ID: 978853271

View in Genome Browser
Species Human (GRCh38)
Location 4:113363859-113363881
Sequence CAGCTCAGAGCACTTTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978853271_978853278 21 Left 978853271 4:113363859-113363881 CCCATGCAAAGTGCTCTGAGCTG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 978853278 4:113363903-113363925 TGAGACCCTGAACTGAATAAGGG 0: 1
1: 0
2: 10
3: 399
4: 475
978853271_978853283 28 Left 978853271 4:113363859-113363881 CCCATGCAAAGTGCTCTGAGCTG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 978853283 4:113363910-113363932 CTGAACTGAATAAGGGGATTGGG 0: 1
1: 0
2: 1
3: 17
4: 150
978853271_978853277 20 Left 978853271 4:113363859-113363881 CCCATGCAAAGTGCTCTGAGCTG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 978853277 4:113363902-113363924 TTGAGACCCTGAACTGAATAAGG No data
978853271_978853282 27 Left 978853271 4:113363859-113363881 CCCATGCAAAGTGCTCTGAGCTG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 978853282 4:113363909-113363931 CCTGAACTGAATAAGGGGATTGG No data
978853271_978853279 22 Left 978853271 4:113363859-113363881 CCCATGCAAAGTGCTCTGAGCTG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 978853279 4:113363904-113363926 GAGACCCTGAACTGAATAAGGGG 0: 1
1: 1
2: 2
3: 27
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978853271 Original CRISPR CAGCTCAGAGCACTTTGCAT GGG (reversed) Intronic
900504167 1:3021010-3021032 CAGCCCAGAGGGCTTTGAATAGG + Intergenic
907300068 1:53481491-53481513 CAGCACAGAGCCCTCTGCCTTGG - Intergenic
909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG + Intergenic
913598921 1:120404607-120404629 CAGCCCAGAGGGCTTTGGATTGG - Intergenic
914088456 1:144475013-144475035 CAGCCCAGAGGGCTTTGGATTGG + Intergenic
914310156 1:146459197-146459219 CAGCCCAGAGGGCTTTGGATTGG - Intergenic
914379683 1:147104988-147105010 CAGCCCAGAGGGCTTTGGATTGG + Intergenic
914591954 1:149113942-149113964 CAGCCCAGAGGGCTTTGGATTGG + Intergenic
917036431 1:170752050-170752072 CAGGTCTGAGCACTGAGCATAGG - Intergenic
918951823 1:191150311-191150333 CTGCTCAGAGTCCCTTGCATTGG - Intergenic
920543870 1:206799555-206799577 CATCTCTGAGCAGTTTGCAGAGG + Intronic
921360489 1:214326996-214327018 AAGCTCAAAGCACCTCGCATAGG + Intronic
922447527 1:225710081-225710103 CAGCTAAGAGGAAGTTGCATTGG + Intergenic
924762332 1:246999988-247000010 CAGCTCAGCGGAGTTTGTATAGG - Exonic
1065873770 10:29979593-29979615 CAGATAAGAGCACATTCCATGGG + Intergenic
1071979348 10:90987948-90987970 CAGCTGAGACCAGTTTGCCTGGG - Intergenic
1073452613 10:103618677-103618699 GAGCTCACAGCACTTCCCATCGG - Intronic
1074299360 10:112219343-112219365 CAGGTGAAAGCACTTTGCACTGG - Intergenic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1075214168 10:120517385-120517407 AAGCTCAGAGCACTGTGGAGAGG - Intronic
1075563549 10:123486465-123486487 CACGTGAGAGGACTTTGCATCGG + Intergenic
1076933131 10:133547162-133547184 CCACTGAGAGAACTTTGCATTGG - Intronic
