70856220 CTTAAAGATTAGTTTTGAGAAGG - Intergenic
1122044481 14:99013399-99013421 TTCAGATATATTTCTTGAGAGGG - Intergenic
1123716194 15:23034446-23034468 CAGAAATATAAGTGGTGAGATGG + Intronic
1125319631 15:38470986-38471008 CTCTAATATATGGCTTGACAGGG - Intronic
1127445184 15:59054637-59054659 CTAAAATAAAATTCTTAAGAAGG - Intronic
1127632781 15:60842027-60842049 GTCAAAGATATGTTTTGAGAAGG - Intronic
1131099166 15:89674534-89674556 TTCAAATATAAGTCTTGGCTGGG - Intronic
1131772669 15:95756820-95756842 CTCAAAAATATGTCTTCTGAAGG - Intergenic
1135084055 16:19460652-19460674 CCCAAAGATAAGTCATGTGATGG + Intronic
1135780565 16:25296341-25296363 CTCAGAAATAAGACTTGAAAAGG - Intergenic
1137438611 16:48479303-48479325 ATCAAATTTTAGTCTTTAGAAGG + Intergenic
1139058019 16:63210418-63210440 GTTAAATATAAGTAGTGAGAGGG - Intergenic
1143687481 17:8529721-8529743 TTTAAATATAACTTTTGAGATGG + Intronic
1144107586 17:11999674-11999696 ACAAAATATAAGTCTTGGGAGGG - Intergenic
1146193378 17:30790246-30790268 CTAAGTTTTAAGTCTTGAGATGG - Intronic
1146859586 17:36285426-36285448 AACAAACAGAAGTCTTGAGATGG + Intronic
1147089910 17:38089513-38089535 AACAAACAGAAGTCTTGAGATGG + Intergenic
1147107301 17:38231008-38231030 AACAAACAGAAGTCTTGAGATGG - Intergenic
1148253554 17:46107709-46107731 TTCAAATAGAAGTGTTGAGTAGG - Intronic
1148422226 17:47557528-47557550 AACAAACAGAAGTCTTGAGATGG + Intronic
1150172095 17:63008659-63008681 TTAAAATAAAATTCTTGAGAAGG + Intergenic
1150665281 17:67129485-67129507 CTCAAATTTATGTCTTGAGTTGG - Intronic
1151554628 17:74840449-74840471 CACAAATATATGCCTAGAGAAGG + Intergenic
1154137941 18:11796953-11796975 CTCAAAAATAAGTTCTGATAGGG - Intronic
1156961930 18:43042727-43042749 CTCAAATGTAAACCTTTAGAAGG - Intronic
1157008825 18:43621410-43621432 TTCAAATATAAATTTTGAGTAGG - Intergenic
1158922833 18:62213310-62213332 CTAAAATATAAGTTTTAATAAGG - Intronic
1159467908 18:68809323-68809345 CTCAAATATAAATATTTATATGG - Intronic
1165181048 19:33969981-33970003 ATAACATATAAGTCTAGAGAAGG - Intergenic
1166839272 19:45686716-45686738 CACATATATAATTTTTGAGATGG + Intergenic
1167677591 19:50897125-50897147 TTGACATATAAGTCTGGAGAGGG - Intergenic
925178817 2:1803551-1803573 TCCAAATAAAAGTCTTGATACGG + Intronic
925492738 2:4413010-4413032 CTGAAATATCACTCTGGAGAGGG - Intergenic
926564269 2:14452646-14452668 CAGAAATATAAGACTTGAGGTGG + Intergenic
928622403 2:33104282-33104304 CTCAGATTCAAGTCTTTAGATGG + Intronic
928671060 2:33603925-33603947 CTCAAATATAAGATTTGTCATGG + Intergenic
931521228 2:63099334-63099356 ATAAACTATAAGTATTGAGATGG - Intergenic
934091305 2:88553034-88553056 CTCAAAAATAATTCTTAAGTTGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935004151 2:99054381-99054403 CTTAAATATAAGACCTGAAACGG + Intronic
