ID: 978851690

View in Genome Browser
Species Human (GRCh38)
Location 4:113345139-113345161
Sequence TGATGCAATATGAATGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978851690 Original CRISPR TGATGCAATATGAATGAACT TGG Intronic
901562124 1:10080754-10080776 TGTGGCAACATGGATGAACTTGG + Intronic
903870456 1:26430510-26430532 TGCTGCAAAATGAAGTAACTTGG + Intergenic
906014712 1:42564982-42565004 TGTCACAACATGAATGAACTTGG - Intronic
908579154 1:65495746-65495768 TGTGGCAACATGAATGAGCTTGG + Intronic
908876099 1:68678203-68678225 TGTGGCAACATGAATGAACCTGG - Intergenic
908985217 1:70009812-70009834 TGATGAAGTTTGAATGACCTTGG + Intronic
909321250 1:74288463-74288485 TGCAGCAACATGAATGAACTGGG + Intronic
909435662 1:75638894-75638916 TGCAACAATATGAATGAACCTGG + Intergenic
909853842 1:80503710-80503732 TTATGCATTAAGAATGATCTAGG - Intergenic
910209770 1:84781008-84781030 TGCTACAACATGAATGAACCTGG + Intergenic
910736921 1:90469166-90469188 TGCAGCAACATGAATGAAATTGG + Intergenic
911362078 1:96889602-96889624 TGCAGCAATATGAATGAACCTGG - Intergenic
911696300 1:100894167-100894189 TTATTCAATATGATTTAACTTGG - Intronic
911823566 1:102450379-102450401 TGCTGCAACATGGATGAAATTGG + Intergenic
911900465 1:103497006-103497028 TGCAGCAACATGGATGAACTTGG + Intergenic
912093009 1:106105409-106105431 TGTGGCAACATGGATGAACTTGG + Intergenic
912175269 1:107147963-107147985 TGATGCAATATAAAGCAAATTGG - Intronic
912707443 1:111925403-111925425 TGATGCAGTAGGTAAGAACTTGG - Intronic
912885540 1:113468718-113468740 TGATGTAATATGAATATATTTGG + Intronic
913458114 1:119054743-119054765 TGCTACAATATGAATGAACTTGG + Intronic
914977943 1:152383200-152383222 TGCAGCAATATGAATGAAACTGG - Intergenic
915290599 1:154880488-154880510 GGAGGAAATGTGAATGAACTAGG + Intergenic
915291818 1:154889372-154889394 TGATGCAGTATGAATGTGCAAGG + Intergenic
916013691 1:160729339-160729361 TGAGGTAATAAGAATGAACATGG + Intergenic
916219108 1:162425575-162425597 TGCAACAATATGAATGAACTGGG + Intergenic
917435720 1:175019112-175019134 TTATGCAATATGAAGAAAATGGG - Intronic
917694014 1:177500591-177500613 TGTGGCAATATGAATGAGCCTGG + Intergenic
917732074 1:177884616-177884638 TTGTGCAAAATGAATCAACTTGG + Intergenic
917994858 1:180425831-180425853 TGGTGAAATATGAACTAACTTGG - Intronic
918892351 1:190291986-190292008 TGTGGCAATATGGATGAACCTGG + Intronic
918893335 1:190305441-190305463 TGCAACAATATGAATGAACCTGG + Intronic
918928958 1:190827910-190827932 TGAGGCAATGTCAATGAACCTGG - Intergenic
918952827 1:191161288-191161310 TGCAGCAACATGAATGAACCTGG + Intergenic
919026783 1:192181993-192182015 TGTGGCAATGTGAATGAACCTGG - Intronic
920105609 1:203551201-203551223 TGAGCCAATATGAATGAACATGG + Intergenic
920323563 1:205143491-205143513 TGACACAATATGGATGGACTAGG + Exonic
921765346 1:218965886-218965908 AGATGTCAGATGAATGAACTGGG - Intergenic
922544839 1:226448596-226448618 TGAAACAAGATGAATGAACTTGG - Intergenic
923387034 1:233475184-233475206 TGAGCCAATATGAATGACCATGG + Intergenic
924832163 1:247608122-247608144 TGCAACAATATGAATGAACCTGG - Intergenic
1063234400 10:4097730-4097752 TTATGCAATGAGAATGAAGTTGG + Intergenic
1063278449 10:4597581-4597603 TAATGAAAAGTGAATGAACTTGG + Intergenic
1066169705 10:32828342-32828364 TGAGCCAATATGAATGACCATGG - Intronic
1066307412 10:34159461-34159483 GGATGTAAAATGAATAAACTTGG - Intronic
1068691384 10:59919172-59919194 TAAAGCAATATGTATGAACCTGG + Intergenic
1069129646 10:64682614-64682636 TGATGAAAAATGCATGAAGTAGG - Intergenic
1069151196 10:64962665-64962687 TGCAGCAACATGAATAAACTTGG + Intergenic
1070746147 10:78935217-78935239 TGATGCAACAAGGATGAACAAGG + Intergenic
1070943473 10:80368117-80368139 TGCTACAACATGAATGAACCTGG - Intergenic
1071038128 10:81272638-81272660 TGTAGCAACATGAATGAACACGG + Intergenic
1071363249 10:84872332-84872354 TGAAGCAATATGAATGCAGCTGG + Intergenic
1071526359 10:86362001-86362023 AGAGGCAAAATGAATGAGCTTGG + Intronic
1072828776 10:98635872-98635894 TGAGGCAACATGAATGAGCCTGG + Intronic
1073658944 10:105450780-105450802 TGCAGCAACATGAATGAACTTGG - Intergenic
1074050083 10:109873826-109873848 TGCTGCAACATGGATGAACCTGG + Intronic
1074178071 10:111030950-111030972 TGATGAAATATGAAAGATCATGG + Intergenic
1076418821 10:130313487-130313509 TGAAGCAATATGGATGCAGTTGG - Intergenic
1079599800 11:22297091-22297113 TGCTACAACATGAATGAACTGGG + Intergenic
1079677480 11:23248398-23248420 TGCAGCAACATGAATGAAATTGG - Intergenic
1080087278 11:28299441-28299463 TGATGAAATATGAATGCAAAAGG - Intronic
1080104108 11:28493913-28493935 TCTTGCAATATGAGAGAACTAGG + Intergenic
1080962730 11:37179233-37179255 TGAGCCAATATGAATGACCATGG - Intergenic
1081766371 11:45613582-45613604 TGAGGCAAAATGAATTAAATAGG + Intergenic
1081902230 11:46638725-46638747 TGCAGCAACATGAATGAACCTGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1086581700 11:88407572-88407594 TCATGAAATCTGAATGAAATTGG + Intergenic
1086797251 11:91122140-91122162 TGGAACAATATGAATGAACCTGG - Intergenic
1086859077 11:91902940-91902962 AGATATAATATGAAAGAACTAGG + Intergenic
1087415152 11:97845928-97845950 TGCAGCAACATGAATGAAATTGG + Intergenic
1087704590 11:101475772-101475794 TGTAACAACATGAATGAACTCGG - Intronic
1087813064 11:102629657-102629679 TGCTGCAATAAAATTGAACTTGG + Intergenic
1091125021 11:133086876-133086898 TGAGACAACATGAATGAACCTGG - Intronic
1091252933 11:134158969-134158991 TGTTGCAACATGGATGAACTTGG - Intronic
1091880897 12:3977304-3977326 TAAAGCAATATGATTGCACTTGG - Intergenic
1091939303 12:4462109-4462131 TGAAGCAACATGGATGAACCTGG - Intergenic
1092799046 12:12145090-12145112 TGTTGCAATCTGAATGTATTAGG - Intronic
1093203067 12:16213193-16213215 TCATGCAATATGAAAAGACTGGG + Intronic
1093251941 12:16816720-16816742 TGTGGCACTATGAAAGAACTTGG + Intergenic
1093360109 12:18215057-18215079 TGATACAAAATGAATGAACCTGG + Intronic
1093838020 12:23859991-23860013 TGAGGGAATATGAATGAAACTGG + Intronic
1095603864 12:44044411-44044433 CCATGCAACCTGAATGAACTGGG + Intronic
1095883026 12:47159040-47159062 TGCAGCAATATGAATGGAATGGG - Intronic
1097326286 12:58280875-58280897 TGTGGCAACATGAATGAACCTGG - Intergenic
1097478793 12:60094293-60094315 TGATGCAATTTCTATGAAATAGG - Intergenic
1098202941 12:68076401-68076423 TACTACAACATGAATGAACTTGG - Intergenic
1098659943 12:73079818-73079840 TGAGACAACATGAATGAACCTGG + Intergenic
1098903197 12:76134008-76134030 TGAGCCAATATGAATGACCATGG + Intergenic
1099282306 12:80666261-80666283 TGTGGCAATATGGATGAGCTTGG + Intronic
1099381950 12:81965451-81965473 GCATGCAACATGAATGAACTTGG + Intergenic
1099421813 12:82471185-82471207 TGATGCAACATGCATAAACCTGG + Intronic
1099431619 12:82592654-82592676 TGAGGCAACATGGATGAGCTTGG - Intergenic
1099607554 12:84824418-84824440 TGCAACAATATGGATGAACTTGG - Intergenic
1099711622 12:86233162-86233184 TGGTGCAATGTGAATTAAATGGG + Intronic
1100190426 12:92185089-92185111 TGCAGCCATATGAGTGAACTTGG - Intergenic
1102642136 12:114376339-114376361 TGAGACAACATGAATGAACCTGG + Intronic
1102731700 12:115116990-115117012 TGCTACAATATGGGTGAACTTGG - Intergenic
1102753519 12:115317574-115317596 TGAAACAATGTGGATGAACTTGG + Intergenic
1104742253 12:131186786-131186808 TGCAGCAATTTGAATGAACCTGG + Intergenic
1107318727 13:39162713-39162735 TGTGGCAATGTGAATGAGCTTGG - Intergenic
1108163106 13:47663400-47663422 TGAAGCAACATGAATGAAACTGG + Intergenic
1108675174 13:52730778-52730800 TCATAAAGTATGAATGAACTTGG + Intronic
1109399134 13:61802022-61802044 TGAGACAACATGGATGAACTTGG + Intergenic
1109691502 13:65897775-65897797 TGCTGCAATATCAATGAGCCCGG - Intergenic
1109870395 13:68324803-68324825 ACATGCAATATTTATGAACTAGG + Intergenic
1109915359 13:68978218-68978240 TGTGGCAACATGAATGAGCTTGG - Intergenic
1110548745 13:76787725-76787747 TGTAACAATATGAATGAACGTGG + Intergenic
