ID: 978863558

View in Genome Browser
Species Human (GRCh38)
Location 4:113480451-113480473
Sequence AGGTGCAACATGGACTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978863558_978863564 9 Left 978863558 4:113480451-113480473 CCTACAAAGTCCATGTTGCACCT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 978863564 4:113480483-113480505 ACATTGATGGTATTAACAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 504
978863558_978863560 -4 Left 978863558 4:113480451-113480473 CCTACAAAGTCCATGTTGCACCT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 978863560 4:113480470-113480492 ACCTTAATACCAAACATTGATGG 0: 1
1: 0
2: 1
3: 6
4: 136
978863558_978863565 10 Left 978863558 4:113480451-113480473 CCTACAAAGTCCATGTTGCACCT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 978863565 4:113480484-113480506 CATTGATGGTATTAACAGGTGGG 0: 1
1: 0
2: 8
3: 80
4: 1007
978863558_978863567 22 Left 978863558 4:113480451-113480473 CCTACAAAGTCCATGTTGCACCT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 978863567 4:113480496-113480518 TAACAGGTGGGGCCCTTGAGTGG 0: 1
1: 1
2: 32
3: 262
4: 1371
978863558_978863566 11 Left 978863558 4:113480451-113480473 CCTACAAAGTCCATGTTGCACCT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 978863566 4:113480485-113480507 ATTGATGGTATTAACAGGTGGGG 0: 1
1: 2
2: 36
3: 271
4: 1220
978863558_978863563 6 Left 978863558 4:113480451-113480473 CCTACAAAGTCCATGTTGCACCT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 978863563 4:113480480-113480502 CAAACATTGATGGTATTAACAGG 0: 1
1: 0
2: 0
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978863558 Original CRISPR AGGTGCAACATGGACTTTGT AGG (reversed) Intronic
905953339 1:41971751-41971773 AGTTGCAACATGAATTTTGGAGG - Intronic
906366591 1:45215316-45215338 AGATGCAATATGGAGTTTATGGG - Intronic
909227089 1:73039426-73039448 ATGTCCATCATGGCCTTTGTAGG - Intergenic
909750402 1:79152772-79152794 AGGTGAAAGATGGACTTAGTTGG - Intergenic
916455900 1:164970654-164970676 AGATGCAACCTAGATTTTGTGGG + Intergenic
917594613 1:176516463-176516485 AGTTTCAACATGGATTTTGGAGG - Intronic
920700004 1:208210632-208210654 AGAACCAACATGGAATTTGTGGG - Intronic
924902536 1:248416899-248416921 AGGTGCATCATGTTCTTTGGTGG + Intergenic
1064350631 10:14573201-14573223 AGTTTCAACATGAACTTTGGGGG - Intronic
1065671112 10:28118982-28119004 AGGTGGAACAGGGAATTTATGGG + Intronic
1067239232 10:44476318-44476340 AGGTGCAAGAAGGAGTTTGAAGG - Intergenic
1067942794 10:50670153-50670175 AGGAGCAACAAGGAAGTTGTGGG - Intergenic
1069882513 10:71602611-71602633 AGGTGCACCCTGAAGTTTGTGGG - Intronic
1072162237 10:92779271-92779293 AGTTTCAACATGAATTTTGTAGG - Intergenic
1072198170 10:93134881-93134903 AGGAGCATCATGGACTTCGTGGG + Intergenic
1074538106 10:114343426-114343448 AGGAGAAACAGGCACTTTGTGGG + Intronic
1077651750 11:3979061-3979083 AGGAGGAACTTGGACTTTATAGG + Intronic
1088721334 11:112594707-112594729 AGCTGAAACATTGACTTTCTTGG + Intergenic
1089960296 11:122611299-122611321 AGGTGAAACATGGGATTTTTAGG + Intergenic
1092376277 12:7958140-7958162 AGGTGGAACATGGGATTTTTAGG - Intergenic
1093005527 12:14046942-14046964 AGATGCAGCATGAACTTTGATGG - Intergenic
1094000085 12:25685711-25685733 ACTTGCATCATGGACTTTGGTGG + Intergenic
1096353477 12:50919087-50919109 AGAGGCAACATGGAGTTGGTTGG + Intergenic
1098824520 12:75277630-75277652 AAGTGCAACTTTGAATTTGTTGG + Intronic
1111720333 13:91935778-91935800 AAGTGCAAAATTGACTTTGCTGG + Intronic
1112600660 13:100852260-100852282 AGTAGTAACATGGACTTTGCTGG - Intergenic
1112604058 13:100886492-100886514 GGGAGCAACATGGAATATGTAGG - Intergenic
1112666488 13:101580759-101580781 AGGTGGAAAATGGAATTGGTTGG + Intronic
1115851825 14:37595348-37595370 AGGTGCACCTCGGGCTTTGTAGG - Intronic
1117068600 14:52035241-52035263 AGGTGGAACATGGGATTTTTAGG - Intronic
1117311684 14:54531625-54531647 AGGTGCAGCAGGGACTTTGATGG - Intronic
1121718702 14:96094646-96094668 AAGAGCTGCATGGACTTTGTAGG + Intergenic
1121887355 14:97555763-97555785 AGATGCAAAAAGGACTTTCTAGG - Intergenic
1124653502 15:31489393-31489415 GGGTGCAACTTGGACATTTTGGG + Intronic
1130287364 15:82567140-82567162 ATGTGGAACATGGACTTCCTCGG - Intronic
1130839151 15:87681467-87681489 AGGTGACACATGGACTCTCTGGG - Intergenic
1135959443 16:26983601-26983623 AGCTGCATCATGGTATTTGTGGG + Intergenic
1137601431 16:49759020-49759042 AAGTTCTACATTGACTTTGTGGG + Intronic
1138358257 16:56403026-56403048 AGGTGCAACGTCGAATTCGTCGG - Exonic
1138846726 16:60576118-60576140 AGGTGCTCCATGGACATTTTTGG - Intergenic
1143318743 17:6053809-6053831 AAGTGATACATTGACTTTGTGGG + Intronic
1143816869 17:9523946-9523968 AGGTGAAAAATGGACGATGTAGG - Intronic
1146929822 17:36769057-36769079 AGGGGCAAGATGGACTTTAATGG + Intergenic
1150188574 17:63213676-63213698 AGGTGCAACATTGTATTTGGTGG + Intronic
1151769096 17:76148080-76148102 AGATGCTACTTGCACTTTGTGGG - Intronic
1153533064 18:6069312-6069334 AGGTGCTTAATGGACTGTGTTGG + Intronic
1157911100 18:51617964-51617986 GGATGCAACATGGACTCTCTGGG + Intergenic
1158365596 18:56731170-56731192 AGTTGCATCAGGGACTTTGTGGG + Intronic
1159103003 18:63975944-63975966 TGCTGCAACAGGCACTTTGTAGG + Intronic
1159788888 18:72751502-72751524 ATGTCCAACATGGACCTGGTTGG - Intronic
1163217622 19:15892619-15892641 AGGTGAAAGAGGGACTTTGGGGG + Intronic
925640164 2:5979461-5979483 AGGAGCCCCTTGGACTTTGTAGG + Intergenic
927098183 2:19764061-19764083 GGGTGCAAAGTGGGCTTTGTGGG - Intergenic
931866474 2:66417675-66417697 ATTTGCAACATTGACTTTGATGG - Intergenic
933710460 2:85321753-85321775 AAAGGCAAAATGGACTTTGTGGG + Intronic
935209967 2:100931092-100931114 AGGTGCTACATGCACATCGTGGG - Intronic
938294491 2:130169145-130169167 AGGCCCAGCATGGGCTTTGTTGG - Intronic
938462159 2:131504751-131504773 AGGCCCAGCATGGGCTTTGTTGG + Intergenic
941291397 2:163680147-163680169 AGATACAACAGGGACTATGTAGG + Intronic