935062106 2:99617484-99617506 CTCAATTATAAGTTTTTAAAAGG - Intronic
935484801 2:103640137-103640159 CACAAATGAAAGTCTTGACAGGG + Intergenic
936240908 2:110787838-110787860 CTCAAGTTGAAGGCTTGAGAGGG - Intronic
937583333 2:123515715-123515737 CTCAAATAAAAGTGTTGCCAGGG - Intergenic
941139937 2:161767717-161767739 CTAAAATATCATTCTTGAAAAGG + Intronic
941399997 2:165019369-165019391 TTCAAATTTAATTCTGGAGAAGG + Intergenic
943840940 2:192579796-192579818 CTCAAATCCAGGTTTTGAGAAGG + Intergenic
945338489 2:208620468-208620490 CTCAAATACAAGTTTTAAAATGG + Intronic
945405154 2:209437839-209437861 CTCAAATACAAGTCCTGATAAGG - Intronic
945552585 2:211238681-211238703 CTCTGATATCATTCTTGAGATGG + Intergenic
948047596 2:234955538-234955560 CTCAATAATCAGTCTTCAGAGGG + Intronic
948286205 2:236787402-236787424 TTCAAATATAAGCCCTGATATGG + Intergenic
1170444287 20:16409354-16409376 CACCAACATAAGGCTTGAGAAGG + Intronic
1176372485 21:6070718-6070740 CTGAAATAAGAGTTTTGAGAAGG + Intergenic
1179160125 21:38888484-38888506 CTCAAAAATAAAACTTGAAAAGG - Intergenic
1179750991 21:43467527-43467549 CTGAAATAAGAGTTTTGAGAAGG - Intergenic
1182957590 22:34441898-34441920 CTCACTTATAACTCTTAAGAGGG + Intergenic
1184085137 22:42257488-42257510 CTCTAATATACGGCTAGAGATGG + Intronic
949849009 3:8402990-8403012 CTCAACTCTAAGAATTGAGAAGG + Intergenic
951948564 3:28171618-28171640 CTCAAAAATAACTCTTTATATGG + Intergenic
953150240 3:40318146-40318168 CTACAATATAAGTGTTGAAAAGG - Intergenic
953888169 3:46730917-46730939 CTCAAAAATTTGTATTGAGAAGG + Intronic
958194745 3:90229843-90229865 CTCAAATCAAAGTCTTGTGAAGG - Intergenic
958418098 3:93900803-93900825 CTCAAATCAAAGTCTTGTGAAGG - Exonic
960883365 3:122368873-122368895 ATAAAATATAAGTATTGATAAGG + Intronic
961797634 3:129421235-129421257 AGCAAACAGAAGTCTTGAGAGGG - Intronic
963263120 3:143212691-143212713 CTCAAAGCAAACTCTTGAGATGG - Intergenic
964009645 3:151876165-151876187 CTCAGAAATAAGGCCTGAGAAGG + Intronic
964071989 3:152646369-152646391 CTTCAATATAAGCCTTGAGATGG + Intergenic
964478010 3:157114182-157114204 CTAAAATATCAGAATTGAGAGGG + Intergenic
967080541 3:186045569-186045591 CTGTAATAGGAGTCTTGAGAAGG + Intergenic
967115119 3:186330499-186330521 GTCAAGCATAAGCCTTGAGAAGG + Intronic
972923863 4:43978537-43978559 CTCAATTTTAAAACTTGAGATGG + Intergenic
976360925 4:84177212-84177234 TTCAAATATAAGTCTTGAACTGG - Intergenic
978059538 4:104320615-104320637 ATCCAATATAAGTTTTCAGAGGG + Intergenic
978397356 4:108295591-108295613 CTAAAATATAAGGATTGACAGGG - Intergenic
978841084 4:113213474-113213496 CTCAAATATAAGTCTTGAGAAGG + Intronic
979961816 4:127029670-127029692 ATTAAATATATTTCTTGAGATGG + Intergenic
981360732 4:143842952-143842974 CTCAAATATATTTCTGAAGAGGG + Intergenic