1078453412 11:11457007-11457029 CAGCTCTGAGCGTTGTGCATGGG + Intronic
1078921550 11:15835617-15835639 CATCACAGAGCACTCTGCCTGGG - Intergenic
1079131401 11:17748906-17748928 CAGCTCAGAGAACCGTGTATGGG - Intronic
1079135519 11:17774193-17774215 CAGCTCCGAGCTCTCTGCTTTGG + Intronic
1081535548 11:43993533-43993555 CAGCTAAGAGCACTTTGCCATGG - Intergenic
1082629877 11:55529570-55529592 ATGCTCAGAACACTTTACATTGG + Intergenic
1083641072 11:64145620-64145642 CAGCCCAGAGCAGTGAGCATGGG - Intronic
1084092327 11:66886809-66886831 CAGCTCAGAACTCTTTACACAGG - Intronic
1085466507 11:76727448-76727470 CAGCACAGAGCACTAGGCTTTGG - Intergenic
1086091328 11:83007981-83008003 AAGCCCAGAGCTCTTTGCAGTGG - Intronic
1086753919 11:90534245-90534267 CACCTCAGCGCACATTTCATTGG - Intergenic
1089184576 11:116606198-116606220 CAGGGCACAGCACTTTGCCTGGG - Intergenic
1091848077 12:3672944-3672966 CAGATCAGCCCACTTTGCAGAGG - Intronic
1093237155 12:16624842-16624864 CATCTCAGACCAATTGGCATGGG - Intergenic
1096954504 12:55512001-55512023 CAGCTCAAAGTTCTTTCCATTGG + Intergenic
1101338526 12:103819567-103819589 CAGCTCAGAGTGGCTTGCATTGG - Intronic
1101561493 12:105861886-105861908 CATCTCAGAACACTCTGCTTGGG - Intergenic
1104182062 12:126391205-126391227 AAGATCAGAGCCCTTTGCATTGG + Intergenic
1104485187 12:129145485-129145507 CAGCTCCGTGCACTCTGCCTGGG + Intronic
1105607608 13:21939746-21939768 ATGCTCAGAGCACCTTCCATGGG - Intergenic
1107706930 13:43117249-43117271 CCTCTCAAAGCACTTTGGATGGG - Intergenic
1112401391 13:99081572-99081594 CAGGTCACATCCCTTTGCATGGG - Intronic
1113262527 13:108580772-108580794 CAGTTCAGAGTACTTTACAGTGG + Intergenic
1113984306 13:114301615-114301637 CAGCGCTGAGCACTTCGCATGGG + Intronic
1115309161 14:31962161-31962183 CTGCTCAGAGCTCTGAGCATAGG + Intergenic
1118744741 14:68765773-68765795 GAGTTCAGAGCATTCTGCATTGG + Intergenic
1118909849 14:70052172-70052194 CAGCTCAGAGTATTAGGCATGGG + Intronic
1120316381 14:82898753-82898775 CTGCTCACAGCACTTTTCACTGG - Intergenic
1120543345 14:85778498-85778520 CAGCTCAGAGGACCTTACAAGGG + Intergenic
1121601231 14:95204620-95204642 CATCTTAGAACACTTTGCATTGG - Intronic
1122273174 14:100577523-100577545 CAGCCCAGAGCCCTCTGCAGTGG - Intronic
1122302795 14:100740652-100740674 TAGCCCAGAGCACTGTGCAAAGG - Intergenic
1122531661 14:102432052-102432074 CAGCTCAGAGGACTTTGACCAGG + Exonic
1124891838 15:33740870-33740892 CAGCTCAAAGCTCTTTCCAACGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1128805537 15:70528254-70528276 CAACTCAGAGCAATTAGAATTGG - Intergenic
1129341869 15:74891522-74891544 CAACTGAGAGCACTTTGAAGAGG - Exonic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130295755 15:82646550-82646572 CAGCTGAGAGCACGGTGCAAGGG + Intronic
1131590810 15:93746726-93746748 CTGCTCACAGCTCTGTGCATAGG - Intergenic
1135072985 16:19368690-19368712 CAGCACAGAGCTCTTTGGAGAGG + Intergenic
1135923605 16:26673022-26673044 CATCACAGAGCATTTTACATAGG + Intergenic
