ID: 978843040

View in Genome Browser
Species Human (GRCh38)
Location 4:113237099-113237121
Sequence TTTGGTGTCGTCTTTCCTAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978843040_978843044 29 Left 978843040 4:113237099-113237121 CCGCTAGGAAAGACGACACCAAA 0: 1
1: 0
2: 1
3: 15
4: 90
Right 978843044 4:113237151-113237173 CAATGCTGACGTACAATCCAAGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978843040 Original CRISPR TTTGGTGTCGTCTTTCCTAG CGG (reversed) Exonic
902684182 1:18065081-18065103 TTTGGTGACTTCTTTCCTGGTGG + Intergenic
907845355 1:58200938-58200960 CTTGGTTTCATCTTTACTAGAGG + Intronic
907912641 1:58840300-58840322 TTTGGGGTGGTATTTCCCAGTGG - Intergenic
908957361 1:69649608-69649630 TTTGTTGACATCTTTCCTAGAGG - Intronic
909466573 1:75980109-75980131 TTGGCTGTCTTCTTTCCTGGTGG - Intergenic
910044412 1:82894275-82894297 TTTGGTGTGGTATATCCTGGGGG + Intergenic
915860529 1:159439658-159439680 TCTGGTGATGTATTTCCTAGTGG - Intergenic
916655527 1:166872248-166872270 TTTGGTGTTATCTTTCCTGGTGG + Intronic
918754099 1:188314276-188314298 TTTGATGTCTTTTTTCCTTGGGG - Intergenic
920863858 1:209735079-209735101 CTAGGTGTCTTCTTTCCCAGAGG - Intergenic
921140927 1:212305438-212305460 TGTGGTCTGGTCTTTCCTGGTGG + Intronic
921277598 1:213535331-213535353 TTTGGTGTTGAGTTTCCTAGTGG + Intergenic
921375463 1:214469102-214469124 TTAGGTGTAGCCTTTCCTAAAGG - Intronic
922755711 1:228095756-228095778 TTTGGTGTCTTCATTGGTAGTGG + Intronic
1066444891 10:35473284-35473306 TGTGGTGTCGTCTTTTCTCAGGG + Intronic
1070023879 10:72612843-72612865 TTTTGTGTTGTCTTTACCAGTGG - Intronic
1073510766 10:104041116-104041138 TTGGGGGTTCTCTTTCCTAGGGG - Exonic
1073631363 10:105153169-105153191 TTTAGTTTTGCCTTTCCTAGAGG + Intronic
1080580504 11:33638904-33638926 TTTTGTGTCTTCTTTCATTGAGG + Intronic
1084035209 11:66505456-66505478 TTTGGTGTCTTCATTCATAAAGG + Intronic
1085367333 11:75962044-75962066 TTTTGAGTTGTTTTTCCTAGTGG + Intronic
1085872604 11:80368275-80368297 TTTAGTTTTGTTTTTCCTAGGGG - Intergenic
1088987869 11:114925960-114925982 TTTGGTGGTGTCCTTCCTTGTGG - Intergenic
1089704579 11:120268750-120268772 TTAGGTGTCATCTCTCCTGGAGG + Intronic
1090808100 11:130215467-130215489 TTTGGTCTCATCATTCTTAGTGG - Intergenic
1092313488 12:7383820-7383842 TTTGGGGTTGGCTTTCATAGAGG - Intronic
1098089650 12:66887548-66887570 TTTTGTGTTTTCTTTTCTAGAGG + Intergenic
1098420193 12:70288090-70288112 TTTGCTGTCCTCTTTACTAAGGG + Intronic
1102761224 12:115387042-115387064 TCTGCTTTCTTCTTTCCTAGAGG - Intergenic
1125181062 15:36881100-36881122 TTTGGGGGCGTCTTTCCTTAGGG + Intergenic
1136370089 16:29830811-29830833 TTTGGTGTCCTCTTTGGTAGTGG + Intronic