981913104 4:150005203-150005225 CTCAAATGAAATTCTTGAGATGG - Intergenic
983162951 4:164439885-164439907 CTCACAGAGAAGTCTGGAGAGGG + Intergenic
987376990 5:17245005-17245027 CTTAAATATCAGTGTTGAGCCGG + Intronic
987477301 5:18406938-18406960 CTCAAACATAAAGCTTGAAATGG + Intergenic
987638279 5:20576022-20576044 CTTAGAGATAAGGCTTGAGAGGG + Intergenic
992137445 5:73761577-73761599 CTCAAATATAAGCCTTGGTGTGG + Intronic
992606977 5:78467531-78467553 CTCGAATAAAAGTATTGATATGG + Intronic
993157233 5:84241169-84241191 CTCAAATGTAAGTATTTAAAAGG + Intronic
993579845 5:89647020-89647042 TTCAAATATTAGTCTTTAAAGGG + Intergenic
994214234 5:97119483-97119505 CTCCAAAATATGACTTGAGAAGG - Intronic
996343456 5:122464267-122464289 CTCAAATCTCAGTGTTGACATGG + Intergenic
998893449 5:146771484-146771506 GTAAAATATGAGTTTTGAGAAGG + Intronic
999341122 5:150773869-150773891 CTCAAATATAACTCTTTGGATGG + Intergenic
1000228122 5:159289570-159289592 CTCAAATATAAGCTCTGTGAGGG - Intergenic
1000960269 5:167592661-167592683 TTCAAATTTAAGTCTTTAAAAGG - Intronic
1001421216 5:171588813-171588835 CGCAAATATAATACCTGAGAGGG - Intergenic
1004021717 6:11781724-11781746 CTCAAGTCTAAGTCTGCAGATGG + Intronic
1010034523 6:71309027-71309049 CTCAAAAATAAATATTGTGAAGG + Intergenic
1010738545 6:79470696-79470718 ATCAAGTAAAAGTCTTGAAAGGG + Intergenic
1011525497 6:88259912-88259934 CTCAAAAAAAAGTCTTCTGAAGG - Intergenic
1011725369 6:90205373-90205395 GTCAAATATAAGCCCAGAGAAGG - Intronic
1011932234 6:92728765-92728787 ATCAAACATAACTCTTCAGATGG + Intergenic
1011954275 6:93005795-93005817 CTAAAACATACGTCTTGACAAGG - Intergenic
1012572690 6:100749992-100750014 CTAAAATACAAGTTTTGAGCTGG - Intronic
1013107496 6:107038089-107038111 CTCCAATCTAAGTCTTAAAAGGG - Intronic
1013398577 6:109768900-109768922 CTGAAATCTAAGTGTTGACAGGG + Intronic
1016814646 6:148292529-148292551 CTCAAAAAATAGCCTTGAGAAGG + Intronic
1017674504 6:156798871-156798893 CTCAAACATAAGGTTTCAGAGGG - Intronic
1017691125 6:156966247-156966269 CTCATATATAAGATTTAAGAAGG + Intronic
1017830145 6:158119467-158119489 CTCAAATGGAAGTCTTTAGAGGG - Intronic
1018520439 6:164643367-164643389 TTCAAATATAAGACATTAGAAGG - Intergenic
1020528290 7:9293764-9293786 CTTAAATATTAGTATTGACATGG - Intergenic
1022603498 7:31784978-31785000 CTCCAAGATAGGTCATGAGAGGG + Intronic
1023469756 7:40503399-40503421 TTTAAATATAAGTAATGAGAAGG + Intronic
1027682695 7:81240376-81240398 TTCAAATGTAAGTGTAGAGAAGG - Intergenic
1028694011 7:93687457-93687479 CTGAAATAAAAGTATTGGGAAGG - Intronic
1029038475 7:97548417-97548439 CTGAAATATGAGTCCTGAAAAGG + Intergenic
1030242043 7:107338183-107338205 CTCAAATATCTTTTTTGAGAAGG + Intronic