1137996773 16:53224120-53224142 CAGCCCACAGCACTTTACATAGG - Intronic
1143399661 17:6635979-6636001 ATGCTCAGAGCACTTTGTAATGG - Intronic
1144209044 17:12999543-12999565 CTGCTCAGAGCTCTTTCCACAGG + Intronic
1146533318 17:33628988-33629010 AAGCTGAGAGGACTTTGGATGGG - Intronic
1148575949 17:48711363-48711385 CAGCTCTGAGAAATTTGGATGGG - Intergenic
1150388678 17:64778920-64778942 CAGCACAGAGCACTGAGCATTGG - Intergenic
1153176153 18:2376048-2376070 CAGTTCAGAGCTCTTTTCACGGG - Intergenic
1155287984 18:24310955-24310977 CAGATCAGTGAACTTTGCAAAGG - Intronic
1155934220 18:31738649-31738671 GAGCTCAAAGCACTGTGCAGTGG + Intergenic
1157099247 18:44714546-44714568 CAGCTCTGTGTATTTTGCATTGG + Intronic
1157826730 18:50819226-50819248 CAGCTCACAGGACATTGCCTGGG - Intronic
1158918570 18:62163614-62163636 CAGCTCATCTCACTTTGCACAGG + Exonic
1159086869 18:63802456-63802478 AAGCTCAGAGCACATGGCCTGGG - Intronic
1160408169 18:78656888-78656910 CACCTCAGGGCACTTTGAAGTGG + Intergenic
1161183753 19:2902141-2902163 CAGCTCAGAGAACCTTACAGGGG + Intronic
1161962476 19:7530190-7530212 CAGCTCCTAGCCATTTGCATGGG + Intronic
1165771676 19:38384102-38384124 CAGCACAAACCACTTTGCAAAGG - Intergenic
1165969067 19:39610101-39610123 CAGCTCAGTGCACTTCCTATGGG + Intergenic
1167966188 19:53149281-53149303 CCGCTCAGAGGACTTTGTACAGG - Exonic
925733688 2:6942307-6942329 CATCTCAGAGGACGTTGCAGAGG + Intronic
925883999 2:8378672-8378694 CGGCTCAGAGAACCATGCATGGG - Intergenic
928139096 2:28712298-28712320 CAGCACAGAGTACTAGGCATAGG - Intergenic
929295551 2:40242456-40242478 CTGCTCAGAGCACATGCCATAGG - Intronic
931164569 2:59733097-59733119 CAGCTCTGAGGACTTTGCTGAGG - Intergenic
931376723 2:61714409-61714431 CAGCACAGAGAACATTCCATCGG - Intergenic
933997466 2:87680311-87680333 CAGCTCAGAGCACCTTTGTTGGG + Intergenic
935816100 2:106847324-106847346 CAGCTCAAAGCACTGTCCCTGGG - Intronic
936296386 2:111270601-111270623 CAGCTCAGAGCACCTTTGTTGGG - Intergenic
939695427 2:145317412-145317434 CAGTTACGAGCACTCTGCATGGG + Intergenic
940772178 2:157851122-157851144 CTGCCCATAGCAGTTTGCATTGG - Intronic
941717987 2:168783803-168783825 CAGCTCATACCAGCTTGCATGGG + Intergenic
942931047 2:181492901-181492923 CTGCTCTAAGCACTTTACATAGG + Intronic
943176576 2:184482444-184482466 CATCTGAGAGCAGTTTTCATAGG - Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945048677 2:205803174-205803196 CAGCTCTCTGCACTTTGCTTTGG - Intergenic
947076894 2:226354775-226354797 CAGCTCACAGCACTAAGCAGGGG - Intergenic
948073376 2:235145685-235145707 CAGCTGAGGGCATTTTGCAGAGG + Intergenic
948246933 2:236494694-236494716 CAGCCCAGAGAATTTTGGATAGG + Intronic
948259357 2:236591343-236591365 CATCTAAGAGCACTTGTCATTGG + Intergenic
948299551 2:236892199-236892221 AAAGTCAGAGCACTTTGCACCGG + Intergenic
1170308185 20:14963117-14963139 TAGCTCAGAGCACAGTGCATTGG + Intronic
1170770353 20:19327355-19327377 TACCTGAGGGCACTTTGCATGGG - Intronic
1172158382 20:32846167-32846189 AGGGTCAGAGCACTTTCCATTGG + Intronic
