ID: 978852298

View in Genome Browser
Species Human (GRCh38)
Location 4:113353749-113353771
Sequence AAGCAGAAACAAAAAGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2306
Summary {0: 1, 1: 0, 2: 13, 3: 185, 4: 2107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978852294_978852298 22 Left 978852294 4:113353704-113353726 CCAAGCTTGGGAATAAAGAAGCC 0: 1
1: 0
2: 0
3: 15
4: 168
Right 978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG 0: 1
1: 0
2: 13
3: 185
4: 2107
978852296_978852298 1 Left 978852296 4:113353725-113353747 CCAGTAAGAAGGAAATTAAAAGA 0: 1
1: 0
2: 4
3: 54
4: 523
Right 978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG 0: 1
1: 0
2: 13
3: 185
4: 2107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978852298 Original CRISPR AAGCAGAAACAAAAAGAGGA AGG Exonic
Too many off-targets to display for this crispr