1110936782 13:81300470-81300492 TGTTGCAATAAGTATGAATTTGG - Intergenic
1111193633 13:84842691-84842713 TAATGCCATATGAAAGAACGTGG - Intergenic
1111434141 13:88184365-88184387 TGATGTAATATGGATGTAATAGG + Intergenic
1112120396 13:96404190-96404212 TGATTTAAAATGAATTAACTGGG - Intronic
1112262518 13:97890147-97890169 TGTTTCAATATGTATGAATTTGG + Intergenic
1112790071 13:102993653-102993675 TGTGGCAATATGGATGAACCTGG - Intergenic
1114324267 14:21573184-21573206 TGTGACAATATGAATGAACCTGG + Intergenic
1115253751 14:31376615-31376637 TGATGCCATATGAAAAAACTTGG - Intronic
1117480942 14:56144203-56144225 TGATACAATAGGATTGAACAAGG - Intronic
1117654183 14:57937714-57937736 TGATGGTAAATGAAGGAACTTGG + Intronic
1118414413 14:65518938-65518960 TGAAGAAAGATGAATGAACAAGG + Intronic
1118704072 14:68463824-68463846 TGATGCAATGTGTTTGGACTGGG - Intronic
1118945811 14:70386226-70386248 TCATCCAATATGAATCAACTTGG - Intronic
1118956385 14:70486246-70486268 TGAGACAACATGAATGAACCTGG + Intergenic
1119314802 14:73684091-73684113 TGTTACAATGTGAATGAACCTGG - Intronic
1119978198 14:79049363-79049385 TGATACAACATGAATGAATGAGG - Intronic
1119986358 14:79142526-79142548 TGATCCAATATGGTTGAATTGGG + Intronic
1121790012 14:96692053-96692075 TGTGACAATATGAATGAACCTGG + Intergenic
1122149913 14:99719706-99719728 TACTGCAACATGGATGAACTTGG - Intronic
1125296176 15:38205730-38205752 TTATGCAAGATGAAGAAACTAGG + Intergenic
1126012901 15:44320225-44320247 TGATAAAATATGGATGAGCTTGG - Intronic
1128799027 15:70485636-70485658 TGAAGCAATGTGGATGAACCTGG + Intergenic
1129901369 15:79153369-79153391 TTATTAAATATGAATGAAATTGG - Intergenic
1130123716 15:81074448-81074470 TGGTCCAATCAGAATGAACTTGG + Intronic
1130840789 15:87699023-87699045 ACATGCAAAAAGAATGAACTTGG - Intergenic
1130978642 15:88796654-88796676 TGCCGCAATATGACTGAACCTGG + Intergenic
1133263005 16:4564339-4564361 TGATGCCATCTGCATGCACTGGG + Intronic
1134376063 16:13674996-13675018 TGAAGCAACATGAATGAAATTGG - Intergenic
1134810692 16:17164668-17164690 TGATACAATATGGATGAGCCTGG - Intronic
1135237521 16:20771531-20771553 TGTGGCAACATGTATGAACTTGG - Intronic
1138128887 16:54461720-54461742 TGATTCAACAGGTATGAACTGGG + Intergenic
1138159848 16:54743243-54743265 TGATTCTATATGTATGAATTTGG - Intergenic
1138355211 16:56372355-56372377 TGCTGCAGCATGAATGAACCTGG - Intronic
1139410386 16:66753980-66754002 TGCTGCAACATGAAGTAACTAGG + Intergenic
1140227012 16:73086555-73086577 TGAAGCAACATGAATGAAAATGG + Intergenic
1140627052 16:76806426-76806448 TGTTGCAACATGAATAGACTTGG - Intergenic
1140668696 16:77252510-77252532 TGTGGCAATATGAATAAACTTGG - Intronic
1144351251 17:14399103-14399125 TGATACAACATGGATAAACTTGG - Intergenic
1144993871 17:19253265-19253287 TGCTACAACATGGATGAACTTGG - Intronic
1145223789 17:21110652-21110674 TGAGCCAATGTGAATGACCTTGG - Intergenic
1147801441 17:43092388-43092410 TCAAGCAATATTAATGAAGTAGG - Exonic
1149041989 17:52201086-52201108 TGCTACAATATGGATGAACCTGG + Intergenic
1153648288 18:7214900-7214922 TGAGGCAATAAAAATGACCTAGG - Intergenic
1153788191 18:8553684-8553706 TGTTACAACATGAATGAACCTGG + Intergenic
1154051126 18:10959430-10959452 TGATGTATTATTAATGAACTTGG - Intronic
1155993189 18:32302555-32302577 TGTGGCAACATGAATGAACCTGG + Intronic
1156934761 18:42690289-42690311 TTGTGCAATATAAATTAACTTGG + Intergenic
1157021737 18:43791285-43791307 TGAGGGAGAATGAATGAACTTGG + Intergenic
1157030919 18:43907118-43907140 TGAAGTGATGTGAATGAACTAGG + Intergenic
1158887317 18:61840511-61840533 TGATGCAATCAGATAGAACTAGG - Intronic
1159149861 18:64506953-64506975 TGAAACAATATGAATGTACCTGG - Intergenic
1159762009 18:72438763-72438785 TGCAGCAATATGAATGGAATTGG - Intergenic
1162316409 19:9941212-9941234 TGTGGCAAAATGGATGAACTGGG + Intergenic
1164460065 19:28439300-28439322 TAATGCCATATGAATGTACTGGG - Intergenic
1164585558 19:29471012-29471034 TAAGGCAATATGAGGGAACTTGG + Intergenic