1174537814 20:51266323-51266345 CAGAGCAGGGCACTTTGTATTGG - Intergenic
1175069923 20:56324605-56324627 CAGCCCATAGCACTGTGCATAGG + Intergenic
1175198424 20:57262369-57262391 CAGCTCAGTTCACATTGCCTGGG + Intronic
1175931511 20:62495956-62495978 CAGCTCAGCTCAGTTTGCAGAGG + Intergenic
1176416623 21:6479120-6479142 CAGCTCAGAGCTGTCTTCATGGG - Intergenic
1180066867 21:45416769-45416791 CAGCACAGCTCACTTTGCCTGGG + Intronic
1182547193 22:31083170-31083192 CAGCTCAGAGAATTCTGCAGGGG - Exonic
1183215384 22:36476268-36476290 GAGCTCAGAGCACTTTGCAGAGG - Intronic
1183283879 22:36950736-36950758 CAGCTTAGCCCACTGTGCATGGG + Intergenic
1185073905 22:48672736-48672758 CACCTTTGGGCACTTTGCATGGG + Intronic
950190957 3:10975818-10975840 TAGCTTACAGCACTTAGCATTGG - Intergenic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
953664244 3:44914703-44914725 CTCCTCAGAGCACCTTGCCTGGG - Exonic
956878703 3:73489105-73489127 CTGCTCAGTGCACTGTGCCTTGG - Intronic
959305653 3:104662375-104662397 AATCTCTGAGCACTTTCCATTGG - Intergenic
961424757 3:126836286-126836308 CCACTCAGAGGCCTTTGCATTGG + Intronic
961795336 3:129404739-129404761 CAGCTCAGACCTCGTTGCACCGG - Intronic
962332798 3:134494489-134494511 CAGCTGTGACCAGTTTGCATGGG + Intronic
963953551 3:151228531-151228553 AAGCTCAGAGCACTCTGCAAAGG - Intronic
966625260 3:182008927-182008949 CAGCCCAGGGCACTTTGTAATGG + Intergenic
966912059 3:184565216-184565238 AAGCCCAGGGCAATTTGCATGGG - Intronic
969280525 4:6167510-6167532 AAGCTCAGGGCCCTTTGCAGTGG - Intronic
969354348 4:6616608-6616630 CACTTCAGCTCACTTTGCATTGG + Intronic
969700323 4:8764385-8764407 CACTTCTGAGCACTTTGCATAGG + Intergenic
971153403 4:24057897-24057919 CTGCTCAGAGCCCATTGCTTTGG - Intergenic
973158882 4:46992458-46992480 TCGCTCAGAGCAGGTTGCATTGG - Intronic
975674128 4:76809947-76809969 CAGCTGAGGGCACTTAGCCTAGG + Intergenic
976876628 4:89861340-89861362 CAGCTCAGTGCACTTTTCACTGG - Intergenic
978853271 4:113363859-113363881 CAGCTCAGAGCACTTTGCATGGG - Intronic
983850743 4:172577565-172577587 CACCTCAGAGCACTGTGTTTGGG + Intronic
985207601 4:187556217-187556239 CTCCTCACAGCACTTAGCATGGG + Intergenic
987326076 5:16812544-16812566 CAGCTCACAGCACATGGCCTTGG - Intronic
990086758 5:51987948-51987970 GATCACAGAGCACTTTGCAGGGG - Intergenic
992133798 5:73721836-73721858 CAGGCCAGTGCCCTTTGCATGGG + Intronic
992654053 5:78890750-78890772 AAGCTCAGGGCACTTTTTATGGG - Intronic
993019704 5:82576873-82576895 CAGTCCACAGCACTTTCCATTGG + Intergenic
994057100 5:95429367-95429389 GAGCACAGAAAACTTTGCATTGG - Intronic
996662870 5:126025580-126025602 TAGCTCAGAGTGCTTGGCATTGG - Intergenic
999713344 5:154338397-154338419 CAGCTGAGGACACTTTTCATTGG - Intronic
1001608910 5:172984046-172984068 CGGGTCAGAGAACGTTGCATGGG + Intronic
1003998701 6:11571364-11571386 CAGATCACATCACTTTTCATTGG + Intronic
1009792334 6:68419837-68419859 CATTTCAGAGAACTTTGCAGTGG + Intergenic
1011148039 6:84240486-84240508 CTGCTTAGAGCTCTTTGCACTGG - Intergenic
1011215598 6:85002510-85002532 CACCTCAGAGCACTCAGCATTGG + Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1015913801 6:138194513-138194535 CAGGGCAGAGCAATTTCCATAGG + Intronic
1016417193 6:143845157-143845179 TAGCTCAGGGAACTTTGCAAGGG + Intronic
1017261646 6:152394554-152394576 CAGATCAGGGAACTTTGCCTGGG + Intronic
1018105908 6:160486210-160486232 CAGTTCAGAGTCCTTTTCATGGG + Intergenic
1018698524 6:166409197-166409219 CAACTCAGAGCCCTGTGCGTGGG - Intergenic
1019126363 6:169843084-169843106 CAGCTCACACCTCTTTGCTTGGG - Intergenic
1019929505 7:4214490-4214512 AATCTCAGAGCACATTGCCTCGG - Intronic
1020503978 7:8960087-8960109 CAGCTCAAAGAATTTTGCTTAGG - Intergenic
1023215105 7:37853781-37853803 CAGCTCAGGGCAATTTTAATAGG - Intronic
1023296321 7:38718445-38718467 CATCTGAGAACACTTTGCTTAGG - Intergenic
1024417041 7:49119671-49119693 CAGCTCAGAACCCTTTCCCTGGG - Intergenic
1025238170 7:57248981-57249003 CTGCTCAGTGGAATTTGCATAGG - Intergenic
1028635733 7:92987145-92987167 AAACTGAGAGCTCTTTGCATAGG - Intergenic
1028638656 7:93018900-93018922 CAGCTCATAGCAGTTTGAAATGG - Intergenic
1029460604 7:100692021-100692043 CAACACAGAGCACTGTGCCTTGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1032189097 7:129752775-129752797 CAGTTAAGAGCAATTTGCAAAGG + Intronic
1033280864 7:140005499-140005521 CCGCACAGAGCCCTTTTCATTGG + Intronic
1033317580 7:140310468-140310490 CAGCCAAGGTCACTTTGCATGGG + Intronic
1034526949 7:151670716-151670738 CAGCTCCGTGCATTATGCATAGG - Intronic
1034695481 7:153049310-153049332 CAGCTCTGAGCTCATTGCCTGGG + Intergenic
1035399204 7:158553805-158553827 CAGCTCCTAACACATTGCATCGG + Intronic
1037193972 8:16165035-16165057 CAGCTCAAAACACTATGAATAGG - Intronic
1038063308 8:23936322-23936344 CAGCTCTGAGAACTTTGCGCGGG + Intergenic
1041730213 8:61054785-61054807 AAGCTCAGAGCTCTTCCCATGGG - Intergenic
1042120473 8:65481972-65481994 TGGCTCAGAGCAGTTTCCATTGG + Intergenic
1047505159 8:125473776-125473798 CCTCGCAGAGCCCTTTGCATGGG + Intergenic
1047560814 8:125986746-125986768 CAACTCAAGGCACTTTGCCTTGG - Intergenic
1052348548 9:27434829-27434851 CAACTGAGAGCCCTTTGCAGTGG - Intronic
1055488181 9:76777422-76777444 GAGCTCAGAGCTCTGTGCCTGGG - Intronic
1059200135 9:112407053-112407075 CACCCCACAGCACTCTGCATTGG - Intronic
1059427368 9:114229555-114229577 CACCTCAGAGCACTTGCCAGGGG + Intronic
1062295260 9:135821849-135821871 CAGGCCGGAGCACTTTGCAAAGG - Exonic
1062362730 9:136195344-136195366 CAGCTCAGAGCAGCTTCCCTTGG + Intergenic
1190397181 X:49997150-49997172 TATCTCAGAGAACTTTTCATAGG + Intronic
1192104324 X:68299184-68299206 CTGCTCAGAGCACTTACCTTTGG - Intronic
1194585259 X:95725201-95725223 CAGTTCTGAGTGCTTTGCATGGG + Intergenic
1195389842 X:104350138-104350160 AAGCCCAGAGCACTATGCTTGGG + Intergenic
1198023680 X:132683774-132683796 CAGGTCAGAGCAAGTAGCATGGG + Intronic
1201178838 Y:11327036-11327058 CACCTCAGAGAACAGTGCATAGG + Intergenic