ID: 978852298 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:113353749-113353771 |
| Sequence | AAGCAGAAACAAAAAGAGGA AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2306 | |||
| Summary | {0: 1, 1: 0, 2: 13, 3: 185, 4: 2107} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 978852294_978852298 | 22 | Left | 978852294 | 4:113353704-113353726 | CCAAGCTTGGGAATAAAGAAGCC | 0: 1 1: 0 2: 0 3: 15 4: 168 |
||
| Right | 978852298 | 4:113353749-113353771 | AAGCAGAAACAAAAAGAGGAAGG | 0: 1 1: 0 2: 13 3: 185 4: 2107 |
||||
| 978852296_978852298 | 1 | Left | 978852296 | 4:113353725-113353747 | CCAGTAAGAAGGAAATTAAAAGA | 0: 1 1: 0 2: 4 3: 54 4: 523 |
||
| Right | 978852298 | 4:113353749-113353771 | AAGCAGAAACAAAAAGAGGAAGG | 0: 1 1: 0 2: 13 3: 185 4: 2107 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 978852298 | Original CRISPR | AAGCAGAAACAAAAAGAGGA AGG | Exonic | ||
| Too many off-targets to display for this crispr | |||||