ID: 978850307

View in Genome Browser
Species Human (GRCh38)
Location 4:113327816-113327838
Sequence GGCACTTGACACTTAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978850305_978850307 -7 Left 978850305 4:113327800-113327822 CCTCAGTTCTTAGCAGGGCACTT 0: 1
1: 0
2: 3
3: 8
4: 204
Right 978850307 4:113327816-113327838 GGCACTTGACACTTAATAGGAGG 0: 1
1: 0
2: 1
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978850307 Original CRISPR GGCACTTGACACTTAATAGG AGG Intronic
900572912 1:3368203-3368225 GGCACCTGACATTCATTAGGAGG + Intronic
903705902 1:25285726-25285748 GGGCATTGGCACTTAATAGGAGG + Intronic
903820778 1:26100830-26100852 GGCGCATGAGACTTATTAGGAGG - Intergenic
915041535 1:152971978-152972000 GTCTCTTGACATTTAACAGGGGG - Exonic
915744081 1:158142814-158142836 GGCACTTGCCACTTAAGAGGGGG - Intergenic
923534116 1:234835453-234835475 GTCACTTGACACTTAACTGCTGG + Intergenic
1070791494 10:79192165-79192187 GGCACATGGCACTTTAGAGGAGG - Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084587021 11:70068236-70068258 GACACTTGCCTCTTAACAGGAGG - Intergenic
1088183984 11:107143101-107143123 GGCACTTCACACTGACTTGGAGG - Intergenic
1088334381 11:108687228-108687250 GTCACTTCACACTTATTAGATGG - Intronic
1088949847 11:114556616-114556638 GGAATTTGACACTTAAAAGTAGG - Intronic
1089367557 11:117930595-117930617 GGCACTTTTCACTTTCTAGGAGG - Intergenic
1089711773 11:120320219-120320241 GTCATTTGAAACTTAAGAGGTGG + Intergenic
1089745997 11:120617261-120617283 GGTACCTGGCACTTAGTAGGTGG + Intronic
1090616013 11:128515882-128515904 GTCACTTGACACTTCAAATGTGG - Intronic
1093492185 12:19717670-19717692 TACATTTGACACTTAGTAGGGGG - Intronic
1108338653 13:49473891-49473913 GGAACTTGACACCTAATAATAGG + Intronic
1109328326 13:60897636-60897658 GTCACTAGACACTTTAAAGGGGG - Intergenic
1114623935 14:24116127-24116149 GGCAGTTGACACATGATATGAGG + Intronic
1119973710 14:79001784-79001806 GGCATTTGTCAATTAATAGAAGG + Intronic
1133459203 16:5972421-5972443 GGCACTGGACACATAATGAGAGG - Intergenic
1144350011 17:14386055-14386077 GGCACTTGAGACCTTGTAGGCGG + Intergenic
1149896344 17:60431483-60431505 GGCACCTGCCACTTAGAAGGTGG - Intergenic
1150159083 17:62879182-62879204 GGCACTTGACACCCACTAGACGG + Intergenic
1160424799 18:78772572-78772594 GGCACATGACAGTTAATACAGGG + Intergenic
1161979857 19:7624732-7624754 AGCACTTGGCACCCAATAGGTGG + Intronic
936151556 2:110024784-110024806 GGTACTGGACACTTTGTAGGGGG + Intergenic
936193118 2:110346585-110346607 GGTACTGGACACTTTGTAGGGGG - Intergenic
936755051 2:115698121-115698143 AGCTATTGAGACTTAATAGGTGG - Intronic
937837539 2:126487521-126487543 GGCATTTGACAGTTCATAAGTGG - Intergenic
937987061 2:127642680-127642702 GGCACTTGAGACTCAGGAGGCGG - Intronic
939454260 2:142413031-142413053 GGTACTTTCCACTAAATAGGTGG - Intergenic
941793797 2:169578722-169578744 AGCACTTGGCACTTAACAGATGG + Intergenic
944337555 2:198554946-198554968 AGGAATTGATACTTAATAGGTGG - Intronic
947718613 2:232354171-232354193 GGCACCTGTCACCTAATAGGAGG + Intergenic
1170451069 20:16484377-16484399 GGGACTTGATAATTAACAGGGGG - Intronic
1183719086 22:39551785-39551807 GACACGTGGCACTTAGTAGGTGG + Intergenic
950350439 3:12345678-12345700 GGCTCACGAAACTTAATAGGAGG - Intronic
956761924 3:72451236-72451258 GGCACTTGATATATACTAGGTGG - Intergenic
966582037 3:181578672-181578694 GGCATGTGATACTTAATAGCTGG + Intergenic
970181003 4:13393936-13393958 AGTACTTGACATATAATAGGTGG - Intronic
977305566 4:95319285-95319307 TGCACTTGACAGTTACCAGGGGG - Intronic
978850307 4:113327816-113327838 GGCACTTGACACTTAATAGGAGG + Intronic
990161707 5:52948071-52948093 GTTACTTGACACAAAATAGGTGG - Intronic
992526757 5:77619289-77619311 GGTACCTGACACTTATTAGATGG - Intronic
1004895298 6:20142254-20142276 AGTTCTTGACACTTAATAGGTGG - Intronic
1009005257 6:57778317-57778339 GGCACTTGTCACTTTATTAGTGG + Intergenic
1011659334 6:89580860-89580882 GGAAATTGACACTTACAAGGTGG + Intronic
1014260200 6:119207741-119207763 GGCATTTGACACTCAAATGGGGG + Intronic
1014718159 6:124889671-124889693 GGCACTGGACACTTGAAATGTGG + Intergenic
1016324922 6:142889865-142889887 GGCTCTTGACACTTGAAATGTGG + Intronic
1022556700 7:31305412-31305434 GTGACTAGACACTTAACAGGTGG + Intergenic
1025028644 7:55537880-55537902 GCCACTTGGCACTTAGTAAGTGG - Intronic
1027435748 7:78162813-78162835 GGCCCTTGACACTTAAAAACTGG + Intronic
1032440892 7:131942160-131942182 GCCATTTTACACTTACTAGGGGG + Intergenic
1037804685 8:22052573-22052595 GGCACTTGAAATTTAATTGGAGG + Intronic
1047689381 8:127335804-127335826 GTCATTTCACACTTAACAGGAGG + Intergenic
1055587580 9:77771497-77771519 AGCACGTGATACTTAACAGGAGG - Intronic
1189259408 X:39667710-39667732 GACTCCTGACACTTAACAGGGGG + Intergenic
1190285694 X:48959781-48959803 TGCTCATGAGACTTAATAGGAGG + Intergenic
1192638553 X:72843320-72843342 AGAACCTGACACTTCATAGGAGG + Intronic
1192643161 X:72877488-72877510 AGAACCTGACACTTCATAGGAGG - Intronic
1194731586 X:97461732-97461754 GGCTCTTGAAGCTTATTAGGTGG - Intronic
1199834421 X:151574420-151574442 GGCACTTGTCACTTTCTAAGAGG - Intronic