ID: 978850666

View in Genome Browser
Species Human (GRCh38)
Location 4:113332107-113332129
Sequence CAGAAGAAGGAGAAGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1247
Summary {0: 1, 1: 0, 2: 7, 3: 120, 4: 1119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978850666 Original CRISPR CAGAAGAAGGAGAAGAATGG GGG (reversed) Intronic
900628278 1:3619625-3619647 AAGATGAAGGGGAAGCATGGCGG - Intergenic
900719561 1:4166569-4166591 CTGGAGAAGGAGCAGAGTGGAGG - Intergenic
901270607 1:7950586-7950608 GAGAAGATGGAGAATAATGGTGG - Intergenic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
902112955 1:14098551-14098573 CAGAAATATAAGAAGAATGGAGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903052365 1:20611299-20611321 CAGAAGAGTAAGAAGGATGGTGG + Intronic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
903467447 1:23561753-23561775 TAGAGGAAGGAAAAGAAGGGAGG - Intergenic
903769959 1:25757530-25757552 GAAAAGAAGGTGCAGAATGGGGG - Intronic
903818731 1:26084589-26084611 CAGAAGAAAGATCAGACTGGAGG + Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904311203 1:29630732-29630754 AAGAAGGAAGAGAAGAAGGGGGG - Intergenic
904409391 1:30315921-30315943 CAGAAGGGGGAGGAGAAGGGAGG - Intergenic
904413734 1:30342322-30342344 CAGAAGACGGTGAAGAAGTGAGG - Intergenic
904496822 1:30891865-30891887 AAGAGGAAGAAGAAGAAGGGAGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904580187 1:31537477-31537499 TAGAAGCAAGAGTAGAATGGTGG + Intergenic
904644810 1:31957743-31957765 GAGAAGGAGGAGAAGAACCGGGG - Intergenic
904896963 1:33824743-33824765 CAGAAGGATGAGAAGAACGATGG + Intronic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
905939139 1:41848997-41849019 CTGAAGAATGGGAAGAAAGGAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180853 1:43817622-43817644 GAGAAGGAGGAGGAGAAGGGAGG - Intronic
906626780 1:47332132-47332154 CAAAAGAAAAAGGAGAATGGGGG + Intergenic
906642983 1:47452588-47452610 CAGAGGCGGGAGAAGAAGGGAGG + Intergenic
906687549 1:47772243-47772265 CAGAAAAAGGGACAGAATGGAGG + Intronic
906860004 1:49349417-49349439 GAGAAGGAGGAGAACAAGGGAGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907564257 1:55419993-55420015 TAAAAGAAAAAGAAGAATGGGGG + Intergenic
907697817 1:56751682-56751704 GAGAAGGAACAGAAGAATGGTGG - Intronic
907741788 1:57173239-57173261 CAGATGAGGGAGAAAAATGGAGG + Intronic
907771482 1:57469397-57469419 CAGAAAAAGGAGAAAAAAGTTGG + Intronic
907886738 1:58598989-58599011 AAAAAGAAAGAAAAGAATGGTGG - Intergenic
907933992 1:59025728-59025750 CATGTGAAGGAGAGGAATGGAGG - Intergenic
909172120 1:72310452-72310474 AAGGAGAAGGAGCAGAATGAGGG - Intergenic
909521488 1:76573650-76573672 AAAAAAAAGGAGAAGAAAGGGGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910275696 1:85446814-85446836 GAGAAGGAGAAGAAGAAAGGAGG - Intronic
910462153 1:87459106-87459128 CAGAGGAAAGAGAAAAATTGAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910774852 1:90864516-90864538 TAGAAGAAGAAGAAGAAAGAAGG - Intergenic
911231826 1:95369997-95370019 AAGAACAAGGCAAAGAATGGTGG - Intergenic
911245777 1:95515459-95515481 TAGAAAAAGGAGTAAAATGGTGG - Intergenic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911544440 1:99199837-99199859 CAGAAGAGGATGAGGAATGGTGG + Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
911783194 1:101910042-101910064 AAGCAGGAGGAGGAGAATGGAGG - Intronic
911820160 1:102408870-102408892 AAGAAGAGGGAGAGAAATGGAGG - Intergenic
912002506 1:104852510-104852532 CAGAAGAATAAGAAAAAAGGGGG - Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912616805 1:111110167-111110189 CAAAGGAAGGTGAAGCATGGAGG + Intergenic
912799786 1:112713744-112713766 CAGAGGGAGGAGGAGAAGGGAGG + Intronic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913665209 1:121041956-121041978 TAGAGGATGGAGTAGAATGGAGG + Intergenic
913983673 1:143546097-143546119 GAGCAGAAGATGAAGAATGGAGG + Intergenic
914016602 1:143825225-143825247 TAGAGGATGGAGTAGAATGGAGG + Intergenic
914161182 1:145135786-145135808 TAGAGGATGGAGTAGAATGGAGG - Intergenic
914362276 1:146945107-146945129 AAGAAGAAAGGAAAGAATGGAGG - Intronic
914489399 1:148141971-148141993 AAGAAGAAAGGAAAGAATGGAGG + Intronic
914655216 1:149733766-149733788 TAGAGGATGGAGTAGAATGGAGG + Intergenic
914857188 1:151361238-151361260 CAGAAGACTGAAAAGAATGTAGG + Intergenic
914858390 1:151368378-151368400 TAGAAGTAGGGGAAGTATGGAGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
916037764 1:160936164-160936186 AAGAAGAAGAAGAAGAAAAGAGG - Intergenic
916206203 1:162318638-162318660 AAGAAGAAGAAGAAGAAAGGGGG - Intronic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916618877 1:166473829-166473851 CAGAAGAAGGCAAAAAATGTAGG - Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916882338 1:169032051-169032073 GAGAAGAAGAAGAAGAAAGAAGG - Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917779033 1:178371566-178371588 GAGGAGGAGGAGAAGAAAGGAGG + Intronic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918056397 1:181025323-181025345 GAGTAGAAGGAAAAGGATGGGGG + Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918737794 1:188088137-188088159 CAGAAAAAGGGGAAAAATGTTGG - Intergenic
918846387 1:189620235-189620257 AAGGAGAAAGAGAAGAAAGGTGG + Intergenic
919518105 1:198552617-198552639 CATAAACAGGAGTAGAATGGTGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919841110 1:201610045-201610067 CAGAAGAAGGAGCAGAGAGAAGG + Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920185716 1:204158070-204158092 CAGAAGCAGAAGAGGAAGGGTGG - Intronic
920330708 1:205205821-205205843 AAAAAGAAGGTGAAGAATGTTGG + Intronic
920874230 1:209819199-209819221 AAGAAGAAAGGGGAGAATGGGGG + Intergenic
921141025 1:212306338-212306360 GGAAAAAAGGAGAAGAATGGAGG + Intronic
921255048 1:213331509-213331531 GGGATGAAGGAGATGAATGGGGG + Intergenic
921337534 1:214103255-214103277 CCAGAGTAGGAGAAGAATGGAGG + Intergenic
921397054 1:214679617-214679639 GAGAAGAAGAAGAAGAATGGAGG - Intergenic
921442386 1:215202986-215203008 AGGAGGGAGGAGAAGAATGGGGG - Intronic
922040252 1:221889318-221889340 ATGAGGAAGGTGAAGAATGGTGG + Intergenic
922158609 1:223060644-223060666 GAGGAGACGGAGAAGAAAGGAGG - Intergenic
922224790 1:223636930-223636952 CAGAAGTGGGAGAAAAAGGGGGG - Intronic
922389550 1:225125977-225125999 AAGAAGAAGGAGAGAGATGGGGG + Intronic
922412805 1:225392187-225392209 GAGAAGAAAGGGAAGAGTGGAGG - Intronic
922454090 1:225760590-225760612 CAAAAGAAAGAGAAGAAATGTGG - Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923247569 1:232147412-232147434 GGGAAGAAGGAAAAGAATGAAGG + Intergenic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
923432483 1:233936652-233936674 AAGAAGAAGGGGAAGAAAGGAGG - Intronic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
923600134 1:235395525-235395547 AAGAAGAAGAAGTAGAATGATGG - Intronic
923671373 1:236043979-236044001 CAGAAGAATGGTAAAAATGGTGG - Intronic
923792553 1:237124675-237124697 TAGAAGAAGCAGAAGACTTGTGG - Intronic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
923924414 1:238608412-238608434 CAGAAGGGGGACAAGAAGGGAGG + Intergenic
923976888 1:239274034-239274056 GAATAGAAGGACAAGAATGGAGG - Intergenic
924027069 1:239844878-239844900 CAGAAGAAGTAGAGGGGTGGAGG + Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924066569 1:240229323-240229345 AGGAAGAGGGGGAAGAATGGTGG - Intronic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924448774 1:244159015-244159037 GAGAAGGAGAAGAAGAAGGGTGG - Intergenic
924806444 1:247365456-247365478 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
924806990 1:247369454-247369476 CAGCAGAAGGGGAAGAATTTGGG - Intergenic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063210025 10:3871974-3871996 CAGAGGAGAGAGAGGAATGGGGG - Intergenic
1063931285 10:11030759-11030781 CAGAACAAGTAGAAGATTGCTGG - Intronic
1064121756 10:12625018-12625040 CGAAAGAAGAAGAAGAAAGGAGG - Intronic
1064305130 10:14158642-14158664 GAGAAGGAGGAGGAGAAGGGGGG + Intronic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064829763 10:19449676-19449698 AAGAACAAAGAGAAGATTGGAGG + Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065053857 10:21823024-21823046 CAGAAAAGGGATAAGAATGCAGG + Intronic
1065623822 10:27610644-27610666 GGGAAGAAGGAGAAGAAAGAAGG - Intergenic
1065866467 10:29919286-29919308 GAGGAGAAGGAGAAGAAAGCAGG - Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1066057163 10:31692681-31692703 TAGAAGAAAGAGAGGGATGGGGG + Intergenic
1066335415 10:34472618-34472640 CAGAAGAGGGAGAGAAATGGAGG - Intronic
1066434799 10:35387466-35387488 CAGATGTGGGAGAAGGATGGTGG + Intronic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1067337511 10:45377328-45377350 CAGAAGAGGGGGCAGAATGTAGG - Intronic
1067513825 10:46919465-46919487 AAGAAGGAGAAGAAGCATGGAGG - Intronic
1067648429 10:48132369-48132391 AAGAAGGAGAAGAAGCATGGAGG + Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1067919882 10:50443425-50443447 GAGAAGAAGAAGAGGAATGATGG + Intronic
1068292733 10:55025546-55025568 CAGAAGAATTATAAGAATGTAGG - Intronic
1068576879 10:58694114-58694136 CAGGAGAAGGAGATGATTGTGGG - Intronic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1069078290 10:64061800-64061822 AAGAAGTAGCTGAAGAATGGGGG + Intergenic
1069304769 10:66955716-66955738 CAGAAGAGGAAGAACAATGGAGG - Intronic
1069373033 10:67767147-67767169 AAGGAGAAGGAGGAGAAGGGTGG - Intergenic
1069533137 10:69233586-69233608 CAGGAGGAGGATTAGAATGGGGG + Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1070312490 10:75283723-75283745 GAGGAGGAGGAGAAGAAAGGAGG + Intergenic
1070781280 10:79138662-79138684 AAGAAGAGGGAGAGGCATGGAGG - Intronic
1070924517 10:80210015-80210037 CAGAAGAAGGTCAGGAGTGGGGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071347928 10:84711015-84711037 AGGAAGAAGAAGAAGAATGAGGG - Intergenic
1071763873 10:88639761-88639783 CAGGAGAGGGAGCAAAATGGGGG + Intergenic
1072494277 10:95940142-95940164 AAGAAGAAAGAGAAGAGGGGAGG + Intergenic
1072806640 10:98427591-98427613 CAGAACAAGGAGGGGATTGGGGG - Intronic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073441404 10:103555035-103555057 CATAAGGAGGAGGAGACTGGAGG - Intronic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1073866406 10:107809444-107809466 AAGAAGAAAGAAAAGAAAGGGGG + Intergenic
1074037949 10:109759866-109759888 CAGAAGTAAGAGATGAATAGGGG - Intergenic
1074134919 10:110617980-110618002 CTGAAGAAGGACAGGAATGAGGG - Intergenic
1074281557 10:112056467-112056489 CAGAAGAACAAGATGAAAGGAGG + Intergenic
1074737012 10:116445957-116445979 GGGAAGAAGGAGAAGAATGAAGG + Intronic
1074738024 10:116456149-116456171 TAGACGTAGGAGTAGAATGGTGG + Intronic
1074960117 10:118437049-118437071 CAGAAGAAGCAGCAGTTTGGGGG - Intergenic
1076044510 10:127280715-127280737 CAGAACACAGTGAAGAATGGTGG - Intronic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1076414594 10:130276828-130276850 AAGAACAAAGAGAAGATTGGGGG - Intergenic
1076897906 10:133323139-133323161 AGGAAGCAGGAGAAGGATGGAGG - Intronic
1077304803 11:1864277-1864299 CCGACGAAGGAGAAGAACAGAGG + Intronic
1077531341 11:3097045-3097067 CAGGAGAAGGAGAGGAAAGGGGG + Intronic
1077724965 11:4665542-4665564 CAGAAGAAGGAGGAAAAATGTGG + Intergenic
1077822068 11:5755506-5755528 GAAAAGAAGGAGAAGAAAGCTGG - Exonic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079319053 11:19435257-19435279 TAGAAGAAAGAGTAAAATGGTGG - Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079923404 11:26460402-26460424 AAGAAAAAGAAGAAGAAAGGGGG + Intronic
1080905483 11:36540732-36540754 AAGAACAAAGAGAAGATTGGAGG - Intronic
1080946179 11:36978109-36978131 CAGGAGGAGGAGAAGAGTTGCGG + Intergenic
1081040573 11:38205370-38205392 AAAAAGAAGAAGAAGAATAGAGG + Intergenic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1081347357 11:42006617-42006639 TAGAAGTAGGAGTAGAATAGTGG - Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1081390936 11:42527846-42527868 CAGAAAAAGGAGAAAATTAGGGG + Intergenic
1081563859 11:44244089-44244111 GAGCAGAATGAGAAGGATGGGGG - Intronic
1081606272 11:44529046-44529068 CAGAAGGAGGGCAAGAGTGGTGG - Intergenic
1081761499 11:45579599-45579621 GAGAAGGAGGAGAAGAAGGAAGG - Intergenic
1083091652 11:60206093-60206115 AAGCAGAAGGAAAAGGATGGGGG + Intronic
1083139780 11:60712400-60712422 GAGAGGAAGGAGAAGAAAAGGGG + Intronic
1083205172 11:61144452-61144474 CAGAAGCAGGAGGAGAACGCAGG + Intronic
1083295690 11:61714291-61714313 CAGAGGCAGGAGTAAAATGGGGG + Intronic
1084309238 11:68306874-68306896 CAGAAGGAGGAGAGAAGTGGAGG + Intergenic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1084975973 11:72798549-72798571 CAGGAGAAGGGGTAGAAAGGCGG - Intergenic
1085036988 11:73306733-73306755 GAGGAGAAGGAGGAGACTGGGGG + Intergenic
1085596910 11:77819779-77819801 GAGAGGAAGGAGAACTATGGAGG + Intronic
1085657853 11:78333038-78333060 CAGAAGGAGGAGGATAATGCTGG + Intronic
1085668556 11:78439455-78439477 CAGAACAAAGAAAAGAAAGGGGG + Intronic
1085672898 11:78485693-78485715 CAGAAGAGAGAAAAGACTGGGGG - Intronic
1085688765 11:78648970-78648992 CAGAAAGAGGAGAAAAAAGGAGG + Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086056116 11:82649065-82649087 AAGAAGGAGCAGAAGAAAGGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086546425 11:87972969-87972991 CAGAAGGAAGAGAGGAAAGGGGG - Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086788173 11:90998880-90998902 CAGAAGGAAGAGAAAAATGCAGG + Intergenic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1087507303 11:99042348-99042370 AAAAAGAAGAAGAAGAAGGGAGG - Intronic
1087641904 11:100764002-100764024 AAGAAGAAGAAGAAGAAGAGGGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088348659 11:108860015-108860037 AACAAGAAGAAGAAGAAAGGAGG - Intronic
1088565921 11:111173013-111173035 AAGAAGAAGGAGAAGTACAGTGG + Intergenic
1088851625 11:113707853-113707875 TAGAAGAAGGAGAGAAATGGTGG + Intergenic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089340383 11:117753338-117753360 CAAAGGGAGGAGAAGAATGCGGG - Intronic
1089542088 11:119195423-119195445 CAGAAGAAGAAAAAGAACTGGGG - Exonic
1089597615 11:119591133-119591155 GAGAAGAAGGAAGAGAATGGGGG + Intergenic
1089723380 11:120450883-120450905 GAAAAGAAGGAGAGGAATGGTGG - Intronic
1089798373 11:121002376-121002398 CAAGAGAAGAAGAAGAAGGGAGG + Intergenic
1090393132 11:126402468-126402490 AAGAAGAAGAAGAAGAACTGAGG + Intronic
1090527330 11:127551517-127551539 TAGAAGAAGAAAAACAATGGAGG - Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092111906 12:5970178-5970200 CAGAGGAGGGAGAAGTCTGGAGG - Intronic
1092231515 12:6778189-6778211 CGGAAGGAGGAGAAGGATGAAGG - Intronic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1092447574 12:8571690-8571712 AAGAAGAAGAAGAAGAATAGTGG - Intergenic
1092955873 12:13549303-13549325 CTGAAGAAAGGGAAGCATGGGGG - Exonic
1093219428 12:16401137-16401159 AAGAAGAAAGTGAAGAATGTGGG - Intronic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1093661169 12:21758605-21758627 GAGCAGCAGGAGAAGTATGGTGG - Intergenic
1094019666 12:25900907-25900929 GAAAGGAAGGAGAAGAATGGCGG + Intergenic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1094788075 12:33874483-33874505 GAGAAAGAGTAGAAGAATGGGGG - Intergenic
1095207227 12:39452465-39452487 CAGATGGAGGAAAAGAATGGTGG - Intergenic
1095337715 12:41048710-41048732 AAGAAGAAGGAAAAAAATGAAGG + Intronic
1095399845 12:41801408-41801430 CAGATGAAAGAGAAGAATGATGG + Intergenic
1095432188 12:42145552-42145574 AAGAAGAGGGAGAAGAACTGGGG - Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095787743 12:46128703-46128725 TATAAGAGGTAGAAGAATGGAGG - Intergenic
1096320584 12:50609041-50609063 CTGAAGCAGGAGAATCATGGAGG + Intronic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096889268 12:54750336-54750358 AAGAAGAAGAAGAAGAAAGTAGG - Intergenic
1097725042 12:63065842-63065864 CACAAGAATGAGAAGAAATGAGG + Intergenic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1098032264 12:66267011-66267033 CAGCAGAAGGGGAAGAATCAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098370312 12:69752235-69752257 CAGAAGCAGGAGGACAATTGTGG - Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099517028 12:83609787-83609809 CAGAAGACGGAAATCAATGGAGG - Intergenic
1100069222 12:90690987-90691009 CAGGAGAGGGAGAGGAATAGGGG - Intergenic
1100093057 12:90995455-90995477 AAGAAGCAGAAAAAGAATGGGGG + Intronic
1100100526 12:91098594-91098616 AAGCAGAAAGAGTAGAATGGTGG + Intergenic
1100118132 12:91334626-91334648 GAGGAGAGGGAGAAGAAGGGAGG + Intergenic
1100330737 12:93579540-93579562 CAGCAGAAGCAAAGGAATGGAGG - Intronic
1100535491 12:95505009-95505031 CAGATGAGGGAGGAGGATGGTGG - Intronic
1100574211 12:95874495-95874517 GAGAAGAATGAGATGAATGAAGG + Intronic
1100726505 12:97414525-97414547 AGGAAGAAAGGGAAGAATGGAGG - Intergenic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1101119426 12:101563944-101563966 CAGAAGAGGGAGCAGATTTGGGG - Intergenic
1102194436 12:111014534-111014556 AAGAAGAAGAAGAAGAAAGGGGG + Intergenic
1102230098 12:111256436-111256458 CAGAAGAAGCTGAAGACTGGTGG - Intronic
1102474680 12:113180943-113180965 AAGAAGAAGAAGAAGTCTGGAGG - Exonic
1102531113 12:113547270-113547292 GAGGAGGAGGAGAAGAATGGAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102808078 12:115799650-115799672 CAAAAAAAGAAGAAGAAGGGGGG + Intergenic
1103180549 12:118907521-118907543 GAGAAGAAGGAGAAGAGAAGAGG + Intergenic
1103743293 12:123105819-123105841 AGGAAGAAGGAAAAGAAAGGTGG + Intronic
1103787214 12:123441891-123441913 CAGATGAAAGTGAAGAATGGGGG + Intergenic
1104395433 12:128428342-128428364 CAGGAGAAGGAGAACAATGTGGG - Intronic
1104477894 12:129085216-129085238 CAGTAGAAGGGGAAGAAGAGGGG - Intronic
1104520618 12:129471490-129471512 GAGGAGAGGGAGAAGGATGGAGG - Intronic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1105614411 13:21999361-21999383 CAGGAGAGGCAGGAGAATGGTGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106258286 13:28041300-28041322 CTGAAAAAGGAGAAGAGAGGAGG + Intronic
1106339001 13:28810254-28810276 CAGAAGAAAGAGAGGTATGGGGG - Intergenic
1107143712 13:37034072-37034094 GAGAAGAAGGAGAAAGATAGGGG - Intronic
1107526788 13:41240572-41240594 CTGAAGAAGAAGAAGAAAAGAGG + Intronic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1107897119 13:44976296-44976318 AAGGAGAAGGAGAAGAAAGGAGG + Intronic
1107897122 13:44976312-44976334 AAGGAGGAGGAGAAGAAAGGAGG + Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1109140242 13:58705647-58705669 AAAAAGAAGGAGAGGAAGGGAGG - Intergenic
1109269537 13:60238916-60238938 CAGAAGCAAAACAAGAATGGTGG - Intergenic
1110149901 13:72238854-72238876 GAGAAGAATGAGAAGAATAAAGG + Intergenic
1110390996 13:74973852-74973874 AAGAGGAAGGAGAAGATTTGAGG + Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110724107 13:78799763-78799785 CAGAAGAAGGAGTGAGATGGCGG + Intergenic
1110841733 13:80151882-80151904 TGGAAGAAGGAGAAAAATGGGGG + Intergenic
1110945568 13:81411369-81411391 AAGGAGAAGGAGAAGAACGAGGG - Intergenic
1111942349 13:94624100-94624122 CACAAGAAGGTCAAGAAAGGAGG - Intronic
1112235353 13:97630962-97630984 CAGAGGAATGAGAAGAAAAGTGG + Intergenic
1112408946 13:99145752-99145774 AAGAAGAAGAAGAAAAATGCAGG + Intergenic
1112930679 13:104732520-104732542 CAGAAGGAGGAGAAGAAAAGGGG - Intergenic
1113006931 13:105716578-105716600 CTAAAGAAGGTGAAAAATGGGGG - Intergenic
1113161325 13:107384729-107384751 CAAAAGAAGGTGAACCATGGTGG + Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113898838 13:113784548-113784570 AAGAAGAAGGAGGAGAAGGGAGG + Intronic
1114299627 14:21363451-21363473 AAGAAGAAAGTGAAGAATGTGGG - Exonic
1114672185 14:24417213-24417235 CAGGAGAAGGAGTGGAATGTGGG + Exonic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1114999951 14:28410094-28410116 CAGAAGAAAAAAAAGAAAGGAGG + Intergenic
1115154642 14:30323922-30323944 AAGAAGGAGGAGAAGAAGAGGGG + Intergenic
1115275659 14:31606049-31606071 AGGAAGAAGAAGAAGAATGGAGG - Intronic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1116058307 14:39891247-39891269 CTGAGGAAGGAGAACAAAGGTGG + Intergenic
1116070670 14:40040905-40040927 TAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1116584864 14:46690508-46690530 AGGAAAAAGGACAAGAATGGTGG - Intergenic
1117185793 14:53239393-53239415 CAGTAGAAGGGAGAGAATGGAGG - Intergenic
1117634784 14:57730286-57730308 GAGAAGATGGAGAAAGATGGTGG - Intronic
1117657503 14:57971700-57971722 TAGAAGCAGGAGTCGAATGGTGG + Intronic
1117661399 14:58009333-58009355 CAGAGGAAGGAGGAAAAAGGGGG - Intronic
1117852148 14:59985264-59985286 TAGAAGCAGAAGTAGAATGGTGG + Intronic
1118011184 14:61612145-61612167 CAGAAGCAGGAGATGTTTGGTGG - Intronic
1118015097 14:61652545-61652567 AATAAGAAGGAGGAGAATGTGGG - Intronic
1118186373 14:63542546-63542568 CAGAAGGTGGAGAAAAAGGGGGG + Intronic
1118287916 14:64493854-64493876 AAAAAGAAGAAGAAGAATAGGGG + Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1119209292 14:72817962-72817984 CAGAAGAAGGCCAAGCACGGTGG + Intronic
1119335523 14:73830391-73830413 AAGAAGAAGGAGAAGAAATGAGG - Intergenic
1119760340 14:77146341-77146363 GACAGGAAGGAGAAGAAAGGGGG + Intronic
1119947567 14:78711009-78711031 AAGAAGAAGAAGAAGTATGGGGG - Intronic
1119993647 14:79227849-79227871 GAGAAGAAAGAGAGGAAGGGAGG - Intronic
1120294526 14:82622982-82623004 GAGGAGGAGGAGGAGAATGGAGG + Intergenic
1120307615 14:82790473-82790495 GAGAAGAACGGGAAGAATGGAGG - Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120481748 14:85057722-85057744 CAGAAGAAGGATTTGAATGTGGG + Intergenic
1121821495 14:96971763-96971785 GAGAAGGAGGAGAAGAAGGGAGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122009109 14:98731135-98731157 GAGGAGTAGGAGAAAAATGGAGG + Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122624653 14:103078195-103078217 CAGAGGAAGGGGAGGAAGGGAGG + Intergenic
1122915966 14:104859140-104859162 TAGAAGGTGGAGATGAATGGTGG - Intergenic
1122964462 14:105115549-105115571 CAGAAGAAGGTGAGGCATAGAGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123027048 14:105430322-105430344 CAGGAGAGGGAGAGAAATGGAGG + Intronic
1202894209 14_KI270722v1_random:188690-188712 AAGAAGAAGTAGAAGAATTCAGG - Intergenic
1123800313 15:23811953-23811975 ATGAAGAAGGAGGAGGATGGTGG + Intergenic
1123986761 15:25653150-25653172 GAGAAGAACGAGGAGAACGGCGG - Intergenic
1124061319 15:26296198-26296220 CAGCAGAAGCAGAAGAATTTGGG - Intergenic
1124232456 15:27957006-27957028 CAGAAGAAGCAGGAGCCTGGTGG - Intronic
1124427441 15:29573701-29573723 CAGGAGAAGGAGAGGAAGAGGGG - Intergenic
1125119807 15:36141836-36141858 CAAAGGAAGGAGGAGAAAGGAGG + Intergenic
1125484272 15:40101556-40101578 AAGATAAAGGATAAGAATGGAGG + Intronic
1125762916 15:42109956-42109978 GAGAAGAAGAAGAAAAAAGGAGG - Intergenic
1125986563 15:44058800-44058822 AAGAAGAAGAAGAAGAAATGGGG + Intronic
1126213885 15:46132260-46132282 CAGAAGTAGTAGCAGCATGGTGG + Intergenic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126851447 15:52799336-52799358 GAGAAGGAAGAAAAGAATGGAGG - Intergenic
1126887127 15:53163146-53163168 CAGAAGAAGGGGAAGAAATTGGG + Intergenic
1127122101 15:55780573-55780595 CAGAAGAAGAAGAAGAAAGGAGG + Intergenic
1127137745 15:55942515-55942537 GAGAAGGAGGAGGAGAATGAAGG - Intronic
1127226913 15:56940734-56940756 AAGGAGAAGGAGGAGAAGGGGGG - Intronic
1128013577 15:64321825-64321847 CTGAAAGTGGAGAAGAATGGAGG + Intronic
1128095607 15:64952228-64952250 AAGAATAAGAAGAAGAAAGGAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128711198 15:69873196-69873218 CACAAGAAGGGTAAGGATGGTGG + Intergenic
1128743808 15:70100084-70100106 AAGAAGAAGGAAAAGAAAAGAGG + Intergenic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1129289814 15:74556259-74556281 AAGAAGAGGGAGAAAGATGGAGG + Intronic
1129356851 15:74997149-74997171 AGGAAGAGGGAGAAGAAAGGGGG - Intronic
1129561696 15:76577456-76577478 AAGAAGAAGGAGAAAAAAAGAGG + Intronic
1130435809 15:83898296-83898318 AAGAAAAAGAAGAAGAATGGCGG + Intronic
1130681838 15:86003723-86003745 TTGAAGAAGGAGAAGAGTAGAGG + Intergenic
1130772123 15:86935138-86935160 CAGAAAATGGAGAGGAATCGGGG - Intronic
1130896924 15:88178087-88178109 CAGAAGAAGGAGGATACTTGTGG + Intronic
1131152216 15:90054267-90054289 CCGAAGGAGGGGAGGAATGGAGG + Intronic
1131222218 15:90594519-90594541 TGGAGGAAGGAGAAGAAAGGCGG + Intronic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131701664 15:94943100-94943122 GAGAAGAATGAGGAGAATGGAGG + Intergenic
1131701671 15:94943137-94943159 GAGAAGAATGAGGAGAATGGAGG + Intergenic
1132759002 16:1499969-1499991 CAGCAGACGGACAAGCATGGGGG - Intronic
1133221455 16:4320794-4320816 CAGAATAGGGAGGACAATGGAGG - Intronic
1133460685 16:5983986-5984008 AAGGAGAAGAAGAAGAATGTGGG - Intergenic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1134596579 16:15500556-15500578 AGAAAGAAGGAGATGAATGGAGG + Intronic
1135394654 16:22122102-22122124 AAGAAGAAGGAAAAGAATGATGG + Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136394862 16:29987310-29987332 CAGGAGTAGGAAAAGACTGGAGG - Exonic
1136546909 16:30959735-30959757 AAAAAGAAGAAGAAGAATGAAGG - Intronic
1136901016 16:34038104-34038126 CAGAAGAAAGACAACCATGGAGG - Intergenic
1137339030 16:47581253-47581275 CGTAAGAAGGAGAAGAGAGGTGG - Intronic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137592303 16:49700937-49700959 CAGAGGAGGGAGGAGAAGGGAGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137633199 16:49962555-49962577 AGGAAGAAGGAGATGAAGGGTGG + Intergenic
1137702363 16:50506372-50506394 AGGATGAAGGGGAAGAATGGGGG + Intergenic
1137755093 16:50894814-50894836 CATATGAAGGAGTAGAATTGCGG - Intergenic
1138255743 16:55557764-55557786 AAGAAAAAGTAAAAGAATGGTGG - Intronic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1138629974 16:58285745-58285767 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
1139052825 16:63146709-63146731 AAAAAGAAGGAAAAGATTGGAGG + Intergenic
1139165779 16:64563528-64563550 AAGAAGAAGAAGAAGAAAAGAGG + Intergenic
1139424939 16:66873728-66873750 GAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1139425012 16:66873917-66873939 GAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1139825310 16:69752631-69752653 CAGAGGAAGGAGCAGAAAGTTGG + Intronic
1140006260 16:71078864-71078886 CTGAAGAAGGAAAAGGATAGTGG - Intronic
1140117726 16:72057284-72057306 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
1140119961 16:72075037-72075059 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
1140127227 16:72128292-72128314 CACAAAAAGGAGATGAAAGGGGG - Intronic
1140357602 16:74319581-74319603 GAGAAGAAGGAGAAGAAAGGAGG - Intergenic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141412288 16:83843788-83843810 CAAAAGAAGGAAAGGAAAGGAGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141873281 16:86804320-86804342 AAAAAGAAGAAGAAGAAGGGAGG + Intergenic
1142857511 17:2739776-2739798 GAGAAGAAGAGGAAGAAGGGAGG - Intergenic
1142976855 17:3650181-3650203 AAGCAGGAGGAGAAGAATGCAGG + Intronic
1143171068 17:4930703-4930725 AAGAAGAAGAAGAAGAAAGGAGG + Intergenic
1143330782 17:6133506-6133528 TAGGAAAAGGAGAAGAATTGGGG - Intergenic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143949266 17:10619880-10619902 AAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144255014 17:13458964-13458986 GAGGAGAATGAGAAGAATGGAGG - Intergenic
1144335404 17:14264667-14264689 CAGAGGAAGGAGTAGAACTGGGG + Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144871420 17:18374097-18374119 AAGAAGAAGGAGAAGAGTCAGGG + Intergenic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145091131 17:19987020-19987042 AAGGAAAAGGAGAAGAAAGGCGG + Intergenic
1145103878 17:20098737-20098759 CAGCAGGAGGAGGAGGATGGAGG - Intronic
1145984364 17:29035199-29035221 GAGAAGAAGGAGAAGAAAGAAGG - Intronic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146805624 17:35863065-35863087 CAGCTGAAGGAGAAAAATGAGGG - Exonic
1146921958 17:36719347-36719369 CAGAAGAAAGAGAGCAAAGGAGG - Intergenic
1146935523 17:36810390-36810412 AAGAAGAAGAAGAAGAAGAGGGG + Intergenic
1147311358 17:39597835-39597857 CACAAGGAGGAGAGGAAGGGGGG - Intergenic
1147547331 17:41412161-41412183 CAGAGGTAGGAAAAGAATGTGGG - Intergenic
1147834002 17:43317150-43317172 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
1148086145 17:44994993-44995015 CAGAGGAAGGAGGAGAGGGGAGG + Intergenic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148271089 17:46262356-46262378 AAGAAGAAGAAGAAGAAGAGGGG - Intergenic
1148467554 17:47873959-47873981 AAGAAGAAAGAGAGGAAAGGAGG - Intergenic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149055991 17:52366497-52366519 AAGCAGAAGGAAGAGAATGGAGG + Intergenic
1149110655 17:53025416-53025438 CAGAAGAAAGAGAAGAAATGGGG - Intergenic
1150374567 17:64670004-64670026 AAGAAGAAGAAGAAGAAATGGGG - Intergenic
1150688777 17:67344636-67344658 CAGAGGAAGGTGAAAAAAGGTGG - Exonic
1150947601 17:69765371-69765393 CAGAGGAAGGAGGGGAAGGGAGG - Intergenic