946803934 2:223451208-223451230 ATGAGCAACCTGGACTTTGCAGG - Intergenic
948389089 2:237599209-237599231 ATTTTCAGCATGGACTTTGTAGG - Intronic
1168887191 20:1267769-1267791 AAGTGAAACATTGACCTTGTGGG + Intronic
1171466972 20:25336685-25336707 AGGAGCAGCATGGAGCTTGTTGG - Intronic
1176988449 21:15465005-15465027 AGTTCCAACATGAACTTTGGAGG - Intergenic
1177387589 21:20427717-20427739 AATTTCAACATGGAGTTTGTAGG + Intergenic
1177584296 21:23069881-23069903 AGGTGAAATCTGGACTTTTTTGG + Intergenic
1178228313 21:30751042-30751064 AGTTGCAACATGAATTTTGAAGG - Intergenic
1180903804 22:19394367-19394389 AAGACCAACATGGACTTTGTTGG - Exonic
1181385546 22:22542847-22542869 AGTTCCAACATGAACTTTGGAGG - Intergenic
949581226 3:5390347-5390369 AGCTGCAACAGGGACATTCTGGG - Intergenic
951650254 3:24943714-24943736 AGGTGCAAAATGCAATTTGCAGG - Intergenic
954972712 3:54664518-54664540 AGGAGTAACTTGGTCTTTGTGGG + Intronic
955319217 3:57962201-57962223 AGTTGCAACATGAATTTTGGAGG - Intergenic
955473646 3:59313200-59313222 AGGTGGAAAATGGAGTTGGTGGG + Intergenic
955478681 3:59366794-59366816 AGTTGCAACATGAATTTTGGAGG - Intergenic
956213562 3:66825953-66825975 AGTTGTAAGATGGACTTTGAAGG - Intergenic
958813269 3:98887957-98887979 AGGTGGAACATGGGATTTTTAGG - Intronic
962388808 3:134954666-134954688 ATGTGAAACTGGGACTTTGTAGG + Intronic
962661431 3:137604390-137604412 AGGGGCAACGTGGACAGTGTAGG - Intergenic
966130163 3:176628375-176628397 AGCTGCAACATGCAATTTGAAGG - Intergenic
966657063 3:182371194-182371216 AGGTGCAGCCTGGGCATTGTGGG - Intergenic
968471420 4:784365-784387 AGGTCAAACAAGGACTTTCTGGG + Intergenic
972883594 4:43456868-43456890 AGGTACAAATTGGACTTTGTTGG + Intergenic
974522376 4:62999499-62999521 AGGGGTTACATTGACTTTGTAGG - Intergenic
975119974 4:70717698-70717720 AGAAGGAACATGGACTTTGGAGG + Intronic
977465950 4:97383055-97383077 AGGCACAACATGGATTTTGGAGG + Intronic
978863558 4:113480451-113480473 AGGTGCAACATGGACTTTGTAGG - Intronic
979140938 4:117173777-117173799 AGGTGGAAAATAGACTTTGAGGG + Intergenic
979921726 4:126504394-126504416 GTGTACTACATGGACTTTGTTGG + Intergenic
980709564 4:136546924-136546946 AGGGGAAACATGGTGTTTGTGGG - Intergenic
982402140 4:154979948-154979970 AGGGGCAATATTGACTTGGTAGG - Intergenic
983193648 4:164781626-164781648 AAGTGCAACATGGATCTAGTGGG - Intergenic
984825238 4:183918636-183918658 AGGAGGAACATGCACTTGGTTGG - Intronic
985905240 5:2830197-2830219 AGGTGCTACATGGGCCTGGTTGG - Intergenic
985932790 5:3072226-3072248 AGGTGCCACATGTACTTTTTAGG - Intergenic
987995525 5:25272904-25272926 AGTTTCAACATGAATTTTGTAGG - Intergenic
991666703 5:69006577-69006599 TGGTGCAACCTGGACCTTGCTGG - Intergenic
991687408 5:69194139-69194161 AAGTGCCACATTGTCTTTGTTGG + Intronic
993690164 5:90990186-90990208 AGGAAAAACAGGGACTTTGTAGG - Intronic
995000023 5:107115939-107115961 AGGTTCAACATGGACTTGTTAGG - Intergenic