1137418300 16:48306579-48306601 TTGGGTGTAGTCTTTACTAGAGG + Intronic
1145247413 17:21278659-21278681 TCTGGTGTCATCCTTCCTGGTGG + Intergenic
1148626509 17:49073468-49073490 TTTGGTTTCTTCTTTATTAGCGG + Intergenic
1149406495 17:56357142-56357164 TTAGGTGTCATGTTTCCTGGAGG - Intronic
1150849896 17:68694663-68694685 TATGTTGGTGTCTTTCCTAGTGG - Intergenic
1157662364 18:49456963-49456985 TTTGGTATCCTGTTTCCTAGTGG - Intronic
1159477459 18:68941911-68941933 TTTGGTTTCTTTTTTCCCAGTGG + Intronic
1163080905 19:14941485-14941507 TTTGGTTTCCTCTTTCCATGGGG - Exonic
926043043 2:9690206-9690228 GTTGGTGAGGTCTTTCCTGGTGG + Intergenic
927236656 2:20881078-20881100 TTTGTGCTCATCTTTCCTAGAGG - Intergenic
939679748 2:145115818-145115840 TTTGGTTTCATCTTTCTGAGAGG - Intergenic
943069959 2:183128935-183128957 TTTAGGGTTATCTTTCCTAGTGG - Intronic
943459455 2:188153434-188153456 TTTAGTTTCTTCTTTACTAGTGG - Intergenic
947755332 2:232559486-232559508 TTTGTTGTAGTATTTCCTACTGG - Intronic
1169654895 20:7912001-7912023 ATTGGTGTTGTTTGTCCTAGTGG - Intronic
1172337001 20:34125132-34125154 TTTGATGCTGTCTTTCCTGGTGG - Intergenic
1177802609 21:25842685-25842707 TTTGGTGTCCTTTTTCCAGGGGG + Intergenic
1185235060 22:49707421-49707443 TTTGGTGTCATCTATCCTAGCGG - Intergenic
949112433 3:278272-278294 TTTGGGGTCGGTTTTCCTTGTGG + Intronic
951803271 3:26620902-26620924 TTTGGTGTCGTTTTTCTGAAGGG - Intergenic
958146088 3:89627394-89627416 TTTGGTGTTGTCATTGTTAGAGG - Intergenic
963977887 3:151503248-151503270 CTTGGTGTCTTATTTCCTAGTGG - Intergenic
966274341 3:178146669-178146691 ATTGGTGTCTGCTCTCCTAGAGG - Intergenic
968944603 4:3657021-3657043 TTTTGTGTCTTCTTTCCTCTGGG - Intergenic
969893938 4:10285430-10285452 TAGGGAGTAGTCTTTCCTAGAGG - Intergenic
970692328 4:18633687-18633709 AGTGGTGTCTTCTTCCCTAGCGG - Intergenic
971088857 4:23315805-23315827 TTTTGAGTCCTCTTTCTTAGAGG + Intergenic
976230168 4:82834458-82834480 TTTGGTGTCATTTTACCAAGGGG - Intronic
976404155 4:84643096-84643118 TTTGGAGGCTTCTTTGCTAGTGG + Exonic
978402402 4:108344504-108344526 TTTGGTGAGGGCTTTCCCAGAGG - Intergenic
978843040 4:113237099-113237121 TTTGGTGTCGTCTTTCCTAGCGG - Exonic
980496461 4:133591794-133591816 ATTTGTTTCTTCTTTCCTAGAGG + Intergenic
981363285 4:143871956-143871978 TTTGGTGTCCCCTTGCCTAGGGG - Exonic
981374020 4:143992757-143992779 TTTGGTGTCCCCTTGCCTAGGGG - Intergenic
981383114 4:144096013-144096035 TTTGGTGTCCCCTTGCCTAGGGG - Intergenic
985424573 4:189816848-189816870 TTTGGTGTCCTCTTTAATAAGGG + Intergenic
986734555 5:10659300-10659322 TTTGGTGTCATTTTTGCTGGAGG + Intergenic
988347039 5:30050518-30050540 TTTGGAGTCTTTTTTCCAAGTGG + Intergenic