1030439970 7:109576918-109576940 CTCAAATAGAAGTGATAAGAAGG + Intergenic
1030573279 7:111253540-111253562 AGAAAATAAAAGTCTTGAGAGGG + Intronic
1031460395 7:122041796-122041818 CTCAAATTTAACTCCTGAGATGG - Intronic
1033207417 7:139434964-139434986 CTCATCTGTAAGTCTGGAGATGG - Intergenic
1033758218 7:144414524-144414546 CTTAAAAGTAAGTCTTGAAAAGG - Intergenic
1034402269 7:150870439-150870461 CTCAAATATATCTTTTGAGGGGG + Intergenic
1034651978 7:152698683-152698705 ATCTAATATAGGCCTTGAGATGG + Intergenic
1035387224 7:158481755-158481777 CTAAAATATAAGTCTTGGCTGGG - Intronic
1036107807 8:5860399-5860421 TTCAAAAATATCTCTTGAGATGG + Intergenic
1038013115 8:23490504-23490526 CTAAATTAAAAATCTTGAGATGG + Intergenic
1039103821 8:33969246-33969268 CTCCAGTATAAGTTTTAAGATGG + Intergenic
1041273575 8:56133895-56133917 CTATAAAATCAGTCTTGAGATGG - Intergenic
1042261054 8:66859558-66859580 CACAAAAATAAGTCTTCTGAAGG - Exonic
1042367087 8:67950044-67950066 CTCAACTGTAAGTCTTTAGATGG + Intergenic
1042775834 8:72430071-72430093 ATCAAACATAAGTCTGAAGAAGG + Intergenic
1045832576 8:106481627-106481649 CTCAAATTTAGTTTTTGAGAAGG + Intronic
1046094994 8:109547147-109547169 TTCAAATACAAGTCTTTATATGG + Intronic
1046568351 8:115930399-115930421 CTCAAAGAACAGACTTGAGAAGG - Intergenic
1048123329 8:131606097-131606119 TTAAAATTTAATTCTTGAGATGG - Intergenic
1048436331 8:134421991-134422013 TTCAAATTTAAGTTTTGGGAAGG - Intergenic
1048638393 8:136325317-136325339 CTCAAATATGATTCTGGATAGGG + Intergenic
1050185585 9:2969405-2969427 CTAAAATATCAATATTGAGAAGG - Intergenic
1050380708 9:5025391-5025413 CTCAAATATAAATCTTGTCTGGG + Intronic
1053100695 9:35369925-35369947 CCCAAAGATAAGTCTTGCCAAGG - Intronic
1056357388 9:85815332-85815354 GTAAGATATAAGTCTTGATAAGG + Intergenic
1056739366 9:89240557-89240579 CTCAAAAATAAATTTTAAGAGGG + Intergenic
1058076299 9:100655319-100655341 CTCAGATATAAGGGTTGGGAGGG + Intergenic
1058365539 9:104204320-104204342 CTACAATAGAAGTCTTGTGAAGG + Intergenic
1060425689 9:123503568-123503590 CTCACATATCAGCATTGAGAAGG + Intronic
1060626394 9:125116351-125116373 CTCAAATACAAGCCCTGTGAGGG - Intronic
1061694108 9:132358255-132358277 CTCAAAAAAAAGCCTTGAGCAGG - Intergenic
1187183021 X:16960758-16960780 CTCATTTATTAGTCTTAAGAGGG - Intronic
1188635051 X:32419428-32419450 TTTAAATATAACTCTTGTGAGGG + Intronic
1191063340 X:56321294-56321316 CACAAAGATATGTCCTGAGAAGG + Intergenic
1193041186 X:77005521-77005543 CTTAAATATAGGTTTTGAGATGG - Intergenic
1198607721 X:138361115-138361137 CTTAAAAATAACTCTTGAAATGG - Intergenic
1199778244 X:151034461-151034483 CTAAAATATATGTCTTGAATTGG + Intergenic
1200909710 Y:8519717-8519739 CTGAAATATGAATCTTGAAAAGG + Intergenic
1201610438 Y:15837168-15837190 CTTAAATATGAGTCATGAGAAGG + Intergenic