ID: 978854467

View in Genome Browser
Species Human (GRCh38)
Location 4:113378261-113378283
Sequence TCCTCTTTAGGGTAGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978854467_978854472 15 Left 978854467 4:113378261-113378283 CCCTACATCTACCCTAAAGAGGA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 978854472 4:113378299-113378321 TCTCCTGTATTATAATACTTTGG 0: 1
1: 0
2: 0
3: 25
4: 227
978854467_978854474 26 Left 978854467 4:113378261-113378283 CCCTACATCTACCCTAAAGAGGA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 978854474 4:113378310-113378332 ATAATACTTTGGTCAAGTAATGG 0: 1
1: 0
2: 0
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978854467 Original CRISPR TCCTCTTTAGGGTAGATGTA GGG (reversed) Intronic
906409249 1:45565935-45565957 CCCTCTTTATGGTAGATGCCGGG + Intronic
907484914 1:54770805-54770827 ACCTCTTTAGGTTAGCTCTATGG + Intergenic
909135745 1:71798241-71798263 TTGTCTTTAGGCTAAATGTAGGG - Intronic
913030294 1:114895880-114895902 TCATGTTTAGTGAAGATGTAGGG + Intronic
913475741 1:119235754-119235776 TCTTCTTTAGGGTAGATTAAAGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914873204 1:151492625-151492647 TCCTATTTAGGGTAGCTGGCAGG + Intergenic
914912331 1:151797664-151797686 TACTTTATAGGGTTGATGTAAGG + Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
924586147 1:245362794-245362816 TCCTCTTCATGGGAGAAGTAGGG + Intronic
1063243902 10:4198733-4198755 TCTTCTTTCTGGTAGATGCAAGG - Intergenic
1065100120 10:22323293-22323315 TACACTTTGGGGTAGATGTATGG - Intronic
1065270585 10:24029396-24029418 TACTCCTTAGAGTAGATGAAAGG - Intronic
1067740385 10:48890945-48890967 TCCACATTAGGGGAGATGTGAGG - Intronic
1070160304 10:73862839-73862861 TGCTGTTTAGGGTAGAGGCAGGG - Intronic
1073875525 10:107917526-107917548 ACCTCTTCAGTGTAGGTGTAGGG - Intergenic
1073935238 10:108623435-108623457 TCCACCTTAGGGTAGATAGAAGG - Intergenic
1074787767 10:116856438-116856460 TCCTCTTTCTGGGAGAGGTAGGG + Intronic
1075639175 10:124052163-124052185 TCCTCTCTAGGCTATATATATGG + Intronic
1078999563 11:16739753-16739775 TCATCTTTAAGGAAGATGAAGGG + Intronic
1079904538 11:26229076-26229098 TCCTCTTTATTTAAGATGTAAGG - Intergenic
1083859984 11:65415157-65415179 TCATCTGTAGGGTAGTGGTAAGG - Intergenic
1084811069 11:71611846-71611868 TCCTCTTTAAGAGAGATGAAAGG + Intergenic
1085488342 11:76888132-76888154 GCCTTTTTAGGTTATATGTATGG + Intronic
1085785614 11:79445888-79445910 TCCCTTTTAGGGAATATGTATGG - Intergenic
1087491480 11:98832849-98832871 ACCTCTCTAGAGTAGATGTCTGG - Intergenic
1098578011 12:72066466-72066488 TGCTATTTAGGGTAGATGGGTGG + Intronic
1100573686 12:95868572-95868594 ACCTCTTGAGGTTAGTTGTAAGG + Intronic
1105825671 13:24120373-24120395 TTTTCTTTGGGGAAGATGTATGG + Intronic
1108979225 13:56489670-56489692 TCCCTTTTAGGGTGGATGAAGGG - Intergenic
1110162291 13:72392935-72392957 AGCTCTTTAAGGTAGAAGTAGGG - Intergenic
1112973462 13:105288180-105288202 TCTTCTCCAGGGTAGATGTTAGG - Intergenic
1113520634 13:110938033-110938055 TCCTCTTTAGTGCTGATGCACGG - Intergenic
1117038331 14:51748852-51748874 TCCTCTTTAAGAGAGATGAAAGG + Intergenic
1127290857 15:57569739-57569761 TCCTTTCTAGGGAAGATGTCTGG + Intergenic
1128468186 15:67930020-67930042 TACTCTTTAGGGTAAGTGGAGGG + Intergenic
1128590966 15:68896699-68896721 ACCTCTTTGGGATGGATGTAAGG - Intronic
1128746308 15:70116857-70116879 TCCTCTTGAGGATTGATGGAAGG + Intergenic
1130709749 15:86268191-86268213 TCCTCTTTGGGGGAGGTGAAGGG + Intronic
1131338569 15:91573586-91573608 TCCTTTCTAGGGCAGATGAAGGG - Intergenic
1134013172 16:10870239-10870261 CCCTATTTGGGGTAGATTTACGG - Intergenic
1138387642 16:56647314-56647336 TCCTCTTAAGGGTTGCTGTGAGG + Intronic
1140298011 16:73727433-73727455 TTCTGTTTAGGGTAGATGTTGGG - Intergenic
1142773896 17:2120800-2120822 TCCTCTTTCTGGTAGGTGTGTGG - Intronic
1146129480 17:30259008-30259030 CCCTCTTTAGGGAGGATGTTAGG - Intronic
1148619435 17:49023132-49023154 TCCTCACAAGGGTAGATGTGGGG + Intronic
1156628461 18:38938804-38938826 TCCTCTGTAGGGTAAATTAAAGG + Intergenic
1158810701 18:61030589-61030611 CCCTCTTTAGAGTAGAGGTCTGG - Intergenic
925174901 2:1775845-1775867 CCCTCTTTAGGGCTGATGTCCGG + Intergenic
933234211 2:79847155-79847177 TCTTCTATAGGGTAGATCTTGGG - Intronic
937741285 2:125357800-125357822 TCCTCTTTAGTGTATTTGTCTGG - Intergenic
939356589 2:141110688-141110710 CCCTCTCTAGGGTAGTTTTAGGG - Intronic
942173635 2:173310380-173310402 ACCCATGTAGGGTAGATGTAGGG - Intergenic
942557659 2:177188488-177188510 TCTTTTTTAGGGTTCATGTAAGG - Intergenic
944936119 2:204570350-204570372 TCACCTTTAGGGTTGATGTTGGG + Intronic
947047352 2:226003136-226003158 TCCTCTATAGAGAAGATGAAAGG + Intergenic
1171407443 20:24921101-24921123 TCCTCTTTAACACAGATGTAAGG + Intergenic
1172081627 20:32345804-32345826 TCCTATGTAGGGTTGATGTAGGG + Intergenic
1173869194 20:46331094-46331116 TTCTCTCAAGGGCAGATGTATGG - Intergenic
1175648140 20:60693579-60693601 TCCACTTTAGGGTGGATGCAGGG + Intergenic
1177745418 21:25207424-25207446 TCATCTCTTGGGTAGAGGTAAGG + Intergenic
1179245620 21:39631842-39631864 TACTTTTTAGGGGAGATGTCAGG + Intronic
1181148961 22:20869309-20869331 TCTCCTTTAGGGAAGATGTCTGG + Intronic
1183394208 22:37561990-37562012 TCCTCTATAGGGTAAATATAAGG + Intronic
954526677 3:51277953-51277975 TCTTCTTTAGGGCAGATCTGGGG + Intronic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
957076646 3:75607838-75607860 TCCTCTTTAAGAGAGATGAAAGG - Intergenic
959164027 3:102754339-102754361 TACTCTATAGGATAGATGTAAGG + Intergenic
960755700 3:121009588-121009610 TCCTCTTTGTGGTAGTTATAAGG + Intronic
961390171 3:126547862-126547884 TTCTCTTTTGGGTAGATGTCTGG - Intronic
963859778 3:150297206-150297228 TCCTTTGTAGGGTGGTTGTAAGG + Intergenic
964760227 3:160128509-160128531 TCCTCCTTAAGGCAGATGTGGGG + Intergenic
965608856 3:170524048-170524070 TCCTGTTTTGGGGAGAGGTAGGG + Intronic
965917571 3:173869531-173869553 TCCTCTTAATGGTAGATTTGGGG - Intronic
966758656 3:183394989-183395011 TCATCCTTAGAGTAGATTTAAGG - Intronic
