ID: 978858321

View in Genome Browser
Species Human (GRCh38)
Location 4:113418646-113418668
Sequence GAGAAAAAGAAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978858321_978858332 21 Left 978858321 4:113418646-113418668 CCCTCCTCCTTCTTCTTTTTCTC No data
Right 978858332 4:113418690-113418712 TCTCTCTCTCTCTTATCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978858321 Original CRISPR GAGAAAAAGAAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr