ID: 978850743

View in Genome Browser
Species Human (GRCh38)
Location 4:113332921-113332943
Sequence GGACATAGTGGGCCATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978850743_978850753 27 Left 978850743 4:113332921-113332943 CCAGGGGATGGCCCACTATGTCC 0: 1
1: 0
2: 1
3: 10
4: 104
Right 978850753 4:113332971-113332993 GTCACTTTGCAACAGAGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 76
978850743_978850750 5 Left 978850743 4:113332921-113332943 CCAGGGGATGGCCCACTATGTCC 0: 1
1: 0
2: 1
3: 10
4: 104
Right 978850750 4:113332949-113332971 CCCAGCAAAAGAAGAATTCCAGG 0: 1
1: 0
2: 3
3: 24
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978850743 Original CRISPR GGACATAGTGGGCCATCCCC TGG (reversed) Intronic
901491051 1:9596512-9596534 GGTCATAGTGTGCTGTCCCCTGG + Intronic
901841660 1:11957692-11957714 GGAGATAATGCTCCATCCCCAGG - Intronic
904703128 1:32370477-32370499 GGCCATAGTTTGCCAACCCCTGG - Intronic
904915945 1:33970706-33970728 GGACATAGGGGCCCCTCCCCAGG - Intronic
905890898 1:41517794-41517816 GGCCATGGTGGTCAATCCCCAGG - Intronic
907022635 1:51083660-51083682 GGATATACTGAGCCATCCCCAGG + Intergenic
913452630 1:119002303-119002325 GCACATAGTGGACCATTCCCAGG - Intergenic
915543328 1:156582358-156582380 GGGCATTGTGGGCCATCCCGAGG - Exonic
916719846 1:167476291-167476313 GTGCACAGTGGGCCATCCCTGGG - Intronic
921982315 1:221272171-221272193 CCATATAGAGGGCCATCCCCAGG - Intergenic
923886656 1:238164838-238164860 GGACATTTTGGGACATACCCTGG - Intergenic
924944493 1:248837536-248837558 GGACCTTGAGGGCCATCCCTGGG + Intergenic
1063920255 10:10925712-10925734 GGACTCTGTGGGCTATCCCCTGG - Intergenic
1065263755 10:23954114-23954136 GAACATGGTGGGCCATTTCCAGG + Intronic
1067710981 10:48651042-48651064 GGATATAGTGGACCAAGCCCAGG - Intronic
1069905575 10:71730392-71730414 GGCCACAGTGGGCCAAGCCCTGG + Intronic
1070427183 10:76300464-76300486 GGAAATAAAGGGCCTTCCCCAGG - Intronic
1073553075 10:104421456-104421478 GGACATAGTGGGTCTTGCCCAGG - Intronic
1074101489 10:110357905-110357927 GAACAAAGTAGCCCATCCCCTGG + Intergenic
1074292444 10:112148578-112148600 GGAGCTAGTAGGCAATCCCCAGG - Intergenic
1074787792 10:116856635-116856657 GGTCAGAGGGTGCCATCCCCTGG - Exonic
1076693557 10:132236296-132236318 GGACATTGTTGGCCATTTCCGGG - Intronic
1081224619 11:40504970-40504992 AGACAGAGTGGGCCATCTTCAGG + Intronic
1081586473 11:44388092-44388114 GGTCATAGTTTGCCATCCCCTGG + Intergenic
1081989811 11:47331837-47331859 GTACATACCTGGCCATCCCCAGG + Exonic
1084316302 11:68347769-68347791 GGGCATAGTGCTCCATCCCAGGG + Intronic
1084502309 11:69542078-69542100 GGAAAGAATGGGCCATGCCCAGG - Intergenic
1084562485 11:69912568-69912590 GCACATACCGAGCCATCCCCTGG + Intergenic
1085744265 11:79101091-79101113 GGGTATTGGGGGCCATCCCCAGG + Intronic
1092578428 12:9814378-9814400 TGGCAGAGTGGGCAATCCCCAGG - Intergenic
1102909061 12:116698722-116698744 GGCCATAGTTTGCCAACCCCTGG - Intergenic
1104018316 12:124975176-124975198 GGACAGAGTGGCCCATCCAGGGG - Intronic
1104521162 12:129476559-129476581 GGGCATTAGGGGCCATCCCCTGG - Intronic
1110633299 13:77735469-77735491 GGCCATAGTGTGTCAACCCCGGG - Intronic
1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG + Intergenic
1119060627 14:71470565-71470587 GGACTTAGTGGGTGATCACCTGG + Intronic
1119480764 14:74956208-74956230 GGACACAGTGGGCCTCCCACAGG + Intergenic
1121441352 14:93951677-93951699 GGACATCCTGGGACATCCCAGGG - Intronic
1121478664 14:94239556-94239578 GGCCATAGTTTGCCAACCCCTGG - Intronic
1121584110 14:95051198-95051220 GGACAACGTGGGCCATTACCAGG + Intergenic
1122375346 14:101253384-101253406 GGCCCTAATGGGCCATCCCACGG + Intergenic
1123409888 15:20049475-20049497 GGACAGAGGGGGCCCTCTCCGGG + Intergenic
1123519220 15:21056183-21056205 GGACAGAGGGGGCCCTCTCCGGG + Intergenic
1125853942 15:42931333-42931355 GGAGAAAGTGGGCCATCAGCTGG - Intergenic
1126706598 15:51411838-51411860 GGACATAGTCTGCCACCCCCTGG + Intergenic
1133236339 16:4388999-4389021 TGACAGAGTGTGACATCCCCAGG - Intronic
1134255816 16:12610420-12610442 AGAAATACTTGGCCATCCCCTGG - Intergenic
1140896617 16:79330547-79330569 GGAGATACTGGGCCACCCACAGG + Intergenic
1142063730 16:88047969-88047991 GGACTTAGGGGGCTGTCCCCTGG + Intronic
1144789022 17:17847346-17847368 GGGCAGAGTGGCCCAGCCCCAGG - Exonic
1146790463 17:35747882-35747904 GGACACACTGGGCCATTACCTGG - Exonic
1148193420 17:45696216-45696238 GGCCATAATTGGCCAACCCCTGG + Intergenic
1155514374 18:26609459-26609481 AGACATGGTGGTCCATCACCCGG - Intronic
1155661178 18:28250122-28250144 GGCCATAGAGGGCCATCTCATGG - Intergenic
1159449700 18:68584485-68584507 TGAGATAGTGAGCAATCCCCAGG + Intergenic
1160907292 19:1457300-1457322 GGTCCTAGTCGCCCATCCCCCGG - Intronic
1164372789 19:27656472-27656494 GGAAATACTTGGCCAACCCCAGG - Intergenic
1168294535 19:55372448-55372470 GCTCACAGTGGGCCAGCCCCAGG + Intergenic
925329031 2:3043970-3043992 GGCCATTGTGGCCCCTCCCCTGG - Intergenic
927932406 2:27053495-27053517 GCACAAAGGGGGCCATGCCCTGG - Exonic
929552910 2:42905710-42905732 GGATCTAGGAGGCCATCCCCTGG + Intergenic
932659699 2:73641541-73641563 GGGCATGCTCGGCCATCCCCCGG + Exonic
933229073 2:79785086-79785108 GCAAATAGGAGGCCATCCCCAGG - Intronic
934950136 2:98570522-98570544 GGACAAAGTGGTCCATTCCAGGG - Intronic
935748008 2:106206107-106206129 GGACATTGAGGGCCCTTCCCTGG - Intergenic
936122121 2:109755981-109756003 GGACATTGAGGGCCCTTCCCTGG + Intergenic
936222573 2:110615493-110615515 GGACATTGAGGGCCCTTCCCTGG - Intergenic
947828611 2:233123580-233123602 GGGAAAAGTGGGGCATCCCCAGG - Intronic
1168792577 20:589588-589610 GGCCAGAGGGGGCCTTCCCCAGG + Intergenic
1169087326 20:2835593-2835615 GAACATAGCGTGGCATCCCCCGG + Exonic
1170098752 20:12675503-12675525 GGACAACGTTGGCCATCCCCTGG - Intergenic
1173310713 20:41893871-41893893 GGCCATACTGGGCCCACCCCGGG - Intergenic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1178087581 21:29127770-29127792 TCACACAGTGGGCAATCCCCAGG + Intronic
1179478059 21:41660341-41660363 GTACAGAGTGCGCCAGCCCCCGG + Intergenic
1180858647 22:19064170-19064192 GGGCAGAGTGTGCCATCCCTGGG - Intronic
1180986886 22:19910190-19910212 CCACAGAGTGGGCCATCCCGAGG - Intronic
1181983610 22:26783748-26783770 GCCCATAGTGGCCCATTCCCGGG + Intergenic
1183932804 22:41245897-41245919 GGACCTAGTGGGCCTTCTCCTGG - Exonic
1185195455 22:49466616-49466638 GGACATGGTGGGCCGAGCCCTGG - Intronic
951713147 3:25606783-25606805 GGATATAGTTGGACAACCCCTGG - Intronic
952379442 3:32793141-32793163 AGACATAGAGGGGCATCACCAGG + Intergenic
956168867 3:66417085-66417107 GGACACAGCGGGCCAGCCACAGG + Intronic
956768721 3:72506551-72506573 GGACGTAGTGGGCTAAACCCGGG - Intergenic
957826707 3:85455866-85455888 AGACATAGTGGTCAATCTCCAGG + Intronic
959532554 3:107450301-107450323 GGACAGAGTGGTCCTGCCCCAGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
966111604 3:176408895-176408917 GGACCTAGACAGCCATCCCCAGG - Intergenic
966574597 3:181485824-181485846 AGACATTGAGGGCCAGCCCCTGG + Intergenic
978850743 4:113332921-113332943 GGACATAGTGGGCCATCCCCTGG - Intronic
1001686816 5:173599544-173599566 GGAAACAGTGGGCCACCGCCTGG - Intergenic
1001934438 5:175694437-175694459 GGACATAGTCGGCCGGCTCCTGG + Intergenic
1003091936 6:3111704-3111726 GGCCATAGTTGGCCAACCCCTGG + Intronic
1007091823 6:39189586-39189608 GGACACAGTGGGCCAGCCCCAGG + Exonic
1010426029 6:75729697-75729719 GGACACAGTGGCCCAGCCTCTGG - Intergenic
1015734961 6:136389338-136389360 GGACAAAGTGAGCCGCCCCCCGG - Exonic
1017174127 6:151485968-151485990 GGCCATAGTTTGCCAACCCCTGG - Intergenic
1019001965 6:168761472-168761494 GGACTTGGTGTGGCATCCCCAGG - Intergenic
1019322410 7:421730-421752 GGACAGGGAGGGCCGTCCCCGGG - Intergenic
1022605777 7:31812439-31812461 GGCCATAGTTTGCCAACCCCAGG - Intronic
1024632834 7:51263284-51263306 AGACCTCGTGGGCCCTCCCCAGG - Intronic
1025608619 7:63057442-63057464 GGACATGGTGAGCCATAGCCGGG + Intergenic
1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG + Exonic
1027224963 7:76237950-76237972 GGACATAGTGGGTGCTTCCCAGG - Intronic
1033492796 7:141860709-141860731 GGAAACAGTGGGGCATCCCATGG + Intergenic
1034386120 7:150742601-150742623 GGACTTAGGGGGCCAGGCCCTGG + Exonic
1034986149 7:155516733-155516755 AGACCCAGTGTGCCATCCCCAGG + Intronic
1037829044 8:22177417-22177439 GGGCATAGTGGGCCGTCCTGGGG + Intronic
1040494744 8:47956561-47956583 GGACATAGTGGCACATCCTGTGG + Intronic
1043818193 8:84829505-84829527 GGGCATAGTGGGCCTGCCTCAGG - Intronic
1049610576 8:143553052-143553074 GGACATAGTGGGGACTTCCCCGG + Intergenic
1050570940 9:6938317-6938339 GGTCATCATGAGCCATCCCCTGG - Intronic
1056250806 9:84746077-84746099 GGTCATAGTTTGCCAACCCCTGG - Intronic
1056815430 9:89797408-89797430 GGACATAGTGTGACCTCCCATGG + Intergenic
1058221588 9:102310005-102310027 AGACATAGGTGCCCATCCCCAGG - Intergenic
1199745833 X:150771503-150771525 GCACATAGAGGGCCACCCACAGG - Intronic