1151345689 17:73500079-73500101 CGGAGGATGGAGGAGAATGGAGG - Intronic
1151345770 17:73500380-73500402 CAAAGGATGGAGGAGAATGGAGG - Intronic
1151623870 17:75264294-75264316 CAGAAGAAGGCGAAGGGAGGTGG - Intronic
1151730326 17:75907234-75907256 CAGCAAGAGGACAAGAATGGAGG - Intronic
1152084072 17:78206692-78206714 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1152261656 17:79270469-79270491 CAGGAGAAGGGGAGGCATGGTGG - Intronic
1152297028 17:79473800-79473822 TAGGAGGAGGAGAAAAATGGAGG - Intronic
1152439200 17:80295167-80295189 CAGTAAAAGGAGGAAAATGGGGG - Intronic
1153843120 18:9024585-9024607 CAGATGCAGAAGTAGAATGGAGG + Intergenic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1154136605 18:11785433-11785455 TGGAACAAGGAGAAGAAAGGAGG + Intronic
1155062030 18:22237270-22237292 CAGAAGAATTTGAAGAGTGGGGG + Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1156920342 18:42514844-42514866 GGGTAGAAGGAGAAGACTGGAGG + Intergenic
1156958037 18:42992143-42992165 GAGAAGAAGTGGAGGAATGGAGG - Intronic
1157237597 18:45979148-45979170 GAGAAGAAGAAGAAGAGAGGAGG - Intergenic
1157322566 18:46645837-46645859 CACAAGAATGACAAGAATTGAGG + Intronic
1157427368 18:47595350-47595372 CAGCAGGTGGAAAAGAATGGGGG + Intergenic
1157703479 18:49780577-49780599 CTGAAGAGGGGTAAGAATGGAGG + Intergenic
1157744981 18:50127515-50127537 CAGCTGAAAGAGAACAATGGAGG + Intronic
1157763816 18:50283074-50283096 AGGGAGAAGGAAAAGAATGGAGG + Intronic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158288545 18:55912851-55912873 CAGAAGGAGAGGAAGAATTGTGG - Intergenic
1158754140 18:60301798-60301820 CAGAAGAAAGCGAATAGTGGAGG + Intergenic
1158828765 18:61254835-61254857 AGGAAGAAGGATAATAATGGAGG + Intergenic
1158855526 18:61540095-61540117 CAAAAGCAGGAGCAGAATGGAGG - Intronic
1159088732 18:63822668-63822690 AAGAGGAAGTAGAAGAAAGGAGG - Intergenic
1159356054 18:67338221-67338243 AAGAAGAAAGGAAAGAATGGAGG - Intergenic
1159728551 18:71995054-71995076 CAGAAGGAAGAGAAAGATGGGGG + Intergenic
1159996262 18:74968377-74968399 CAAGAGAAGCAGAAGTATGGGGG - Intronic
1160783941 19:891217-891239 CAGAAGTGGGAAAACAATGGAGG + Intronic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1161701162 19:5796349-5796371 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162425802 19:10594690-10594712 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1162504011 19:11071713-11071735 AAGAAGAAGAAGAAGAAAGGGGG + Intergenic
1162543654 19:11314773-11314795 CAGAAGGAGGGGAAGAAAAGAGG + Intronic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162846062 19:13393564-13393586 AGGAAGAAGAAGAAGAAGGGGGG - Intronic
1162853496 19:13450209-13450231 CAGAAGAATGGGGAGAATTGGGG - Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163048448 19:14662742-14662764 CAGAAGCAGGAGCAAAAGGGAGG - Intronic
1163197764 19:15735664-15735686 AACAAAAAGGAAAAGAATGGAGG - Intergenic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1164167697 19:22697095-22697117 CAGAAGAAGGTGCTGAGTGGAGG - Intergenic
1164324783 19:24181516-24181538 CAGAAGAGGAAGAGGAAAGGAGG + Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165277357 19:34766403-34766425 CTGGAGAAGGTGAAAAATGGTGG + Intronic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1166299780 19:41907111-41907133 TGCAAGAAGGAGAGGAATGGGGG + Exonic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166822235 19:45587686-45587708 AAGAAGGAGGAGAGGAATAGGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167632163 19:50632061-50632083 CAGAAGAAGTAGGGGACTGGGGG - Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168126092 19:54283993-54284015 CAGAACAAGGAAAAAAGTGGAGG + Intergenic
925678693 2:6394143-6394165 CATAAGAAAGGGAAAAATGGAGG - Intergenic
925862241 2:8190475-8190497 AAGAAGAAGGAAAAGAATGAAGG - Intergenic
926243812 2:11107402-11107424 AAGAAGGAGGAGGAGAAAGGGGG + Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926650084 2:15334171-15334193 AAGAAAAAGGAGAAGAGAGGAGG - Intronic
927369932 2:22342941-22342963 CAAAACAAGGAGCAGAATGAAGG + Intergenic
927372676 2:22375252-22375274 CTGAAACAGGTGAAGAATGGGGG - Intergenic
927399211 2:22691270-22691292 CAGAAAAAGAAGAAAAAGGGAGG + Intergenic
927455207 2:23242859-23242881 CAGGAGCAGGAGAAGGTTGGGGG - Intergenic
928083103 2:28327237-28327259 GAGAAGGAGGAGGAGAAGGGAGG - Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928289873 2:30027732-30027754 CAAAATCATGAGAAGAATGGGGG + Intergenic
928425293 2:31172707-31172729 CAGAAGATGGGGAAGCGTGGTGG + Intergenic
928835825 2:35543454-35543476 TAGAAGCAAGAGTAGAATGGTGG + Intergenic
929242530 2:39666549-39666571 AAGGAGAGGGAGAAGAAGGGAGG - Intronic
929353330 2:40988086-40988108 GAGAAGAATTAGAAGAATGTAGG - Intergenic
929362119 2:41104280-41104302 CAGGAGAAGGAAAAGAAAGAAGG - Intergenic
929404012 2:41620236-41620258 CAGAAGGCAGAGAAGAATGAAGG + Intergenic
929462578 2:42114176-42114198 AAGAAGAAGAAGAAGATTGCTGG + Intergenic
929717080 2:44323334-44323356 TAGAAGAATTAGAAGAATGGGGG - Exonic
929855558 2:45635928-45635950 AAAAAGAAGAAGAAGAAGGGTGG + Intergenic
929855561 2:45635931-45635953 AAGAAGAAGAAGAAGGGTGGGGG + Intergenic
929969949 2:46565332-46565354 AGGAAGTAGGAGAAGAATGCTGG + Intronic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930317240 2:49812731-49812753 CATAAGAAGGTCAAGACTGGGGG - Intergenic
930891335 2:56391560-56391582 CAGAGGAAGAAGAAGACTTGAGG + Intergenic
931330073 2:61271673-61271695 AAGAAGAAAGAGGAGAAAGGAGG + Intronic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931720617 2:65064966-65064988 CAGAAGAGAGAGAAGACTGGTGG - Intronic
931906916 2:66852310-66852332 CATAAGGGGGAGAAGAATGAGGG + Intergenic
931964813 2:67521793-67521815 CAGAATGTGGGGAAGAATGGAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932208209 2:69902921-69902943 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
932214273 2:69956462-69956484 AAGAAGAAGAAGAAGAAAAGAGG + Intergenic
932646455 2:73508190-73508212 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
933089323 2:78100758-78100780 CAAAAGAAAGACAATAATGGAGG + Intergenic
933520711 2:83368451-83368473 AAGAAGAAGAAGAAGGATAGAGG + Intergenic
933636132 2:84710866-84710888 AAGAAGAGGAAGAAGAAGGGAGG + Intronic
934101664 2:88659293-88659315 CAGCACTAGGAGAAGAGTGGAGG - Intergenic
934904859 2:98190941-98190963 TAGAAGAAGGAGAAGAGAGGGGG - Intronic
934990078 2:98914627-98914649 CAGAAGCAGGCGAAGGCTGGTGG - Intronic
935451154 2:103210966-103210988 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
935661373 2:105469544-105469566 CAGAAGGAGGAGAAGGTTAGAGG - Intergenic
935927319 2:108083628-108083650 AAAAAGGAGGATAAGAATGGAGG + Intergenic
936141636 2:109946925-109946947 CAGAGGAGGGAGAAGCCTGGCGG - Intergenic
936178324 2:110244873-110244895 CAGAGGAGGGAGAAGCCTGGCGG - Intergenic
936269351 2:111036873-111036895 CAGCAGAAGTAGGAGCATGGAGG + Intronic
936407123 2:112214725-112214747 CAGAGGAAAGGGGAGAATGGAGG + Exonic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936655532 2:114481933-114481955 GAGAAGAAGGAGAAGAGAGGAGG + Intronic
936702693 2:115032903-115032925 AAGAAGAAGAAGAAGAATATAGG + Intronic
936970364 2:118171012-118171034 AAGATGAAGGAGGAGAATGTAGG - Intergenic
937129045 2:119493627-119493649 AAAAAAAAGAAGAAGAATGGAGG - Intronic
937153885 2:119704606-119704628 AAGAAGAAGGGGAGGAAAGGAGG + Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937492173 2:122381477-122381499 GAGAAGAAAGATTAGAATGGAGG + Intergenic
937872652 2:126797305-126797327 GAGAAGGTGGCGAAGAATGGAGG - Intergenic
938710099 2:133968759-133968781 AAGAAGAAGGAGAAGTTTTGAGG - Intergenic
938726131 2:134110067-134110089 CAGAAGAAGGAGATAAATTGAGG + Intergenic
939122141 2:138129954-138129976 AAGAACAAAGAGAAGATTGGGGG + Intergenic
939272489 2:139958747-139958769 CAAAAGAAGAAGAAGAAAGAAGG + Intergenic
939389149 2:141544293-141544315 AAGAAGAAGAAGAAGAAGAGTGG - Intronic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
939492572 2:142894233-142894255 AAGAAGATGGAGAAAAATGTAGG - Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
939756536 2:146119273-146119295 CAGAAGAAAGAGAAGTTTAGTGG + Intergenic
939884829 2:147670217-147670239 GAGAAGAAAGAGAGGCATGGAGG + Intergenic
940008197 2:149029265-149029287 CTGAAGAAGCAGAAGAATATAGG - Intergenic
940440964 2:153715809-153715831 AAGAAGAAGAAGAAGAAAAGAGG - Intergenic
940479707 2:154212712-154212734 TAGAAGGAGAAGAAGGATGGGGG - Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941595913 2:167476837-167476859 AAGAAGAAAAAGAAGAAAGGGGG + Intergenic
941901834 2:170686332-170686354 AAGAAGGAGGGGAAGAAAGGAGG + Intergenic
942252628 2:174060507-174060529 GGGAAGAAGGAGGAGAAAGGAGG - Intergenic
942458302 2:176152369-176152391 CAGAAGAAGGAGCACATTTGGGG + Intronic
942465676 2:176205089-176205111 CAGAAACAGGAGAAACATGGGGG + Intergenic
943188148 2:184640249-184640271 GAGGAGAAGAAGAAGAAAGGAGG + Intronic
943202842 2:184851367-184851389 CAGAAGCAGAAAGAGAATGGTGG - Intronic
943498344 2:188653059-188653081 CAAAACAAGGAGAAAAATGATGG + Intergenic
944190160 2:196994484-196994506 AAGAAGAAGAAGAAGACTGTTGG - Intronic
944806971 2:203292455-203292477 CAAAAGAAAGAGAAGAAAAGGGG - Intronic
944855386 2:203762245-203762267 GAGTAGAAGGAAAAGAATGAAGG - Intergenic
945155165 2:206830429-206830451 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946247664 2:218396703-218396725 CTGAAGGAGGAGATGGATGGGGG + Exonic
946346489 2:219115169-219115191 AAGAAGAAGAAGAAGAAAGGGGG + Intronic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
947077016 2:226355732-226355754 AAGAGGAAGGAGAGGAAAGGAGG + Intergenic
947208598 2:227685007-227685029 AAGAAGAAGAAAAAGAATAGCGG + Intergenic
947232400 2:227901729-227901751 CAGAAGATGGACAAAAATGATGG + Intronic
947374285 2:229480064-229480086 CAGAAAAAATAGAAGAATGCAGG + Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947674566 2:231966151-231966173 AAGAAGAAGAAGAAGAATTCTGG - Intronic
947808852 2:232987452-232987474 AAGAAGAGGAAGAAGAAGGGAGG + Intronic
947811955 2:233010427-233010449 CAGGAGGAGGAGAAGAACTGGGG - Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948488314 2:238295350-238295372 GAGAAGAAGTAGAAGAAGGAGGG - Intergenic
948661287 2:239508110-239508132 CAGAAGAGGAAGCAGAAAGGGGG - Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1168795695 20:609133-609155 CAGGAGACTGAGAAGAAAGGAGG - Intronic
1168843068 20:922103-922125 CAGAAGAAGGTATAGGATGGGGG + Intergenic
1169770836 20:9198363-9198385 TAGAAGAAAGAGAAGAAGGTAGG + Intronic
1170139115 20:13107642-13107664 AAGAAGAATTGGAAGAATGGTGG - Intronic
1170496348 20:16929062-16929084 CAGGAGAGAGAGAAGAATGAAGG - Intergenic
1170798603 20:19571468-19571490 AAAAAGAAGGAGAACAAAGGGGG + Intronic
1170950199 20:20929926-20929948 CAGAAGAAGCAGGAAAATAGGGG - Intergenic
1170954963 20:20971579-20971601 AAGAAGAAGAAGAAAAATAGGGG + Intergenic
1171381242 20:24735760-24735782 CACAGGATGGAGGAGAATGGCGG + Intergenic
1171400784 20:24871979-24872001 GCGCAGAAGGAGAAGAAGGGAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172741628 20:37172947-37172969 GAGAAGAAGGAGAAAAATGCAGG - Intronic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1173110288 20:40180990-40181012 CTGAAGAAGGAAAAGACTAGTGG + Intergenic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173324908 20:42024294-42024316 CAGGAAAGGGAGAAGAATTGAGG + Intergenic
1173624888 20:44465576-44465598 CAGAACAAGCAGAAGAATAATGG - Intergenic
1173740735 20:45399976-45399998 CAGAAGAAGAAGGAAAATGTGGG + Intronic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173997927 20:47353729-47353751 CAGAAGGAGGAACAGAATGTTGG - Intronic
1174215626 20:48914103-48914125 CAGAAGAAGAGGCAGAAAGGGGG + Intergenic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1174663026 20:52231580-52231602 GAGAAGGAGGAGGAGAAGGGAGG - Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174983077 20:55419497-55419519 AAGAAGAAAGGGAAGAAAGGAGG - Intergenic
1175156649 20:56976093-56976115 CAGATGAGGGAGGAGCATGGAGG + Intergenic
1175156661 20:56976144-56976166 CAGATGGAGGAGGAGTATGGAGG + Intergenic
1175298836 20:57928587-57928609 GAGAAGGAGGAGGAGAAGGGTGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1177093741 21:16804421-16804443 CAGAAGAAGGAGCAAAATTATGG + Intergenic
1177447843 21:21221199-21221221 GAGAAGAGGGAGAAAAATGAGGG - Intronic
1177555480 21:22682457-22682479 CAGAAGAAGAAGGAAAATGAGGG - Intergenic
1177585695 21:23091754-23091776 CATAAGAACGTGAAGAATGTGGG - Intergenic
1177689587 21:24488121-24488143 AAGAAGAAAGAGGAGAGTGGTGG + Intergenic
1177809244 21:25907134-25907156 TAGAAGAAGAAGAAGAAGAGCGG - Intronic
1178011761 21:28295437-28295459 GAGAAGAAGGAGAAGAGTAAGGG - Intergenic
1178028443 21:28495598-28495620 AAGAACAAGGAAAAGACTGGGGG - Intergenic
1178161818 21:29926465-29926487 GAGAAGAAGGTTAAGAATTGTGG + Intronic
1178197235 21:30360535-30360557 CAGAAGAAGGACGAAAGTGGAGG + Intronic
1178376539 21:32072246-32072268 CAGAAAAAAGGGGAGAATGGAGG - Intergenic
1178619924 21:34165344-34165366 AAGAAGAAGTGGAAGAATTGTGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178777043 21:35561848-35561870 TAGGAGAAAGAGAACAATGGAGG + Intronic
1178910270 21:36668385-36668407 AAGAAGAAGGAGAAAAAATGAGG - Intergenic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1179247283 21:39644933-39644955 AAGAAGAGTGAGAAGAAAGGGGG - Intronic
1179343192 21:40531764-40531786 CAAAAGAAGGAAAGGAATGGGGG - Intronic
1179435141 21:41357589-41357611 CAGCAGAAGGAGATGACTGTCGG - Intergenic
1180013840 21:45070081-45070103 CAGAAGAGGGAGACGATGGGTGG - Intergenic
1180228849 21:46414376-46414398 GAGGAGAAGGAGGAGAAGGGTGG - Intronic
1180865125 22:19114120-19114142 CAAAAGATGGAGAGGAAAGGTGG - Intronic
1181515526 22:23409532-23409554 TAGAAGAAGAAGAAGATTTGGGG - Intergenic
1181812275 22:25410802-25410824 CAGAAGGAGGAGAGAAGTGGAGG - Intergenic
1181883404 22:25999592-25999614 AAGGAGAAGGAGGAGAAAGGAGG - Intronic
1181883414 22:25999635-25999657 GAGGAGAAGGAGGAGAAAGGAGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1181997590 22:26894881-26894903 AGGAAGAAGGGGAAGACTGGAGG + Intergenic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182031628 22:27163536-27163558 AAGAAGAAAGAGAGGAATGAAGG + Intergenic
1182344027 22:29647237-29647259 CAGAAGAGAGAAAAGAATTGTGG + Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1183046206 22:35222484-35222506 CAGTAGGAGGAGAGCAATGGGGG - Intergenic
1183382525 22:37497290-37497312 CAGAAGATGGAGAGGCCTGGGGG - Intronic
1184672551 22:46023023-46023045 AAGAAGGAGGAGAAGAAAGGAGG + Intergenic
1184857372 22:47153751-47153773 GAGAAGAAGGAGAAGAAACTGGG + Intronic
1184929021 22:47666749-47666771 CAGAAGAAGAAGAAAAAAGGAGG - Intergenic
1185035129 22:48471187-48471209 AAGAAGAAGAAGAAGAAAAGAGG - Intergenic
1203237661 22_KI270732v1_random:21405-21427 CAGAAGAAAGACAACCATGGAGG - Intergenic
949348129 3:3096293-3096315 AAGAAGAAGAAGAAGAAGAGTGG + Intronic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949526918 3:4913734-4913756 CAGGAGAGGGAGAGCAATGGGGG + Intergenic
950366909 3:12492930-12492952 CTGAGGAAAGAGAGGAATGGGGG - Intronic
950525277 3:13519477-13519499 GAGGAGATGGAGGAGAATGGGGG - Intergenic
950980757 3:17302110-17302132 CAGAAGCAGGAGAGGCAAGGAGG - Intronic
951056669 3:18154721-18154743 CAGAAGAAGCAGTAGAATACAGG - Intronic
951108948 3:18778270-18778292 AAGAAGAGGGAGAAGAAAGGTGG + Intergenic
951117334 3:18880392-18880414 CAGAAGGAGGAGAAAAAGAGAGG + Intergenic
951682214 3:25306522-25306544 AAGAAAAAGAAGAAGAAAGGAGG + Intronic
951825026 3:26859303-26859325 AAGAAGAAGGTGAAGAGAGGAGG - Intergenic
951891656 3:27573274-27573296 CAAAAGAGAGAGAAGAAAGGAGG - Intergenic
952344492 3:32471111-32471133 AAGAAGAAGAAGAAGAAAAGTGG + Intronic
952368468 3:32696326-32696348 AAGAAGAAGAAGAAGAAATGGGG + Intronic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
953745272 3:45569208-45569230 GAGAAGAATGAGAAGAATAGAGG - Intronic
953827798 3:46269120-46269142 AAAAAGGAGGAGAAGAGTGGTGG + Intergenic
954111066 3:48433451-48433473 CTGAGGAAGGAGAACTATGGAGG - Intronic
954428396 3:50455895-50455917 CAGAACGAGGAGAGGAATGGGGG - Intronic
954553850 3:51503370-51503392 CGGGAGAAGGAGGAGAATGAAGG - Intergenic
955008195 3:54989313-54989335 CACATGAAGGAGAAGACTAGAGG - Intronic
955073535 3:55591767-55591789 TAGAAGAAGGACAAGAATAATGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955329517 3:58035452-58035474 CTGAAGAGGGGGCAGAATGGTGG + Intronic
955459191 3:59161751-59161773 CAGTGGTAGGAGGAGAATGGTGG + Intergenic
955584460 3:60461772-60461794 CAGAGGCAGGATAAGGATGGGGG + Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956064579 3:65383694-65383716 CAGTTGCAGGACAAGAATGGTGG + Intronic
956198818 3:66684023-66684045 AAGAAGAAGAAGAAGAAAAGAGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956261689 3:67350196-67350218 CAGAAGCAAGAGAAAGATGGGGG - Intergenic
956362043 3:68458987-68459009 CAGAAAAAGGAGCTGAATTGTGG + Intronic
956468781 3:69543281-69543303 GAGAGGAAGGAGAGGAAAGGAGG + Intergenic
956705730 3:71997442-71997464 ATGAAGAAGAAGAAGAAAGGAGG + Intergenic
956807512 3:72830820-72830842 CAGAAGATGGAGAAAAATAAGGG + Intronic
956812445 3:72877051-72877073 CAGAGGAAGGCGAAAAAAGGTGG - Intergenic
956938271 3:74128840-74128862 AAGGGGAAGGAGAAGAAAGGGGG + Intergenic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957398808 3:79681469-79681491 CAGAAGTAGGAAATGAGTGGGGG + Intronic
957650636 3:82998089-82998111 AAGAAAAAAGAGTAGAATGGTGG + Intergenic
957736138 3:84205675-84205697 AAGAAGAAGGAGAACAAAGTTGG + Intergenic
958906586 3:99948565-99948587 AAGGCGAAGGAGAAGAAAGGAGG + Intronic
958962534 3:100523676-100523698 AAGGAGAAGGAGGAGAAAGGAGG - Intronic
958962541 3:100523707-100523729 GAGGAGAAGGAGGAGAAAGGAGG - Intronic
958962546 3:100523729-100523751 GAGGAGAAGGAGGAGAAAGGAGG - Intronic
959404352 3:105941996-105942018 AAGAAGAAAGGGAAGAATGGAGG - Intergenic
959839298 3:110955865-110955887 CAGAAGATTAAGAAGGATGGAGG - Intergenic
959977701 3:112480594-112480616 CACAAGACAGAGAAAAATGGGGG + Intronic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960530293 3:118756459-118756481 GAGGAGAAAGAGAAGAAAGGAGG + Intergenic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960698832 3:120421233-120421255 TGGAAGGAGGAAAAGAATGGAGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
961137745 3:124527615-124527637 AAGAAGAAGAAGAAGCATTGGGG + Intronic
961206345 3:125085458-125085480 CCTAAGAAGAAGAAGAATGTAGG - Intronic
961207059 3:125092668-125092690 CTGATGAAGGAGAAAGATGGAGG + Intronic
961405544 3:126677160-126677182 AGGAAGAAGCAGAAGAAAGGAGG + Intergenic
961553897 3:127684799-127684821 CAGAAGAGGAAGAAGAGTGAAGG + Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962371424 3:134823860-134823882 CAGCAGAATGAGAAGAAAGCAGG + Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962779689 3:138700585-138700607 AAGAAAAAAGAGATGAATGGGGG + Intronic
963043137 3:141083603-141083625 CAGCACAAGCAGAAGCATGGAGG - Intronic
963115586 3:141726439-141726461 AAGAAGAAGAAGAAGAAGAGAGG + Intergenic
963584537 3:147168390-147168412 AAGGAGAAGGAGAAGAAGAGAGG + Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963846035 3:150159073-150159095 GTGAAGCAGCAGAAGAATGGGGG - Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964877742 3:161387901-161387923 TAGAAGGAGGAGCAGAGTGGGGG - Intergenic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
967055730 3:185826500-185826522 TACAGGAGGGAGAAGAATGGCGG + Intergenic
967234774 3:187373511-187373533 CAACTGAGGGAGAAGAATGGAGG + Intergenic
967408195 3:189140546-189140568 CAAGAGAAGGAGAATAATAGTGG - Intronic
967423651 3:189301565-189301587 CAGAAGAAGAAAAAAAATGGAGG - Intronic
967497318 3:190156160-190156182 CAGAAGTGGGAGAAGGCTGGAGG + Intergenic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
968027278 3:195452987-195453009 CATAAGAAGGGGAAGAAAAGAGG - Intergenic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
968782847 4:2596291-2596313 GAGAAGGAGGAGAGGCATGGCGG + Intronic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969495209 4:7522699-7522721 CGGGAGAAGGGGAAGGATGGGGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969717893 4:8877281-8877303 GAGGAGAGGGAGAAGAAAGGGGG + Intergenic
969717930 4:8877427-8877449 AAGAAGAAGGAGAAAAGAGGAGG + Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970063795 4:12068030-12068052 AAAAAGGAGGAGAAGAACGGGGG + Intergenic
970219689 4:13797969-13797991 AGGAAGAAGGAGAAGAAAGAAGG + Intergenic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
971234547 4:24829416-24829438 CAGAAGATGGAGAAAAAAGATGG + Intronic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
973074476 4:45905166-45905188 CAGCAGGAAGAGAACAATGGTGG + Intergenic
973259235 4:48144473-48144495 CAGAAGGAAAAGAAGAATGGAGG + Intronic
973306685 4:48659954-48659976 AAGAAGAAGAAGAAGAAAGGAGG + Intronic
974245550 4:59311601-59311623 AAGAAGGAGTAGAAGTATGGAGG + Intergenic
974921419 4:68245002-68245024 CAGGAGAAAGTGAAGAATAGAGG - Intronic
975932021 4:79536520-79536542 TGGAAAAAGGAGAGGAATGGTGG + Intergenic
975932029 4:79536623-79536645 AGGAAAAAGGAGAGGAATGGTGG + Intergenic
976160156 4:82190498-82190520 AAGAAAGAGAAGAAGAATGGTGG + Intergenic
976169321 4:82286489-82286511 TAGAAAGAGGAGAAAAATGGTGG + Intergenic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
976563556 4:86529017-86529039 CAGAAGAAGGAAGAGGTTGGTGG - Intronic
976777193 4:88719627-88719649 GAAAAGAAGGAGAAGAAAGAAGG - Intergenic
976777202 4:88719682-88719704 GAGAAGAAGGAGAAGAAAAAAGG - Intergenic
977149553 4:93492929-93492951 TAGAAGCAGGAGTAGAATGGTGG - Intronic
977784812 4:101020460-101020482 CAGAAAAAGGAGATAAGTGGTGG - Intergenic
978089545 4:104697935-104697957 GAGTATAAGGAGAAGAAAGGGGG + Intergenic
978181726 4:105805802-105805824 AAGAAGAGGCAGAAGAATGGAGG - Intronic
978212122 4:106149514-106149536 ATGAAGAGGGAGAAAAATGGAGG + Intronic
978245490 4:106567396-106567418 AAGGAGAATGAGAAGAAAGGAGG - Intergenic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978562979 4:110053220-110053242 CAGAAGAAGAAGAAGAACCAGGG - Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
978862739 4:113470293-113470315 AAGAAGTAGGAGCAAAATGGGGG - Intronic
979273166 4:118786297-118786319 AAGAAGAAAGAGAAAAATGTAGG - Intronic
979302790 4:119106694-119106716 CACTAGGAGGAGAAGGATGGAGG - Intergenic
979383198 4:120033036-120033058 GAGAAGAGGGAGAAAAAAGGGGG + Intergenic
979405010 4:120299155-120299177 AAGAGGAAGGAGAAGAAAGGGGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
979604365 4:122622072-122622094 CAAGAGAAGCAGAAGAAAGGAGG - Intergenic
980385933 4:132088149-132088171 GAGAAGAAGGAGTAAAAAGGGGG - Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
981018476 4:140000634-140000656 CTAAAGGAGAAGAAGAATGGCGG + Intronic
981075460 4:140586891-140586913 CTGAACAAAGGGAAGAATGGAGG + Intergenic
981279936 4:142945913-142945935 CAGAACACTGAGAAGAATGTGGG + Intergenic
981384960 4:144119082-144119104 AAAAATAAGGAGAAGAAAGGAGG + Intronic
981798423 4:148627115-148627137 TAGAAGCAGGAGTAGAATGGTGG + Intergenic
982079557 4:151775523-151775545 AAGAACAAAGGGAAGAATGGTGG + Intergenic
982243342 4:153322841-153322863 CAGAAGAAGCATAAAAAAGGGGG - Intronic
982644203 4:158002478-158002500 TAGAAGCAGAAGTAGAATGGTGG + Intergenic
982774827 4:159430921-159430943 CAGACAGAGGAGAGGAATGGAGG + Intergenic
982844092 4:160227487-160227509 TTGAAGAAGGAGAAGAAAAGAGG + Intergenic
983204162 4:164895445-164895467 CAGAAGAAGAAGAGGAGTGAAGG + Exonic
983461265 4:168028087-168028109 CAAAGGAAGGAGGATAATGGGGG - Intergenic
983523057 4:168730843-168730865 GAGAAGAGGGTGAAAAATGGGGG - Intronic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
983708258 4:170684837-170684859 AAGAAGAAGAAGAAGAAAAGGGG + Intergenic
983712596 4:170737863-170737885 CAGGAGATGGAGGTGAATGGAGG + Intergenic
983752498 4:171293558-171293580 AAGAAAAAGGAGTAAAATGGAGG + Intergenic
984256121 4:177392023-177392045 CAGAAGAAAGATGAGAGTGGAGG + Intergenic
984406255 4:179334956-179334978 CAGGAGAAAGAGAATAATGATGG + Intergenic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985403183 4:189612306-189612328 GAGAAAAAGAAGAAGAAAGGAGG - Intergenic
985481986 5:118832-118854 AAGGAGGAGGAGAAGAATGTGGG - Intergenic
985631883 5:1018119-1018141 CAGCGGAGGAAGAAGAATGGCGG + Intronic
985927512 5:3029478-3029500 CAGAAGAAGCAGAAGATGTGGGG + Intergenic
986009734 5:3701177-3701199 GAGAAGGAGGAGAAGAAGGAGGG - Intergenic
986109236 5:4694885-4694907 AAGAAGAAAGAGAAAAAAGGGGG + Intergenic
986273672 5:6255500-6255522 GAGAAGGAGGAGGAGAATGAGGG + Intergenic
986466116 5:8026424-8026446 CACAAGAAAGAGAACAAAGGAGG + Intergenic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
986634907 5:9811624-9811646 CAGAAGAAGAAGAAGAAAAAAGG - Intergenic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
986924722 5:12732586-12732608 CAGAAGCAAGAGAAAAAAGGAGG + Intergenic
986997711 5:13626143-13626165 CACAAGAAGAAGAAGAAAGAGGG + Intergenic
987353218 5:17039917-17039939 GAGGAGAAGGAGGAGGATGGGGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987522666 5:19006848-19006870 AAGAAGAAGGAGAATAATCTGGG - Intergenic
987865363 5:23528954-23528976 CAGAAGAAAAAGGAGAAAGGAGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
989264501 5:39457503-39457525 AAGAAGAAGTAGAAGCATTGTGG - Intronic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990308299 5:54515330-54515352 CCAAGGAAGGAGAAGAAAGGAGG + Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990690041 5:58353827-58353849 CAGAAGAAAGGAAAGAAAGGAGG + Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991198527 5:63962190-63962212 CAGAAGAGAGAGAAGAGAGGAGG - Intronic
991930796 5:71750788-71750810 AAGGAGAAGGAGAAGAAGAGAGG - Intergenic
992158620 5:73979465-73979487 CAGAAGGAGAAGCAGAAAGGCGG + Intergenic
992232230 5:74674617-74674639 AAAAAGAAGAAGAAGAAAGGAGG + Intronic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
992743314 5:79795313-79795335 CAGAAAAAGTAGAAGACAGGAGG - Intronic
992959407 5:81943590-81943612 TAGAATAAGGAGAAGAACGTTGG + Intergenic
993198118 5:84776805-84776827 GAGAAGAAGGAAAAGAGAGGAGG - Intergenic
993275982 5:85859307-85859329 GAGGAGAGGGAGAAAAATGGGGG + Intergenic
993425541 5:87759748-87759770 GAGTAGAAGGAGAAGATGGGTGG + Intergenic
993436493 5:87901939-87901961 CAGGAGAACCAGAAGAATGCAGG - Intergenic
993568838 5:89510586-89510608 CAGAGGAAGGCTAAGTATGGTGG - Intergenic
994952436 5:106481537-106481559 CAGAAGAAGGGGGAGAAAAGAGG - Intergenic
994970630 5:106731807-106731829 CAGAATATGGATAAGAATGAAGG + Intergenic
995149004 5:108820431-108820453 CAAAAGAAGAACAAGAAAGGTGG + Intronic
995227508 5:109718279-109718301 CAGAAAAAGGAAAAGAATAAAGG - Intronic
995554103 5:113309933-113309955 CAGAAGAAAGAGAGGAAGAGAGG - Intronic
995608036 5:113879376-113879398 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995821575 5:116240308-116240330 GAGAAGAGAGAAAAGAATGGAGG + Intronic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996127537 5:119744005-119744027 AAGAAGAAGAAGAAGAAAGGAGG + Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996553598 5:124755113-124755135 AAGAAGAAGCAGAGAAATGGAGG - Intergenic
996652344 5:125894812-125894834 AAGAACAAAGAGAAGATTGGAGG - Intergenic
997777773 5:136626836-136626858 CTGGAGAAGGAAAAAAATGGTGG + Intergenic
998102694 5:139447512-139447534 GAGAAGGAGGAAAAGAAAGGAGG - Intergenic
998512823 5:142727936-142727958 AAGGAGAGGGAGAAGAAAGGAGG + Intergenic
998720151 5:144936178-144936200 AAGAAGAAGAAGAAGAAATGAGG + Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999261496 5:150241466-150241488 GAGAAGAAGGAGGAGAGGGGAGG - Intronic
999420338 5:151436427-151436449 CATAGGAAGGTGCAGAATGGTGG - Intergenic
999786304 5:154893730-154893752 AAGAAGAAGAAGAAGAATATCGG - Intronic
1000010971 5:157232580-157232602 AAGAAGAAAGAGAGGAAGGGAGG + Intronic
1000161011 5:158597809-158597831 AAGAACAGAGAGAAGAATGGTGG + Intergenic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1000299753 5:159945569-159945591 CAGAAGCAGGAGGAGAGAGGTGG + Intronic
1000371887 5:160544781-160544803 AAGAAGAAAGAGTAGAAGGGAGG - Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001029522 5:168251760-168251782 CAGTAGCAGCAAAAGAATGGTGG + Intronic
1001049352 5:168402146-168402168 CAGAGGGAGGGGAAGAAAGGAGG - Intronic
1001189547 5:169615697-169615719 CAGGAGAGGGAGAAGAGTGAAGG - Intergenic
1001272511 5:170325662-170325684 CAGAAGAAAAGGAGGAATGGAGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002791390 6:440502-440524 GAGAAGATGGAAGAGAATGGTGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003593068 6:7452259-7452281 AAGAAGAAGAAGAAGAAGAGTGG - Intergenic
1003619991 6:7691338-7691360 CAGAGGAAGGAGGGGAAGGGAGG - Intergenic
1003857272 6:10289396-10289418 CACAAGACAGAGAAGAATAGAGG + Intergenic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1004135405 6:12961349-12961371 AAGAAGAAGGAGTGGAATGTTGG + Intronic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005473605 6:26185976-26185998 AAGAAGAAGAAGAAGAATATAGG + Intergenic
1005858891 6:29886474-29886496 CTGAAGGATGAGAAGAATGGAGG + Intergenic
1005866442 6:29941276-29941298 CTGAAGGATGAGAAGGATGGAGG + Exonic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1006315764 6:33290592-33290614 CAGGGGAGGGAGAAGAAGGGGGG - Intronic
1006450526 6:34103370-34103392 CAGAAGCTGGAGAAGAATAGTGG + Intronic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1006635667 6:35459647-35459669 CAGCAGAAGGGGAAGTCTGGGGG - Intronic
1006810899 6:36819898-36819920 CAGAAGAGGCACCAGAATGGGGG - Intronic
1006939246 6:37740909-37740931 AACAAAAAGGACAAGAATGGAGG + Intergenic
1007211783 6:40198136-40198158 CAGAAGAAGGGGCAGATTTGGGG - Intergenic
1007362062 6:41365738-41365760 TAGAAGCAAGAGGAGAATGGTGG - Intergenic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1007877068 6:45116210-45116232 GAGAAGAAGGAGAGGAAGGGAGG - Intronic
1007883809 6:45202391-45202413 CAGAAAAAGGAAAACAATGAAGG + Intronic
1007945934 6:45827212-45827234 CCCAGGATGGAGAAGAATGGTGG - Intergenic
1008306266 6:49904667-49904689 CAGAAGAAAAAGAAGAATCTGGG + Intergenic
1009621946 6:66088753-66088775 AAAAAGAAAGAGAAGAATGAAGG + Intergenic
1010158183 6:72820029-72820051 GTGAAGAGGGAGAAAAATGGAGG - Intronic
1011040135 6:83021140-83021162 CAGAAGAAGGCCAGGCATGGTGG + Intronic
1011216941 6:85015111-85015133 CAGAATAGGGAGACGAAAGGAGG - Intergenic
1011223782 6:85085179-85085201 AAGAAGAAGGAAAGGAAAGGAGG + Intergenic
1011383142 6:86764663-86764685 GAGGAGAAGGGGAAGACTGGAGG - Intergenic
1011647080 6:89469924-89469946 CTGTAGAAGGAGAAGAATCTGGG - Intronic
1011773670 6:90703941-90703963 CAGAAATGAGAGAAGAATGGGGG + Intergenic
1011819268 6:91231555-91231577 TAGAACAAGGAACAGAATGGAGG + Intergenic
1011923311 6:92610263-92610285 CATAAGGAGGAGAAGAAAGACGG - Intergenic
1011959111 6:93064945-93064967 GAGAATATGGAGAAGAATGTGGG - Intergenic
1012152600 6:95773480-95773502 CAAAAGAGGAAGAAGAAGGGGGG - Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012392600 6:98759988-98760010 AAGAAGAGGGAGAAAGATGGAGG - Intergenic
1012413469 6:98987042-98987064 CAGAAGAAGGACAAGAATCTGGG + Intergenic
1012416326 6:99017741-99017763 CAGAAGAAGGGGAAGAGTCGAGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013816509 6:114104728-114104750 CAGAAGAAGGAGAATACTTTTGG + Intronic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014453745 6:121613321-121613343 CAGTAGAATGAAAAGAAGGGTGG + Intergenic
1014709389 6:124788576-124788598 GAGAAGAATGAGAACAAAGGAGG + Intronic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015155621 6:130092321-130092343 GAGAGGAAGGAGAGGAAAGGAGG - Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1016083775 6:139887155-139887177 CAGAAGAAGGAAAAGAGAGAGGG + Intergenic
1016344178 6:143093796-143093818 GAAGAGAAGGAGAAAAATGGGGG + Intronic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017070619 6:150572900-150572922 CAAAAGGAAGAGAAAAATGGAGG + Intergenic
1017426896 6:154331312-154331334 GAAAAGAAGAAGAAGAAGGGAGG + Intronic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1018943194 6:168324425-168324447 AAGGAGAAGGAGAAGAAAGTAGG - Intergenic
1019011849 6:168849314-168849336 AAGAAGAAGAAGAGGAGTGGAGG + Intergenic
1019041080 6:169106737-169106759 CAGAAGAAAGAAAAGAGGGGAGG - Intergenic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019535276 7:1526114-1526136 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535285 7:1526144-1526166 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019535300 7:1526201-1526223 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535309 7:1526231-1526253 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019535324 7:1526287-1526309 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535356 7:1526402-1526424 AAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019697281 7:2452634-2452656 AAGAAGAAGGAAAAGAAAGAAGG - Intergenic
1019785205 7:2972408-2972430 CAGAAGAAAAAGAAGTAGGGTGG + Intronic
1019901953 7:4027944-4027966 AACAAGCAGGGGAAGAATGGAGG + Intronic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1020923877 7:14299194-14299216 CAGTAGAAGGAGAGTATTGGAGG + Intronic
1021078096 7:16329824-16329846 CATAAAAAGGAAAAGAATAGAGG + Intronic
1021229719 7:18071553-18071575 CAGCAGAAGGTTTAGAATGGGGG + Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022715755 7:32896530-32896552 AAGAAGAAAGAGAAGGCTGGAGG + Intergenic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1022996161 7:35757541-35757563 GAGGAAAAGGAGAAGAAAGGGGG - Intergenic
1023006731 7:35878275-35878297 GAGAAGGAGGATGAGAATGGAGG + Intronic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023171550 7:37394523-37394545 CTGCAGAAGGAGAATAATTGGGG + Intronic
1023250471 7:38254893-38254915 CAAAAGAAGGAGAAAAAGGTAGG - Intergenic
1023251772 7:38270992-38271014 CAAAAGAAGGAGAAAAAGGTAGG - Intergenic
1023458508 7:40367916-40367938 ATGAAGGAGGAGGAGAATGGTGG - Intronic
1023549759 7:41357237-41357259 TAGCAGAAGGAGAAGAAAAGAGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1024067430 7:45752365-45752387 GAGAAGGAGGATGAGAATGGAGG - Intergenic
1024144935 7:46504649-46504671 AAGAAGGAGGAGAGGAAGGGAGG + Intergenic
1024471114 7:49769616-49769638 CAGGAGGAAGAGAAGAATTGAGG - Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1024787629 7:52926409-52926431 GAGAAGAGGAAGAAGAAAGGGGG + Intergenic
1024805316 7:53132561-53132583 CAGAAGAAAGACAACCATGGAGG + Intergenic
1025238083 7:57248320-57248342 CAGAAGAGGTAGTAAAATGGAGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1025966341 7:66275680-66275702 TAGAAGCAAGAGTAGAATGGTGG + Intronic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026205586 7:68254862-68254884 CAGAAGAAGGAGAAAAGAAGAGG - Intergenic
1026655478 7:72252743-72252765 CAGGAGTAGGAGTAGCATGGAGG - Intronic
1026879717 7:73900792-73900814 GAGGAGCAGGAGAAGAAAGGGGG - Intergenic
1027475909 7:78631208-78631230 CAGCACAACTAGAAGAATGGTGG - Intronic
1027518052 7:79167285-79167307 CAGAAGAATCAGAGGAGTGGAGG - Intronic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1028215374 7:88125802-88125824 CTGAAGAAGCAGTAGAAAGGGGG + Intronic
1028390542 7:90311579-90311601 AAGAAGAAGGAGGAAAATGTGGG - Intergenic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028630764 7:92931480-92931502 CTGTAGAAGCAGCAGAATGGTGG + Intergenic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028742903 7:94296955-94296977 CAGAGGCAGGAGAACATTGGAGG - Intergenic
1028898174 7:96065321-96065343 GAGAAGAAGGAGGACTATGGAGG - Intronic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029515657 7:101021550-101021572 AAGAAGAAAGAGAAGAGAGGGGG - Intronic
1029745111 7:102512294-102512316 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029763103 7:102611455-102611477 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030435996 7:109521420-109521442 CAGGAGCAGGAGAAGACTTGAGG - Intergenic
1030583072 7:111384155-111384177 AAGAAGAAGGAGGAGAAAGGAGG + Intronic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031923483 7:127618060-127618082 CTGAAGCAGGAGCAGAGTGGAGG - Intergenic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1032401971 7:131629993-131630015 CAGAGGAGGGAACAGAATGGAGG + Intergenic
1032523392 7:132562464-132562486 GAGAAGGAGGAGGAGAAAGGAGG - Intronic
1032667454 7:134051253-134051275 AAGCAGAGAGAGAAGAATGGAGG + Intronic
1032713496 7:134483807-134483829 AAGAGGAAGGAGAAGCCTGGGGG + Intergenic
1032785361 7:135196047-135196069 CAGGAGATGGCGGAGAATGGGGG - Intronic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1033241595 7:139684243-139684265 GAGAAGAAGGAGAGAGATGGGGG - Intronic
1033301785 7:140192624-140192646 AAGAAGGAAGAGAAGAAAGGAGG + Intergenic
1033393851 7:140955462-140955484 AAGAAGAAGGAGAGAGATGGAGG - Intergenic
1033652094 7:143351393-143351415 CAGAAAAAGGACAAGAAAAGGGG - Intronic
1034119079 7:148610904-148610926 AAGAAGGTGGAGAAGAATGAGGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034978914 7:155463451-155463473 AAGAAAAAGAAGAAGAAAGGAGG - Exonic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035034440 7:155885870-155885892 AGGAAGAAGGAAAAGGATGGGGG - Intergenic
1035075463 7:156174664-156174686 CAGAAATCGGAGAAGAATGGGGG + Intergenic
1035284729 7:157799013-157799035 TAGAAGTTGGAGAAGAAAGGAGG - Intronic
1035529741 8:341747-341769 CAGACCAAGGAGAAGAATCCAGG + Intergenic
1035574543 8:696384-696406 GTGGAGAAGGAGAAGAGTGGAGG - Intronic
1035574610 8:696683-696705 GTGGAGAAGGAGAAGAGTGGAGG - Intronic
1035741331 8:1930410-1930432 CAGTAGAAGCGGAAGAATGAAGG - Intronic
1035854998 8:2965035-2965057 CAGAGGAAGGACAAGAAGAGGGG - Intronic
1036076492 8:5507999-5508021 CAGTAGAAGTAGAAAAATAGAGG - Intergenic
1036158262 8:6362613-6362635 CAGTAGCAGGAGAGGAGTGGAGG - Intergenic
1036523265 8:9512065-9512087 TGTAAGAAGAAGAAGAATGGTGG - Intergenic
1036777251 8:11622109-11622131 AAGAAGAAGAAGAAGAAGTGAGG - Intergenic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037189852 8:16110978-16111000 CAGAAGAAGGAAAAGAAAAAAGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037481187 8:19307443-19307465 CAGAAGGATAAAAAGAATGGAGG - Intergenic
1037520297 8:19674519-19674541 CAGAGGAGGGAGAAGAACAGTGG + Intronic
1037660562 8:20922907-20922929 CAAAAGAAGAAAAAGGATGGAGG - Intergenic
1037901189 8:22690537-22690559 GAGAAGAAGGCGGAGAAGGGCGG - Exonic
1037943404 8:22971816-22971838 CTGAAGCAGGAGAAGAGTGGAGG - Intronic
1038313123 8:26461151-26461173 GAGAAGAAGGAGGGGAATGAAGG + Intronic