989432357 5:41370760-41370782 TTTGTTGTCCTCTTTCACAGAGG - Intronic
991478371 5:67048631-67048653 TTTGAGGTCATCTTTCCTTGGGG + Intronic
992625858 5:78635347-78635369 GTTGGGGGCGTCTTTCCCAGAGG - Intronic
997495991 5:134326429-134326451 TTTGTTTTCGTTTTTCCTATTGG - Intronic
1000233578 5:159337213-159337235 TTAGGTGTGGTATTTCCTGGAGG + Intergenic
1000682914 5:164208904-164208926 TTTGGTGGTGTGTTACCTAGTGG - Intergenic
1004732673 6:18373471-18373493 TTTGCTGTGGTCTCTTCTAGTGG + Intergenic
1005421452 6:25655519-25655541 TTTGCTGTCCTCTTTCCTCGAGG - Intronic
1007960114 6:45951241-45951263 TTGGGTCTCCTCTTTCCCAGGGG - Intronic
1019180771 6:170186316-170186338 TGAGGTGTCGCCTTCCCTAGTGG - Intergenic
1022296786 7:29063088-29063110 CTTGGTGTCCTCCTTCCCAGTGG + Intronic
1029846927 7:103421412-103421434 TTGTGTGTAGTCTTTCCTGGAGG + Exonic
1031235394 7:119169031-119169053 TTTGGTTTCCTTTTTCCCAGGGG + Intergenic
1031406659 7:121395688-121395710 TTTAGTGTCGCCTATACTAGAGG - Intronic
1031952545 7:127907191-127907213 TTTGGTGCCCTCTTTAATAGAGG + Intronic
1036285034 8:7436750-7436772 TTTGGTGTGGGGTTTCCCAGTGG + Intergenic
1036336441 8:7874779-7874801 TTTGGTGTGGGGTTTCCCAGTGG - Intergenic
1037417396 8:18666833-18666855 ATTGGTGTCCTCTTTGATAGTGG - Intronic
1037932785 8:22892429-22892451 TTTGGTGGCTTCATTCCTGGTGG + Intronic
1038683966 8:29698337-29698359 TTTGGTTTGGTCTTTCTTTGAGG - Intergenic
1038937600 8:32269445-32269467 ATTGGTGACGTCTTTCCCAGAGG + Intronic
1039876273 8:41589300-41589322 TTTGGTGTTCTCTGTCCTGGAGG + Intronic
1040653862 8:49481602-49481624 TTTTGTGAGGTCTTTCTTAGTGG - Intergenic
1044843070 8:96354587-96354609 TTGGGTGTGGTCTTGCTTAGAGG - Intergenic
1047775792 8:128069382-128069404 TTTCGTGACGTCATTCCTAGTGG - Intergenic
1048837275 8:138532116-138532138 TTTGGAGTCATCTTTTCTACAGG + Intergenic
1048860409 8:138720511-138720533 TCTGGTGCCTTCTGTCCTAGAGG + Intronic
1048868858 8:138780936-138780958 TTTGCTGCCGTCTCTCCCAGGGG + Exonic
1050254161 9:3776793-3776815 TATGGAGTCCTCTTTCCTCGGGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052740269 9:32385366-32385388 TTTGGGGACTTCTGTCCTAGAGG - Intronic
1052778162 9:32754058-32754080 TTCTGTGTCCTCTCTCCTAGGGG - Intergenic
1056809923 9:89756433-89756455 TTTGGTGTTGTCTTCTCTGGAGG + Intergenic
1057320323 9:94006671-94006693 TTCGGTGCCTTCTTTGCTAGTGG - Intergenic
1057320685 9:94009982-94010004 TTTGGTGCCTTCTTTGCTAGTGG - Intergenic
1058620916 9:106881789-106881811 TTTGGAGTCATGTTTCATAGGGG - Intronic
1061067226 9:128286072-128286094 TAGGGTGTCGTCTCGCCTAGGGG + Intronic
1187719528 X:22136753-22136775 TTTGTTGTACTCTTTGCTAGGGG + Intronic