969020101 4:4134132-4134154 TCCTCTTTAAGAGAGATGAAAGG - Intergenic
969733760 4:8973280-8973302 TCCTCTTTAAGAGAGATGAAAGG + Intergenic
971974127 4:33661027-33661049 TTCTATTGAGGGTAGATGTGAGG + Intergenic
972471595 4:39410944-39410966 TCCACTTTATTGCAGATGTAGGG + Intronic
972575790 4:40350134-40350156 TTCTGTTAAGGGTAGATGTCAGG - Intronic
974703324 4:65479903-65479925 TGCTCTTTAGTGTAGATAAATGG + Intronic
978268745 4:106861616-106861638 TCCTCTTTAGTATACATGCAGGG - Intergenic
978854467 4:113378261-113378283 TCCTCTTTAGGGTAGATGTAGGG - Intronic
993045376 5:82860535-82860557 TCCTCCTAAGGGGATATGTAGGG - Intergenic
993379517 5:87190432-87190454 TCCTCTGTAGTGGAGATGAAAGG + Intergenic
993861690 5:93144460-93144482 TCCTTTTTAGATGAGATGTAAGG + Intergenic
995522793 5:113026913-113026935 TCCTCTTTTTGGTAGATGCTGGG - Intronic
996659098 5:125978464-125978486 TCCTCTGCAGGGTATATATAAGG + Intergenic
999174519 5:149622527-149622549 TCCTCTGTAGGGTTGTTGTGAGG - Intronic
999369889 5:151048284-151048306 TGCTCTTTAGGGGAGATTTGGGG - Intronic
1000597609 5:163233702-163233724 TGCTTTTTATGGTAGATTTATGG - Intergenic
1006625137 6:35392468-35392490 CCCACTTTAGGGTTGATGCATGG + Intronic
1007825490 6:44596902-44596924 CTCTCTTTTGAGTAGATGTATGG + Intergenic
1015759265 6:136640529-136640551 TTCTGTTTAGGGCAGAAGTAGGG - Intronic
1016478414 6:144453966-144453988 TCCTCTTTTGGCTAGATAAATGG + Intronic
1020101543 7:5396948-5396970 TCTTCTTTGGGGTACATGTGGGG + Intronic
1020307507 7:6846167-6846189 TCCTCTTTAAGAGAGATGAAAGG - Intergenic
1020756747 7:12212115-12212137 TCTGCTTTAGGGTAGGTGTTTGG - Intronic
1023938390 7:44755474-44755496 CCCTCTTTAGGGTAGTAGAAGGG - Intronic
1029345382 7:99974896-99974918 TCCTCTTTAGGGGACATCTGAGG - Intronic
1033225228 7:139556498-139556520 TTGTGTTTTGGGTAGATGTAGGG + Intergenic
1035648068 8:1243614-1243636 TCCTCTTTAGGGAAGAAGAGGGG - Intergenic
1039532018 8:38271195-38271217 TCCTCTTTAGCGTGGATTAAAGG - Exonic
1041874010 8:62666935-62666957 TCCTCTTTTGGGGAGATAGAGGG - Intronic
1044216534 8:89618365-89618387 TTGGCTTTAGTGTAGATGTAGGG + Intergenic
1047197043 8:122731216-122731238 TCTTCTTTAGGATAGATATGAGG - Intergenic
1049159594 8:141088893-141088915 TCCTCTTCTGGGTACATGTGGGG + Intergenic
1053115090 9:35493134-35493156 TCTTCTTGAGGGTAGAAGGAGGG - Intronic
1060015707 9:120084549-120084571 TCCTGTTGAGGGCAGATGCAGGG - Intergenic
1060256946 9:122039637-122039659 TCCTTTATAGGGTAGTTATAAGG - Intronic
1062224632 9:135442744-135442766 TCCTCTTTAATGCAGATGTAAGG - Intergenic
1189960809 X:46323309-46323331 TCCACTTCAGGGGAGAAGTATGG + Intergenic
1193041974 X:77013759-77013781 TGCTATTTAGGGTAGAAGGAGGG - Intergenic
1194034754 X:88856247-88856269 TACTCTTAAGGGGAGATGAAGGG - Intergenic
1196560216 X:117137603-117137625 TGCTTTTTAGTGTAGATGGAAGG + Intergenic
1199196379 X:145036098-145036120 TCCTCTTTGGGTTAAATGTTTGG + Intergenic
1199511856 X:148631141-148631163 TCCTCTTTAGGTTAGTTGCAGGG + Intronic