1164968432 19:32508759-32508781 TGTGACAACATGAATGAACTTGG - Intergenic
1166589978 19:43988484-43988506 TGATGCAGTTTGAATGAAGGAGG - Exonic
1167979691 19:53263303-53263325 TGTGGCAACATGCATGAACTTGG - Intergenic
925190552 2:1879261-1879283 TGGAGCAAAATGAATGAAATTGG - Intronic
925719659 2:6814571-6814593 TGTTACAGTATGAATGAACCTGG + Intergenic
927952353 2:27180710-27180732 TCATGCAAAATGTATGAACATGG + Intergenic
928970580 2:37024097-37024119 TGAGACAACATGGATGAACTTGG + Intronic
929373156 2:41251205-41251227 TGCAGCAATATGAATGAAGCTGG - Intergenic
930348656 2:50220455-50220477 TAATGCAATATCAATTATCTGGG - Intronic
930430159 2:51265441-51265463 TGAGCCAATATGAATGACCATGG + Intergenic
931072194 2:58665125-58665147 TGATTTAATATGAATTAAATGGG - Intergenic
931389543 2:61829203-61829225 TGATGTAATATAAAAGACCTAGG - Intronic
932833854 2:75016408-75016430 TGTGACAATATGAATGAACCTGG + Intergenic
933467214 2:82668221-82668243 TGATGGAATAAGGATCAACTTGG - Intergenic
934721890 2:96584668-96584690 TGCAGCAACATGGATGAACTTGG - Intergenic
935409782 2:102749264-102749286 TTCTACAACATGAATGAACTGGG + Intronic
936804365 2:116309920-116309942 TGTAGCAACATGAATGAACCTGG - Intergenic
937424130 2:121783772-121783794 TGCTGCAACATGGATGAACCTGG + Intergenic
938031040 2:127993692-127993714 TGAAGCAGTTTGAATGAAATTGG - Intronic
939598523 2:144158849-144158871 TTATGCAATGTGACTGAATTAGG + Intronic
939982309 2:148796226-148796248 TGAAGTAATATGGATGAATTTGG - Intergenic
940493248 2:154392057-154392079 TGTTGAATTATGAATGAACGTGG + Intronic
940514956 2:154671590-154671612 TGGAACAATATGGATGAACTTGG + Intergenic
940544678 2:155068912-155068934 TCTGGCAATATGAATGAAGTAGG - Intergenic
940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG + Intronic
940942237 2:159575026-159575048 TGCTGCAACAAGGATGAACTTGG + Intronic
941063432 2:160874182-160874204 TGCTGCAACATGAATGAAACTGG + Intergenic
941500256 2:166265346-166265368 TGTGGCAACATGAATGAACCTGG - Intronic
941708173 2:168681933-168681955 TGTAGCAATATGAATGAGTTTGG - Intronic
942203546 2:173595986-173596008 TGCGGCAATATGAATGAACCTGG + Intergenic
943593480 2:189827689-189827711 TGCAGCAATATGGATGATCTCGG + Intronic
943752806 2:191527351-191527373 TGCTGCAACATGAATGAATCTGG - Intergenic
943942588 2:194019376-194019398 TGATTCAATATGACTGATATTGG + Intergenic
944747851 2:202676207-202676229 AGTAGCCATATGAATGAACTTGG + Intronic
945054928 2:205860170-205860192 TGATGCAAAATGAATGAAGCAGG + Intergenic
945477133 2:210296928-210296950 TGCTGCAAGATGGATGAGCTTGG - Intronic
947917025 2:233839360-233839382 GGATGCAATAGCAAAGAACTGGG + Intronic
1169706466 20:8511270-8511292 TGCAACAACATGAATGAACTTGG - Intronic
1169810281 20:9603005-9603027 TGAGGCAAAATAAATCAACTTGG - Intronic
1170116853 20:12869662-12869684 TCATGGAAAATCAATGAACTGGG - Intergenic
1172861487 20:38056860-38056882 TGATGCAAAAAGAATGATTTTGG + Intronic
1176251448 20:64123032-64123054 TGAGTCAATATGAATGACCATGG + Intergenic
1177718214 21:24867768-24867790 TGCAGCAACATGGATGAACTTGG + Intergenic
1178162119 21:29930010-29930032 TGCTGCAACATGAATAAACCTGG + Intronic
1178723593 21:35031714-35031736 TGCAGCAACATGGATGAACTTGG + Intronic
1179057026 21:37945648-37945670 TAATATAATATGAAAGAACTAGG + Intergenic
1180863557 22:19102114-19102136 TGCTACAACATGAATGAACCTGG + Intronic
1181580282 22:23824422-23824444 TGATGCAGAGTGAATGAACCTGG + Intronic
1181623671 22:24107641-24107663 TGCTGCAATGTGAAGGAACCAGG - Intronic
1182909957 22:33974730-33974752 TGGAGCAATATGGATGAACCTGG + Intergenic
1184884536 22:47334471-47334493 CCATGTAATATGAATGGACTTGG + Intergenic
949402382 3:3679187-3679209 GGATGTGATATGAATAAACTGGG - Intergenic
949443153 3:4105078-4105100 TGCTGCAACATGGATGAACCTGG + Intronic
950905376 3:16533059-16533081 TGCTGCAACATGAATGAACCTGG - Intergenic
950928501 3:16766563-16766585 TAATGCAATATCAATCAATTGGG - Intergenic
952351952 3:32548086-32548108 TGCAACAATATGAATGAACCTGG + Intronic
952609270 3:35187938-35187960 TGATACACTATGAGAGAACTGGG + Intergenic
954981960 3:54754426-54754448 TGATGCCATATAAATAAAGTTGG + Intronic
955042458 3:55331392-55331414 AGTTGATATATGAATGAACTTGG - Intergenic
955512235 3:59692882-59692904 TGATGAAATATAAATGCATTTGG + Intergenic
956702613 3:71971917-71971939 TGCTACAACATGGATGAACTTGG - Intergenic
956960409 3:74392743-74392765 TGATGCAATAGAAATGGACTTGG + Intronic
957485443 3:80855817-80855839 TCATGCAATATGAAACAACATGG - Intergenic
957688756 3:83539607-83539629 TGCTACAATATGAATGAAGCTGG + Intergenic
959755719 3:109896346-109896368 TGATGAATTAAGTATGAACTTGG + Intergenic
960431724 3:117577370-117577392 TCATGCTATATTAATGAACTTGG - Intergenic
962299749 3:134228537-134228559 TGCTACAACATGAATGAACCTGG + Intronic
964351848 3:155810720-155810742 TGAGGCATAATGAATGAAGTAGG - Intergenic
964437054 3:156664520-156664542 TGATGGAGTAAGCATGAACTAGG - Intergenic
965032305 3:163387872-163387894 TATGGCAATATGAATGAACCTGG + Intergenic
965344849 3:167535927-167535949 TGCAGCAACATGAATGAACCTGG + Intronic
965418886 3:168431729-168431751 TGCTACAATATGGATGAACCTGG - Intergenic
965489611 3:169320303-169320325 TGACACAATAGGAATAAACTGGG + Intronic
965707919 3:171528358-171528380 TGATGCAATCTGACAGAAGTGGG + Intergenic
965726495 3:171722121-171722143 TGTTGCAATAACAATGTACTGGG - Intronic
965827833 3:172748579-172748601 TCAAACATTATGAATGAACTTGG + Intergenic
965884005 3:173422215-173422237 TGCAGCAACATGAATGAACTTGG + Intronic
965908815 3:173745373-173745395 TGATGCAATTAGCATAAACTAGG - Intronic
967671850 3:192246014-192246036 TGATGAGATATCAACGAACTAGG - Intronic
967782186 3:193451717-193451739 GGATGAAATATGCATGAAGTGGG + Intronic
972038409 4:34556771-34556793 TGGTGCAACATGGATGAACCTGG - Intergenic
972184797 4:36515516-36515538 TTTTGAAACATGAATGAACTTGG - Intergenic
972945364 4:44247762-44247784 TGTGACAACATGAATGAACTTGG - Intronic
973100902 4:46268883-46268905 TGAGGCAACATGAATAAAATTGG + Intronic
973737453 4:53886514-53886536 TGATCCAATCTGAATCAAATTGG - Intronic
974406617 4:61480327-61480349 TGAAACAATATGAATGAACCTGG - Intronic
976036848 4:80834151-80834173 TTACCCAATGTGAATGAACTGGG - Intronic
976071187 4:81241594-81241616 AAATGCTATATGAATGAGCTTGG + Intergenic
976095177 4:81501068-81501090 TGAGTCAATATGACTGCACTTGG + Intronic
976484043 4:85579751-85579773 TGTTACAACATGAATGAACCTGG - Intronic
976492468 4:85687559-85687581 TGCTGCAATATGAATGCAGCTGG - Intronic
976576334 4:86676706-86676728 TGCTACAATATGGATGAACCTGG + Intronic
976916918 4:90387584-90387606 TCATGCAATATCAGTCAACTTGG + Intronic
977158478 4:93604385-93604407 TGATGAAATTTGAATGAATAAGG + Intronic
977670425 4:99688726-99688748 AATTGCAATATGGATGAACTTGG - Intergenic
977824437 4:101513610-101513632 TGATTACATATGAATGAATTTGG + Intronic
978758811 4:112332942-112332964 TGATGCACTTTCAAAGAACTTGG + Intronic
978851690 4:113345139-113345161 TGATGCAATATGAATGAACTTGG + Intronic
979639533 4:122997437-122997459 TGCTGCAACATGCATGAACCTGG - Intronic
979661094 4:123255981-123256003 TGAGGCAACATGAATTAACTGGG - Intronic
979719230 4:123879668-123879690 TGAAGCAACATGAATGCAGTTGG + Intergenic
979769982 4:124511647-124511669 TGCTGCAACATGAATGATCATGG + Intergenic
980210640 4:129782951-129782973 TTATGAATTATGGATGAACTGGG + Intergenic
980304157 4:131034986-131035008 TGAGACAACATGAATGAATTTGG - Intergenic
980390028 4:132132878-132132900 TGATTCAATATAAAGGAACATGG + Intergenic
980803457 4:137783244-137783266 TGTTGCCATATAAATGAATTAGG + Intergenic
981751924 4:148100907-148100929 TGCTGCAACATGGACGAACTTGG + Intronic
982498111 4:156117674-156117696 TTATGTAAGATGAATAAACTTGG - Intergenic
982507212 4:156234564-156234586 TGGAGCAATATGGATGAACTTGG - Intergenic
983023135 4:162704276-162704298 TGAGACAACATGAATGAACTTGG + Intergenic
983326583 4:166265469-166265491 TGCAGCAATATGGATGAACCCGG - Intergenic
983417450 4:167476764-167476786 TGATGCAATGGTAATAAACTTGG + Intergenic
983631740 4:169856379-169856401 TGCTTCAATGTGGATGAACTTGG + Intergenic
983666021 4:170184428-170184450 TGTGACAAGATGAATGAACTTGG - Intergenic
984446807 4:179847871-179847893 TTCTGCAACATGAATGAACCTGG + Intergenic
984783599 4:183548246-183548268 TGTGACAATATGAATGAACATGG - Intergenic
985933595 5:3078372-3078394 TTATGCAGGATGAATGAACCTGG + Intergenic
986259470 5:6131646-6131668 TGAAGCAATCTGGATGAAATTGG + Intergenic
986652936 5:9982317-9982339 TACTACAATATGGATGAACTTGG + Intergenic
986902016 5:12447473-12447495 TGCTGCAATATGAATGCAGCTGG - Intergenic
988140185 5:27228216-27228238 TGTAACAACATGAATGAACTTGG + Intergenic
988174134 5:27698579-27698601 TGCTACAACATGGATGAACTTGG - Intergenic
988401680 5:30769502-30769524 TGAAGCAATGTGAATGACCCAGG + Intergenic
988915342 5:35887896-35887918 TGCTGCAATATGGATGAGATAGG - Intergenic
989013414 5:36900769-36900791 TCATGCAATGTAAATGAAATTGG - Intronic
989420027 5:41226752-41226774 TGAGGCAACATGGATGAACCTGG - Intronic
990174758 5:53095081-53095103 CAATGCAATATGAATCACCTGGG - Intergenic
990195574 5:53311295-53311317 TAATGCAATAGTAAAGAACTTGG - Intergenic
990613988 5:57488389-57488411 TCATGCAATGTGAATTATCTCGG - Intergenic
990903927 5:60782646-60782668 TGTGACAATATGGATGAACTTGG + Intronic
991443688 5:66678101-66678123 TGCTGCAACATGGATGAACCTGG + Intronic
992552809 5:77875107-77875129 TGATGCATAATGCATCAACTGGG - Intergenic
993182775 5:84575930-84575952 TGTGACAACATGAATGAACTTGG - Intergenic
994499960 5:100562557-100562579 TCTTGCAATATGTATTAACTTGG + Intronic
994590514 5:101766697-101766719 TGCAGCAATATGAATGAACCTGG - Intergenic
996311065 5:122106085-122106107 TAATGCAATATGAATTTGCTGGG + Intergenic
996529702 5:124515309-124515331 TGAAACAAAATGAATGAATTTGG + Intergenic
996707353 5:126511038-126511060 TGGAACAACATGAATGAACTTGG - Intergenic
996852996 5:127973556-127973578 TGAGGCAACATGGATGAACCTGG + Intergenic
996969489 5:129346494-129346516 TGCAGCAAAATGGATGAACTTGG - Intergenic
997906689 5:137823980-137824002 TGTGACAATATGAATGAACCTGG + Intergenic
998433961 5:142091015-142091037 TGCTATAATATGAATGAACTTGG + Intergenic
998452752 5:142247309-142247331 TTTTACAAGATGAATGAACTGGG + Intergenic
998801019 5:145869292-145869314 TTATGCAATATGTATAAAGTAGG + Intronic
999013055 5:148063972-148063994 TGGTGCAGTATGACTGAACTCGG - Exonic
999038435 5:148380276-148380298 GGAGGCAATATGGATGAACCTGG - Intergenic
999110795 5:149119548-149119570 TGCTGCAATATGGATGAACCTGG + Intergenic
999433119 5:151540793-151540815 CCAAGCAATAGGAATGAACTAGG + Intronic
999549364 5:152668703-152668725 TGAGACAACATGGATGAACTTGG + Intergenic
1000829552 5:166085759-166085781 TGATCCAATGCTAATGAACTGGG - Intergenic
1002351616 5:178587929-178587951 TGGTGCAGTATGAATGCAGTTGG - Intronic
1002788263 6:420007-420029 TGCTGCAACATGAACGAACCTGG - Intergenic
1004139100 6:12999255-12999277 ACAGGAAATATGAATGAACTAGG + Intronic
1005632888 6:27725233-27725255 TAATGCTAAATGAATGAACGTGG + Intergenic
1005854322 6:29849175-29849197 TGCTGCAACATGGATGAACCTGG + Intergenic
1007618271 6:43195490-43195512 TGAAGCAATGTGAATGGACCTGG + Intronic
1007806580 6:44454569-44454591 TGCTGTAACATGGATGAACTTGG + Intergenic
1008193498 6:48489318-48489340 TGTGGCAACATGAATGAACCTGG + Intergenic
1008200909 6:48588902-48588924 TGCAGCATTATGAATAAACTAGG + Intergenic
1008226834 6:48929723-48929745 TGAAACAACATGGATGAACTTGG - Intergenic
1008312988 6:50001029-50001051 TGCAGCAACATGAATGAAATCGG + Intergenic
1008364996 6:50667838-50667860 GGATTAAATGTGAATGAACTTGG - Intergenic
1008766560 6:54924128-54924150 TGTTACAACATGAATGAACCCGG - Intronic
1009425321 6:63507254-63507276 TGATGGAATAAGAAATAACTTGG - Intergenic
1009493471 6:64321703-64321725 TAAGGCCATATGGATGAACTTGG + Intronic
1009547915 6:65045983-65046005 TGATGCAATAATAATGAAACAGG - Intronic
1011501026 6:87990053-87990075 TGTGACAATATGGATGAACTTGG + Intergenic
1011908583 6:92405847-92405869 TTATACAACATGAATGAACTTGG - Intergenic
1012106823 6:95171994-95172016 TGCTGCTAAATGAATGAATTGGG + Intergenic
1012256037 6:97033320-97033342 TGCAACAATATGGATGAACTTGG - Intronic
1013576941 6:111493094-111493116 TGATGCAAAGTGAAAAAACTAGG - Intergenic
1013668512 6:112373097-112373119 AGATGTAATATATATGAACTAGG + Intergenic
1014730228 6:125023767-125023789 TGCAGCAATATGGATGAACCTGG + Intronic
1014798818 6:125755289-125755311 TAATGAAATCTGAGTGAACTAGG - Intronic
1016278670 6:142386620-142386642 TGATACAGTATGAAAGCACTCGG - Intronic
1016437436 6:144051565-144051587 TAATACAATATGTTTGAACTTGG - Intronic
1020732737 7:11904233-11904255 GCAGGCAACATGAATGAACTTGG + Intergenic
1021302000 7:18984654-18984676 TCATGAAATATCAATGAAATGGG + Intronic
1021381404 7:19971122-19971144 TGCTAAAATATGAATGAATTAGG - Intergenic
1021527320 7:21603202-21603224 TGCTACAATGTGAATGAACCTGG - Intronic
1023287677 7:38636073-38636095 TGATGCATTATTAATGTATTAGG - Intergenic
1023392707 7:39725491-39725513 TGTTGCAACATACATGAACTTGG + Intergenic
1023517749 7:41018833-41018855 TTATCCAATATAATTGAACTTGG + Intergenic
1024161081 7:46677043-46677065 TGCCACAATATGGATGAACTTGG + Intronic
1024662083 7:51506437-51506459 TGTGGCAACATGAATGAACCTGG - Intergenic
1024680135 7:51677873-51677895 TGTGACAATATGAATGAACCTGG + Intergenic
1027429999 7:78102049-78102071 TGTGACAATGTGAATGAACTTGG + Intronic
1027840187 7:83299721-83299743 TGTAACAATATGAATGAACCTGG - Intergenic
1027854585 7:83493395-83493417 TGAGGCAATATGAATGAATCAGG - Intronic
1028483510 7:91333767-91333789 TGATGTAATAAGAAGGAATTAGG - Intergenic
1028635503 7:92984755-92984777 TGATTCAATAAGAATGAAGTAGG - Intergenic
1029057072 7:97758029-97758051 TGATGCAATGATAATAAACTGGG + Intergenic
1029964907 7:104729666-104729688 TGCAGCAACATGAATGAACCTGG - Intronic
1030802684 7:113871729-113871751 TGTAGCAATATGGATGAGCTTGG + Intergenic
1031205020 7:118745282-118745304 TGATGAAAAATGAATGAAGTGGG + Intergenic
1031819147 7:126477085-126477107 TGGTACAACATGGATGAACTTGG + Intronic
1032219861 7:129986312-129986334 TGTGGCAACATGAATGAGCTTGG + Intergenic
1032412623 7:131708894-131708916 TGATACAATAAGAATGAAATCGG - Intergenic
1032955629 7:136968795-136968817 TGCTGCAATATGGATGAAACTGG + Intronic
1033638149 7:143232286-143232308 TGGAGCAATACGAATGAGCTTGG - Intergenic
1033925971 7:146460668-146460690 TGTGACAACATGAATGAACTGGG + Intronic
1034832131 7:154318605-154318627 TGTTGCAATAGGTGTGAACTGGG - Intronic
1036431988 8:8700306-8700328 TGCTACAATATGGATGAACCTGG + Intergenic
1036721843 8:11183012-11183034 TGCTGCAACATGGATGAACCTGG - Intronic
1036811640 8:11870924-11870946 GGATGCATAATGAATGAAGTAGG + Intergenic
1037045168 8:14291032-14291054 TGCAGCAACATGGATGAACTTGG + Intronic
1038817640 8:30921786-30921808 TGCTACAGTATGAATGAACCTGG + Intergenic
1039672483 8:39617683-39617705 TGTAGCAATATGAATGGACTTGG + Intronic
1039712420 8:40069206-40069228 TTACAAAATATGAATGAACTAGG + Intergenic
1040717347 8:50273110-50273132 TGATGAAATTTGAATCAACATGG + Intronic
1040793461 8:51262355-51262377 TGAGACAATATGAATGAAACTGG + Intergenic
1041620415 8:59961058-59961080 TGTTGCAATAAGAAGGAACAGGG - Intergenic
1042181466 8:66091859-66091881 TGCTACAATATGGATGAACCTGG + Intronic
1043264353 8:78244655-78244677 TGATGACAAATGAATGAAGTGGG + Intergenic
1043346669 8:79305608-79305630 TGTGACAACATGAATGAACTTGG - Intergenic
1043369005 8:79569212-79569234 TGATGTAACATGAATGACATGGG - Intergenic
1044350211 8:91155781-91155803 CGAGGCAATATGGATGAACCTGG - Intronic
1044419012 8:91969894-91969916 TGATGCTATATTAATTAACGTGG + Intronic
1045628820 8:104090693-104090715 TGATGGAATATGGATGAACCTGG + Intronic
1046343573 8:112891568-112891590 CCATGCTAAATGAATGAACTAGG - Intronic
1046462534 8:114559358-114559380 TGCAGCAACATGAATAAACTTGG + Intergenic
1046882193 8:119321242-119321264 TGAGTCAATATGAATGACCTTGG - Intergenic
1048458035 8:134595864-134595886 TGATGCAACTGGAAAGAACTTGG + Intronic
1048894045 8:138972936-138972958 TGATATAACATGGATGAACTTGG - Intergenic
1050453766 9:5812002-5812024 GTATGCAATGTGAATGAGCTAGG - Intronic
1050682030 9:8122683-8122705 TGATGCAATAGGAAGCAACTAGG - Intergenic
1050809223 9:9722366-9722388 TGCTGTAATATGAATGAATCTGG - Intronic
1050953401 9:11626039-11626061 TGCTGCAACATGGATGAACCTGG + Intergenic
1050964140 9:11776064-11776086 AAAGGCAATATGAATGAACCTGG - Intergenic
1051046126 9:12875882-12875904 TGCTGCATCATGAATGAACCTGG + Intergenic
1051208135 9:14711798-14711820 TGTAACAACATGAATGAACTTGG + Intergenic
1052584484 9:30408727-30408749 TGAGACAATGTGAATGAACTTGG + Intergenic
1052622461 9:30931625-30931647 TAATGCAATATGAATTACCTAGG - Intergenic
1052922759 9:33985511-33985533 TGGAGCAACATGAATGGACTTGG + Intronic
1053193720 9:36097875-36097897 TGCAACAATATGAATGAACCTGG + Intronic
1054950849 9:70849486-70849508 TGATCCAAAATGGATGATCTGGG + Intronic
1055904733 9:81279566-81279588 TGATGCTAGATCAATGATCTGGG - Intergenic
1056343604 9:85665758-85665780 TGTTGCCATCTGAAAGAACTGGG - Intronic
1056396140 9:86182865-86182887 TGATAAAATGTGAATGAATTTGG + Intergenic
1057329823 9:94103511-94103533 TGAAGCAATATAAATGCCCTAGG - Intronic
1057444760 9:95105773-95105795 TGCTACAACATGAATGAACCTGG - Intronic
1057989486 9:99753149-99753171 TAATGCAAAATACATGAACTGGG + Intergenic
1058012664 9:99995668-99995690 TGTAACAACATGAATGAACTAGG - Intronic
1058316845 9:103579236-103579258 TGCAGCAACATGAATGAACCTGG + Intergenic
1059026397 9:110637406-110637428 TCATGAAATATGAATGAATGAGG + Intergenic
1059336136 9:113569508-113569530 TGCTGCTATTTGAATCAACTGGG - Intronic
1061742875 9:132720141-132720163 TGCTACAATATGGATGAACCTGG + Intergenic
1185886918 X:3791210-3791232 TGCTGCAACATGAATGAACTTGG - Intergenic
1186139185 X:6553133-6553155 TGATGCAATATGGATGCAGCTGG + Intergenic
1187000614 X:15173019-15173041 TGATGGAACATCACTGAACTTGG - Intergenic
1187660017 X:21534230-21534252 TGCTGCAACATGAATGAACCTGG - Intronic
1188699466 X:33240359-33240381 TGCAGCAACATGAATGAACCTGG - Intronic
1188724576 X:33566550-33566572 TGCAGCAATGTGAATGATCTTGG - Intergenic
1188875071 X:35419417-35419439 TGCTACAACATGAATGAACCTGG - Intergenic
1190559855 X:51676576-51676598 TGTGGCAACATGAATGAACCTGG - Intergenic
1190564436 X:51716745-51716767 TGTGGCAACATGAATGAACCTGG + Intergenic
1191096908 X:56682685-56682707 TGTAGCAATATGAATGAAGCTGG + Intergenic
1191806347 X:65138377-65138399 TGTGGCAATACGAATGAACCTGG - Intergenic
1192098884 X:68242762-68242784 TGCTACAACATGAATGAACCTGG + Intronic
1192637683 X:72835080-72835102 CGAGGCAACATGAATGAACCTGG + Intronic
1192644031 X:72885735-72885757 CGAGGCAACATGAATGAACCTGG - Intronic
1194281532 X:91959587-91959609 TGCAGCAACTTGAATGAACTTGG - Intronic
1194740688 X:97570365-97570387 TGATGAGAGATGAATGAATTTGG + Intronic
1195680712 X:107544068-107544090 TGCTACAACATGGATGAACTTGG + Intronic
1195819798 X:108931500-108931522 TGCAACAATATGAATGAAATTGG - Intergenic
1196140381 X:112254853-112254875 TCATGAGATATGAGTGAACTAGG + Intergenic
1196291059 X:113941725-113941747 TGTGACAATATGAATGAACCTGG + Intergenic
1196518379 X:116640951-116640973 TCATATAATATGAATGAACCTGG + Intergenic
1197295299 X:124711987-124712009 TGCTACAACATGGATGAACTTGG - Intronic
1197798273 X:130320939-130320961 TGAAGCAATATGAATGAATCTGG - Intergenic
1197877064 X:131120797-131120819 TGAAGTAATTTGAATAAACTTGG + Intergenic
1198160845 X:134006510-134006532 TGATACAACATGGATGAACGTGG + Intergenic
1198993969 X:142551599-142551621 TGAAGCAACATTAATGAACATGG + Intergenic
1200599124 Y:5184242-5184264 TGCAGCAACTTGAATGAACTTGG - Intronic
1200973426 Y:9180664-9180686 TTATGCAAAATAAATGAATTTGG - Intergenic
1201459238 Y:14203847-14203869 TAATACACTATGAATTAACTAGG + Intergenic