995394250 5:111670562-111670584 AGTTTCAACATGAACTTTGAAGG + Intronic
997382396 5:133446993-133447015 AGCTGAAAGATGTACTTTGTAGG - Intronic
1001489194 5:172143705-172143727 ATTTGCAACATGGACTATGTAGG + Intronic
1002357614 5:178643445-178643467 AGTTTCAACATGAACTTTGAAGG - Intergenic
1002565765 5:180112422-180112444 AGGTGCAGCATGGCCTCCGTGGG - Intronic
1004089880 6:12489865-12489887 AAGAGCAAGATGGACTTTATCGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007422117 6:41725870-41725892 AGGAGCAACAGGAACTCTGTGGG + Intronic
1008629116 6:53347642-53347664 AGGTGCTAGATGGGATTTGTGGG - Intronic
1009465038 6:63958438-63958460 AGTTTCAACATGAACATTGTGGG - Intronic
1009913070 6:69957796-69957818 AGGTGCCACAAGCACTTTGAGGG - Intronic
1010687152 6:78866677-78866699 ACGTCCAACATGGAGTTTGCTGG - Intergenic
1012262922 6:97109074-97109096 ATATGCAACAAGGACTTTGTTGG + Intronic
1013954247 6:115821963-115821985 ATGTGTAATGTGGACTTTGTAGG + Intergenic
1017465685 6:154691641-154691663 ATTTGCAATATGTACTTTGTGGG - Intergenic
1018423009 6:163655543-163655565 AGGTGCCACATGGAGTTTGGGGG - Intergenic
1019129610 6:169864264-169864286 TGGTGAGACATGGACTCTGTGGG - Intergenic
1025274888 7:57571384-57571406 AGTTTCAACATGAACTTTGGAGG + Intergenic
1030985263 7:116233994-116234016 AGTTGCAACATGAATTTTGGAGG + Intronic
1034329473 7:150269940-150269962 AGGTGCTACTGGCACTTTGTGGG + Intronic
1034668583 7:152839921-152839943 AGGTGCTACTGGCACTTTGTGGG - Intronic
1034883156 7:154777797-154777819 AGGTGCATCAGGGACATGGTTGG - Intronic
1036465143 8:8990323-8990345 ATGTGCAAAATGAACTTTGATGG + Intergenic
1036550892 8:9814405-9814427 AGATTCAACATGGCCTTCGTGGG - Intergenic
1037744719 8:21633677-21633699 AGTTCCAACATGAACTTTGAGGG - Intergenic
1038887775 8:31684211-31684233 AGCTTCAACATGAATTTTGTAGG - Intronic
1038891770 8:31733624-31733646 AGGTGTAACCTGGACTTTTCTGG - Intronic
1041648128 8:60274508-60274530 AGTTTCAACATGGATTTTGGAGG - Intronic
1042993751 8:74669889-74669911 AGTTTCAACATGAATTTTGTGGG - Intronic
1043571797 8:81612238-81612260 AGTTTCAACATGAACTTTGAAGG - Intergenic
1045571484 8:103372245-103372267 CGGTGCAACGTGTCCTTTGTTGG + Intronic
1048145652 8:131840029-131840051 AGGTGCTATATGGAGTTTTTGGG + Intergenic
1056021806 9:82445700-82445722 AGGTGAGACATGGGCTCTGTTGG - Intergenic
1056285636 9:85084970-85084992 AGGTACAAAATTGTCTTTGTTGG + Intergenic
1186116203 X:6307413-6307435 AGGGGCAACAAATACTTTGTAGG - Intergenic
1189963748 X:46350687-46350709 TGGTGCAGCATGGACTGTGGTGG - Intergenic
1194575579 X:95610496-95610518 AGGTGGAACATGGAAATTGGTGG - Intergenic
1196327225 X:114420882-114420904 AACTGCACCATGGACTTTTTTGG - Intergenic
1198226315 X:134648888-134648910 TGGTTCAACATGAATTTTGTGGG + Intronic
1199664657 X:150087182-150087204 AGGTGCCACCTGGCCTTTATGGG - Intergenic
1199795597 X:151192301-151192323 AGGTGCCACCTGGACAGTGTTGG - Intergenic
1201053879 Y:9968561-9968583 AGGTGGAAAAGGGACTTTGATGG - Intergenic