1038365811 8:26933183-26933205 CAGAACAAAGAAAATAATGGTGG + Intergenic
1038464991 8:27753647-27753669 CAGAAGATGGAAAATACTGGTGG - Intronic
1038695337 8:29801534-29801556 AAGAAGAAGAAGAAAAAAGGAGG + Intergenic
1039159882 8:34605670-34605692 AAGAAGCAAGAGCAGAATGGTGG - Intergenic
1039502076 8:38026009-38026031 GAGAAGAAGAAGAAGAATTTGGG + Intergenic
1039542669 8:38384154-38384176 AGGAAGAAAAAGAAGAATGGAGG - Intergenic
1039870345 8:41540473-41540495 CAGAAGAGGGAGCAGGTTGGAGG + Intronic
1040807173 8:51407873-51407895 TAGAAAAAGGAGCAGAAAGGGGG + Intronic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041253397 8:55956871-55956893 GAGAAGGAGGAGAAGACAGGAGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041345927 8:56898064-56898086 CAGCAGAAGGAGACTCATGGGGG - Intergenic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1041971832 8:63752290-63752312 GACAAGAAGGGGAAGACTGGAGG + Intergenic
1042289844 8:67158499-67158521 CAGAAGAAAAAGAAGAAAGACGG + Exonic
1043551378 8:81376843-81376865 GAGAAGAAGGTGGAGGATGGAGG + Intergenic
1043645934 8:82518568-82518590 GAGAAGAAAGAGATGAATTGAGG - Intergenic
1044799572 8:95940157-95940179 TAGACGTAGGAGAAGAATAGAGG - Intergenic
1044899249 8:96926519-96926541 AAGAAGAAAAAGAAGAAAGGAGG - Intronic
1045008530 8:97937028-97937050 CTGGAGAAGGAGAGGAGTGGAGG - Intronic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1045113878 8:98961059-98961081 GTGAAGAAAGAGATGAATGGGGG + Intergenic
1045522420 8:102914806-102914828 CAGAAGAAGGTGCAGATTGAGGG - Intronic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046494774 8:114999005-114999027 AGGAAGAAGGAGAGGAAGGGAGG - Intergenic
1046571755 8:115974935-115974957 GAGAAGAAGGAGAGAGATGGAGG + Intergenic
1046594967 8:116250827-116250849 CAAAAGAATGAGTAAAATGGTGG - Intergenic
1046664161 8:116980697-116980719 CAGAACAAGGTAAAGAATGAAGG + Intronic
1046721789 8:117628339-117628361 CAGAAGCAGGAGTAGAGTTGGGG + Intergenic
1047073647 8:121375986-121376008 AAGAAGAAGGAGGAGTATGAGGG - Intergenic
1047153957 8:122296264-122296286 AAGAAGAAAGGGAAGAATGGAGG + Intergenic
1047158367 8:122348072-122348094 CAGAAGAGAAAGAAGAAAGGAGG + Intergenic
1047327060 8:123849919-123849941 AATATGAATGAGAAGAATGGTGG + Intergenic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1047515641 8:125552531-125552553 CAAAAGAAGGAGCAGATTGAGGG - Intergenic
1047767783 8:128003338-128003360 AAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1048350958 8:133615937-133615959 AAGAAGAAAGAGAGGAAGGGAGG - Intergenic
1048420698 8:134275518-134275540 AAGAAGAAAGAGAAGACTAGAGG - Intergenic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1049121942 8:140747425-140747447 GAGGAGGAGGAGAAGAAAGGGGG + Intronic
1049350943 8:142164331-142164353 GAGATGAAGATGAAGAATGGAGG + Intergenic
1049391333 8:142373139-142373161 GAGAAGAAAGAGAGGAAGGGAGG + Intronic
1049495186 8:142926900-142926922 CAGAAGGAGGAGACGGATGCAGG - Intergenic
1050053206 9:1624450-1624472 CAGAAGAAGGTGAAATAAGGTGG + Intergenic
1050229867 9:3511591-3511613 CAGAAGAAGCAGAAGATAGTTGG + Intronic
1050354077 9:4766743-4766765 CAAAAGAGGAAGAAGAATGGTGG + Intergenic
1050708970 9:8438039-8438061 CTGAAGCAGGAAAAGAATGAGGG + Intronic
1050734470 9:8747628-8747650 CAGAAGAAGAAATAGAATGAAGG + Intronic
1050745109 9:8867172-8867194 AGGAAGAAAGAGAAGAAGGGAGG - Intronic
1050984098 9:12060096-12060118 AAGAAGATGGAGAAGGTTGGGGG - Intergenic
1051031926 9:12691264-12691286 CATAAAGAGTAGAAGAATGGAGG - Intronic
1051095988 9:13465631-13465653 CAGAAGAAGGAGAAGAGTAATGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051857958 9:21591050-21591072 CAGAAGAAGAAAAAGAAAAGAGG + Intergenic
1051905295 9:22088031-22088053 CAGAAGAACTAAAAGAAAGGAGG + Intergenic
1051961102 9:22763729-22763751 CAGAAACAGGAGTAAAATGGTGG + Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052186984 9:25609905-25609927 TAGAAGAAGGAGGAAAATGAGGG + Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053263605 9:36693998-36694020 GAGGAGAAGGAGGAGAAAGGAGG - Intergenic
1053440077 9:38108838-38108860 CTGAGGAAGGGGAAAAATGGTGG + Intergenic
1054584435 9:66950765-66950787 AAGAAGAAGAAGAAGCCTGGTGG - Intergenic
1055224453 9:73977447-73977469 CAGAAGAACGGGAGGAAGGGAGG + Intergenic
1056808025 9:89743765-89743787 CAGAAGAAGGAGTTGAAAGTGGG - Intergenic
1056850511 9:90080012-90080034 CAGAGGAAGGAGGAGAATAGGGG - Intergenic
1057110098 9:92461468-92461490 AAGAAGAGGGAGAAAAAAGGAGG - Intronic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057396045 9:94681446-94681468 GAGAAGGAGGAGGAGGATGGTGG - Intergenic
1057558323 9:96107349-96107371 CAGAGGAGGGAGAAGAATAGGGG + Exonic
1058226397 9:102369836-102369858 CAGAGGCTGGGGAAGAATGGTGG + Intergenic
1058318571 9:103600320-103600342 CAGAAGGAAGGGAAGAAGGGTGG - Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058561437 9:106233148-106233170 AGGAAGAAGGAGGAGAAAGGAGG - Intergenic
1058760383 9:108125202-108125224 CAGTAGAAGGAGGAAAAAGGGGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059103979 9:111495620-111495642 CAAAAGAAGGAGATGATTAGAGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059348408 9:113647819-113647841 CAGAGAAAGGAGAAAAATTGGGG + Intergenic
1059630112 9:116112804-116112826 CAGAAGAAGGCACAGAATGACGG - Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1059850143 9:118329182-118329204 GAGCTGAAGCAGAAGAATGGAGG - Intergenic
1059998745 9:119939295-119939317 CAGAAGAAGGAGGAGACATGAGG + Intergenic
1060237265 9:121873636-121873658 AAGAAGAAGAAGAAGAGAGGAGG - Intronic
1060237266 9:121873639-121873661 AAGAAGAAGAAGAAGAAGAGAGG - Intronic
1060594831 9:124841572-124841594 CAGGAGCAAGGGAAGAATGGGGG + Intergenic
1060720912 9:125976774-125976796 GGGAGGAAGGAGAAGAAGGGAGG - Intergenic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061337855 9:129953808-129953830 AAGGAGAAGGAGGGGAATGGGGG + Intronic
1061477172 9:130875822-130875844 AAGGAGAAGGAGAAGAGAGGAGG - Intronic
1061942579 9:133891493-133891515 CAGATAGAGGAGAAGGATGGAGG + Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1203652182 Un_KI270751v1:136195-136217 CAGAATAAGGCCAAGCATGGTGG + Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185759427 X:2678571-2678593 AGGAAAAAGGAGAAAAATGGAGG - Intergenic
1185772190 X:2773278-2773300 AGGAAGAAGGAGAGGAATGAAGG + Intronic
1185793426 X:2945009-2945031 AAGAAGAAGAAGAAGAAGAGGGG + Intronic
1185814811 X:3144975-3144997 AGAAAGAAGGAGAAGAAAGGAGG - Intergenic
1185971206 X:4666638-4666660 CAGCAGATGGAGCAGAATTGAGG + Intergenic
1186093553 X:6075703-6075725 GAGAAGAAGCAAGAGAATGGGGG - Intronic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187025828 X:15434376-15434398 AAAAAGAAGGAGGAGAAAGGAGG + Intronic
1187211415 X:17236111-17236133 AAGAAGAAAAAGAAGAAAGGAGG - Intergenic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1188009232 X:25039737-25039759 CCGGAGAGGGAGAAGTATGGTGG + Intergenic
1188052710 X:25507374-25507396 CACAGGATTGAGAAGAATGGGGG + Intergenic
1188399521 X:29727909-29727931 AAGAAGAAGAATAAGAATAGTGG - Intronic
1188980183 X:36720428-36720450 GAGAAGAAGAAGAAGAAGGGAGG + Intergenic
1189301724 X:39957130-39957152 CAGAATCAGGAGATCAATGGAGG + Intergenic
1189400457 X:40663326-40663348 TATAAGAAGGAGAAAAATAGTGG - Intronic
1189566117 X:42242890-42242912 CAGAACAAGCAGAAGCCTGGTGG - Intergenic
1189775570 X:44467668-44467690 AAGTAGAAGGTGAAGAAAGGTGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1191962385 X:66718283-66718305 TATAAGAAGGAGAAGAGGGGTGG + Intergenic
1192007468 X:67232658-67232680 GAGGAGAAGGAGGAGGATGGAGG - Intergenic
1192124828 X:68492141-68492163 AAAAAGAAGGACAGGAATGGTGG - Intergenic
1192339997 X:70256522-70256544 CACAAGAAGGAGATGAATTTGGG + Intergenic
1192946161 X:75967199-75967221 CAAAAGGAGCAGAAGAGTGGAGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193347306 X:80419054-80419076 CAAAAGAATGTGAAGAATAGAGG - Intronic
1194135515 X:90135771-90135793 CCAAAGAAGGAGGAGAAAGGAGG + Intergenic
1194795223 X:98202696-98202718 AAGAAGAAGAAGAAGAATGGGGG + Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196098957 X:111828673-111828695 CAGAAGAAGAAGGAAAATGTGGG + Intronic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1196748591 X:119094250-119094272 CAAAAGAAGAAAAAGAATTGGGG + Intronic
1197751162 X:129964536-129964558 AAGAAGAAGAAGAATATTGGAGG - Intergenic
1197803782 X:130379725-130379747 CAGATGAAGGAGAATAACAGTGG + Intergenic
1197910333 X:131476306-131476328 AAGAAGAAGAAAAGGAATGGAGG + Intergenic
1198338035 X:135687697-135687719 AAGCAGAAGGAGAGGAATGATGG + Intergenic
1198530191 X:137544872-137544894 CAAAAGAAAGTGAATAATGGTGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199435133 X:147804552-147804574 CAGAAGAGGGAGGAGAAAAGGGG + Intergenic
1199751588 X:150824326-150824348 GAGAAGAAGAAGAAGAAAGAAGG + Intronic
1199765883 X:150941497-150941519 CAGAGGAGGGAAAAGACTGGAGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200415573 Y:2906590-2906612 AAGAAGAAGGAGGAGAGGGGAGG - Intronic
1200923482 Y:8633704-8633726 GAGAAGAAGAAGAAGAAAAGAGG - Intergenic
1201422820 Y:13818918-13818940 AAGAAGAAGAAGAAGAAAGGAGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201475491 Y:14376851-14376873 AAGGAGGAAGAGAAGAATGGAGG + Intergenic
1201504636 Y:14684512-14684534 GAGAAGAAGCAAGAGAATGGGGG + Intronic
1201511362 Y:14768155-14768177 CAGAAAAAGGAGATGAGTGATGG - Intronic
1201589039 Y:15593493-15593515 AACAAGAAGGAGAAGAGAGGAGG - Intergenic
1201739704 Y:17310942-17310964 GAGAAGGAGGAGGAGAAGGGGGG - Intergenic
1202099397 Y:21290116-21290138 CAGGAGAAAGAGAAAAATGCAGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic