ID: 978865504

View in Genome Browser
Species Human (GRCh38)
Location 4:113504797-113504819
Sequence ATGACCAAGTTCATTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978865504 Original CRISPR ATGACCAAGTTCATTTCTTT TGG (reversed) Intronic
900512141 1:3065782-3065804 ATGACCAGGTTAATTCCTTAGGG - Intergenic
905328325 1:37174298-37174320 CTGACCAAGTGAATGTCTTTGGG - Intergenic
905357914 1:37397524-37397546 AGGCCCATGTTCCTTTCTTTGGG + Intergenic
905448228 1:38041249-38041271 ATGACCATTTTCCTTCCTTTTGG + Intergenic
906165572 1:43683652-43683674 AAGACCAATTTAATTTCTTGTGG + Intronic
908296241 1:62716330-62716352 CTAATCAAGTTGATTTCTTTTGG - Intergenic
908979402 1:69935952-69935974 ATAATCAAATTCATTTCTGTGGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910094836 1:83509658-83509680 ATGACAGAGTTAATTTGTTTTGG - Intergenic
911698335 1:100920424-100920446 CTGACAAAATTTATTTCTTTTGG + Intronic
913507647 1:119533039-119533061 ATGTCCAAGTTGATCTCTCTAGG + Intergenic
917794482 1:178522639-178522661 TTGGCCAAGTTCTTTTTTTTTGG + Exonic
918028099 1:180773627-180773649 ATGACTAAATTCCTTTCCTTGGG - Intronic
919196124 1:194288447-194288469 ATAAACAAGCTCATTTCTCTAGG - Intergenic
921222469 1:212982845-212982867 ATGACCTAGTCCCTTTCCTTTGG + Intronic
921417268 1:214903887-214903909 ATAACCAACTCAATTTCTTTGGG + Intergenic
921840891 1:219827298-219827320 ATGATCAAGTTCATATTCTTTGG + Intronic
924297842 1:242606568-242606590 ATGAACAAGATGATTTTTTTTGG - Intergenic
924602493 1:245503986-245504008 AGGACCAGGTTCCTTTCCTTAGG - Intronic
1063268493 10:4480327-4480349 ATTACCCTGTTCATTTCTATTGG + Intergenic
1063558583 10:7104549-7104571 AAGAACAAGATCATGTCTTTTGG - Intergenic
1064946011 10:20790657-20790679 TTTACTAAGTTGATTTCTTTAGG - Intronic
1065516699 10:26531054-26531076 CTGGCCAAGTACAATTCTTTTGG - Intronic
1068382225 10:56271128-56271150 TTGCCCAAGTTCACTACTTTTGG - Intergenic
1071059804 10:81555773-81555795 AAGGCCAAGTTCCTTTCTTCTGG - Intergenic
1071160593 10:82741157-82741179 ATGCACACGTGCATTTCTTTAGG + Intronic
1071733401 10:88271253-88271275 ATGAGCAAATTCATTTCTGGGGG + Intergenic
1073028610 10:100507113-100507135 AGGATAATGTTCATTTCTTTAGG - Intronic
1074722475 10:116274290-116274312 ATGTCCAAGTTCATCTCTCGGGG + Intergenic
1078342337 11:10507119-10507141 ATAACTAAGTGAATTTCTTTTGG + Intronic
1078524018 11:12086854-12086876 CTTCCCAAGTTCATTTTTTTAGG - Intergenic
1080975101 11:37329993-37330015 AAGAACAAGATCATGTCTTTTGG - Intergenic
1081887626 11:46512509-46512531 ATGACCAAGCTCTTGTCCTTTGG - Intronic
1082211209 11:49504308-49504330 CAAACCAATTTCATTTCTTTTGG - Intergenic
1082906341 11:58311668-58311690 AGGACCCCGTTCCTTTCTTTAGG - Intergenic
1086638434 11:89120746-89120768 CAAACCAATTTCATTTCTTTTGG + Intergenic
1087493994 11:98865687-98865709 CAGACCAATTTCCTTTCTTTGGG - Intergenic
1090715867 11:129430181-129430203 ATTCCCAACTTCATTTCTTTGGG + Intronic
1090917774 11:131181143-131181165 GTGACCAACAGCATTTCTTTTGG - Intergenic
1091503709 12:1044366-1044388 ATGACCAAGTTGAGTGCTTCTGG + Intronic
1091522358 12:1259199-1259221 ATGACCACTTTCATCTCTTTTGG + Intronic
1092656755 12:10693732-10693754 ATGACTAAGTGCATTTATTCAGG + Intergenic
1093104745 12:15072637-15072659 ATGATCAAGCACCTTTCTTTAGG - Intergenic
1093443987 12:19233198-19233220 ATTTCCAAATTCATTTATTTTGG - Intronic
1093505185 12:19857029-19857051 ATGACGAAGTGGATTTCTCTGGG + Intergenic
1093531339 12:20168375-20168397 TTGTCCAAGTACATTTCCTTAGG + Intergenic
1093629661 12:21393607-21393629 ATGCCCAATTTAATTTTTTTAGG + Intronic
1094463416 12:30723565-30723587 ATGTCTTAGTTCTTTTCTTTTGG - Intronic
1097651467 12:62303410-62303432 ATAACCAATTTCGTTTTTTTAGG + Intronic
1098450283 12:70611108-70611130 ATGTGGAATTTCATTTCTTTTGG - Intronic
1098527549 12:71503217-71503239 ATAAACAATTTCATTTTTTTTGG - Intronic
1098627273 12:72687644-72687666 ATGACAAAATATATTTCTTTTGG + Intergenic
1098850934 12:75594912-75594934 AAGAACAAGATCATGTCTTTTGG + Intergenic
1099410852 12:82324682-82324704 ATGACAAAGATTATATCTTTAGG + Intronic
1099542686 12:83932988-83933010 AGGTCCAATTTCATTTTTTTTGG - Intergenic
1099652752 12:85449476-85449498 AATACCAATTTCCTTTCTTTAGG + Intergenic
1099661731 12:85572233-85572255 ATGAAAAAGTACATTTCTCTTGG + Intergenic
1101147881 12:101858444-101858466 ATCACCAAGTTTATTTTTTGTGG - Intergenic
1101975878 12:109358388-109358410 ATAATCAAGTTGATCTCTTTTGG + Intronic
1104217902 12:126752462-126752484 ATGACTAAGTTATTTTCTCTTGG + Intergenic
1105632820 13:22188190-22188212 AAGACCAAGGTCACTTCATTTGG + Intergenic
1110107089 13:71691069-71691091 AAGACCAAATGCATTGCTTTTGG - Intronic
1111710535 13:91806843-91806865 ATGAATGAGTTCATTTGTTTTGG - Intronic
1111737642 13:92162840-92162862 GTGACCAAGTTCATTTCAAGAGG - Intronic
1112046263 13:95601463-95601485 AGGACCAAGATCCTTTCTTCTGG - Intronic
1112180381 13:97073038-97073060 ATTACCAATTTTATTACTTTGGG + Intergenic
1112726146 13:102306983-102307005 ATGACCCAGGGCATTTCTCTGGG + Intronic
1114809334 14:25878558-25878580 AGGACAAAGTTCATCTCATTTGG + Intergenic
1114853837 14:26413616-26413638 AAACCCAAGTTCATTTATTTGGG - Intergenic
1114876161 14:26720980-26721002 ATGAACCAGTTTTTTTCTTTTGG + Intergenic
1115185180 14:30679484-30679506 ATTTCCAGGTTCAGTTCTTTGGG - Intronic
1116788631 14:49315658-49315680 AAGACCACGGTCATTTCTTAGGG + Intergenic
1117354586 14:54911687-54911709 TTGACCAGTTTCATTCCTTTTGG + Intergenic
1117907301 14:60603696-60603718 ATGAGCAAGTTCATTTTTATAGG - Intergenic
1119027275 14:71164118-71164140 AAGACCAGGTTCTTGTCTTTGGG - Intergenic
1122105718 14:99452982-99453004 ATCTGCAAGTTCATTTCTCTAGG + Intronic
1124058953 15:26269762-26269784 TTGACCAAATTCATTTCCTTGGG - Intergenic
1124228967 15:27925009-27925031 ATGATAAAGTTCAATTCATTTGG + Intronic
1126499456 15:49328857-49328879 ATAACCACTTTCAATTCTTTTGG + Intronic
1127333813 15:57964250-57964272 TTGAACAACTTCACTTCTTTGGG + Intronic
1127803927 15:62501231-62501253 ATGACCCAATCCACTTCTTTTGG - Intronic
1128406917 15:67351029-67351051 ATCACTGAATTCATTTCTTTTGG + Intronic
1130514608 15:84616715-84616737 ATGACCAAAAACATTTTTTTGGG - Intronic
1130548021 15:84870494-84870516 TGGTCCAAGTTCATTTCTGTTGG - Exonic
1131003057 15:88953892-88953914 GTGATCAAGTGGATTTCTTTAGG - Intergenic
1132922337 16:2404006-2404028 ATGGCAAAGTTCATTTTGTTTGG - Intergenic
1134102199 16:11460374-11460396 GTGAGCAAGTCCATCTCTTTGGG + Intronic
1138159772 16:54742106-54742128 TTGACCAAATTCATTTCTCTTGG + Intergenic
1140211487 16:72974093-72974115 CTGACCAAGTTCATTTCTCTTGG - Intronic
1141376496 16:83535702-83535724 ATGATAATGTTCATTTTTTTTGG + Intronic
1143891892 17:10108255-10108277 AGGACCAAGGCCCTTTCTTTTGG - Intronic
1144318006 17:14082258-14082280 ATGAACAGGTTCTATTCTTTTGG - Intronic
1144354327 17:14429679-14429701 TTGACCAAGTCCATTTTTCTTGG + Intergenic
1144873071 17:18382419-18382441 ATGACCAAGTCCACTTCTCCGGG + Intronic
1146571451 17:33956738-33956760 ATGAACAAGTCCAGTTCTGTGGG + Intronic
1146572159 17:33962107-33962129 ATGAACAAGTCCAGTTCTGTGGG + Intronic
1149300033 17:55296764-55296786 GTGAACTAGTTCAATTCTTTTGG - Intronic
1149342742 17:55703234-55703256 GAGAGCATGTTCATTTCTTTAGG - Intergenic
1150137082 17:62701979-62702001 ATGACCAAGATGCTGTCTTTGGG - Intronic
1151748173 17:76022610-76022632 ATGACCAAGTCCACTTCTCCGGG - Intronic
1153911935 18:9712128-9712150 ATGTCCAAGCTTATTTCTATTGG + Intronic
1155149980 18:23115448-23115470 TTGGCCAAGTTCATCTCTCTCGG - Intergenic
1159248945 18:65848627-65848649 ATCAGCAAGTTCATTTCTGTAGG + Intronic
1160023116 18:75196117-75196139 AAGACCCTGTTCAGTTCTTTAGG + Exonic
1168690570 19:58374195-58374217 ATGCCTGAGTTCATTTCTCTTGG - Intronic
925941764 2:8827457-8827479 ATGAACAATTTCAATGCTTTTGG - Intronic
926231030 2:11004001-11004023 ATGTCCTCTTTCATTTCTTTGGG - Intergenic
927118618 2:19930104-19930126 ATAGCCAAGTTCATATTTTTTGG - Intronic
927908744 2:26881290-26881312 ATGACCAACTTCCCTTCTTCTGG - Intronic
928253681 2:29703686-29703708 ATGACCATGACCATTTCTTTAGG + Intronic
929761051 2:44806462-44806484 ATAAACAAGTGAATTTCTTTCGG - Intergenic
931316825 2:61140821-61140843 ATAACCTAGTTCATTATTTTTGG - Intergenic
932344967 2:70989317-70989339 AAGAGCAAGGTCACTTCTTTGGG - Intronic
932426585 2:71640877-71640899 GAGGCCAAGATCATTTCTTTGGG - Intronic
934928078 2:98396140-98396162 ATTTCCAAGTTCATTGGTTTTGG + Exonic
935616410 2:105087661-105087683 ATGTAAAAGTTCATTCCTTTTGG - Intronic
936942299 2:117897742-117897764 AAGGCAAACTTCATTTCTTTTGG + Intergenic
937071567 2:119067510-119067532 AACACAAAGTTCATTTCTTGAGG + Intergenic
937386762 2:121441373-121441395 ATGATCAAGTTCCTCTGTTTTGG - Intronic
938173425 2:129103000-129103022 CTGACCACATTCATTTCTTTGGG + Intergenic
939431501 2:142115062-142115084 ATGAGCAAAATGATTTCTTTTGG + Intronic
941263194 2:163322649-163322671 ATGAACAAGTACATGTTTTTTGG + Intergenic
941914437 2:170800805-170800827 ATATCCATCTTCATTTCTTTTGG - Intergenic
943202859 2:184851670-184851692 CATACCAATTTCATTTCTTTTGG + Intronic
944108096 2:196101244-196101266 ATTTCCATGTTCATTTCTTAGGG - Intergenic
946022041 2:216647336-216647358 AAGACCAAGTTTATGTCTTCAGG + Intronic
946081610 2:217124803-217124825 ATGACTGAGTTCATTTACTTTGG - Intergenic
946626292 2:221615098-221615120 ATCAGCAAGTTAATTTCTTCAGG + Intergenic
946773467 2:223113033-223113055 TTGACCGAGTTCAGTTCCTTGGG + Intronic
1170063035 20:12279888-12279910 ATGTCTGATTTCATTTCTTTTGG - Intergenic
1173052408 20:39576372-39576394 AGGACATATTTCATTTCTTTTGG - Intergenic
1174284197 20:49460733-49460755 TTGACCAAGTTCCTTTCTAATGG + Intronic
1174816011 20:53687668-53687690 ATAAACCAGTTCATTTCTTTTGG - Intergenic
1175137713 20:56837300-56837322 ATGACAAAGTTTGCTTCTTTGGG + Intergenic
1175291966 20:57881939-57881961 ATGATCAAGGTAATTTCTTATGG - Intergenic
1177053534 21:16270282-16270304 ATCACCATGTTCAGCTCTTTAGG + Intergenic
1179669358 21:42935224-42935246 ATGATCAAGGTGATTTCTTTTGG - Intergenic
949176657 3:1071587-1071609 ATGACCAATTTCTTTTAGTTAGG - Intergenic
950242977 3:11388266-11388288 ATCAACTATTTCATTTCTTTAGG + Intronic
950362658 3:12460865-12460887 CAGACCCAGCTCATTTCTTTAGG + Intergenic
950874631 3:16260000-16260022 GTCACCAATTTCACTTCTTTTGG + Exonic
955259371 3:57369861-57369883 ATAACCAAGAACATTTATTTAGG - Intronic
955671109 3:61404223-61404245 CTCACCAAGTTCAGATCTTTTGG + Intergenic
957508810 3:81160563-81160585 ATGGCCCATTTCATTTCGTTTGG - Intergenic
961600882 3:128061080-128061102 ATGACCAAGTGCTTTGGTTTAGG - Intronic
962293907 3:134162804-134162826 CCGACCAGTTTCATTTCTTTGGG - Intronic
964818285 3:160740873-160740895 ACCACCAAGTTCATGACTTTTGG - Intergenic
965130362 3:164691472-164691494 ATGATTAAATACATTTCTTTAGG - Intergenic
965140090 3:164821654-164821676 ATGACTAAAATCATTGCTTTTGG - Intergenic
965775722 3:172228776-172228798 ATGACTAACTTCATTTCAATTGG + Intronic
965951580 3:174314942-174314964 ATGACTAAATTCTATTCTTTAGG + Intergenic
966297121 3:178437269-178437291 ATCACCAATATCATTTCTGTTGG + Intronic
967401271 3:189064200-189064222 ATGAACAAACTCATTTCCTTTGG - Intronic
970013372 4:11485049-11485071 ATGACCAAGTTCTTTACTACTGG + Intergenic
970973987 4:22021823-22021845 CTGACAAAGTTCTTGTCTTTAGG - Intergenic
971425924 4:26515320-26515342 ACTGCCATGTTCATTTCTTTTGG + Intergenic
971664407 4:29463617-29463639 ATCTCAAAGTTCATTTATTTTGG - Intergenic
971756479 4:30714944-30714966 ATAAGCAAGGTCATTTGTTTGGG + Intergenic
973087737 4:46089071-46089093 CTAACCAAGTTATTTTCTTTTGG - Intronic
974583783 4:63842641-63842663 TTGCCCAAATGCATTTCTTTGGG - Intergenic
976561442 4:86506149-86506171 ATGACCGACTGCCTTTCTTTTGG - Intronic
976851284 4:89548932-89548954 CATACCAATTTCATTTCTTTTGG - Intergenic
977130606 4:93231678-93231700 ATGTCTAAGTTCATTTCTTCAGG + Intronic
977257393 4:94756471-94756493 ATGACTAATTTCACTTGTTTTGG + Intergenic
977713253 4:100151358-100151380 ATGACCTAATTCAGTTATTTTGG - Intergenic
978060257 4:104328010-104328032 ATGGCTAAGATAATTTCTTTAGG + Intergenic
978113142 4:104986658-104986680 ATAAGCAAGGGCATTTCTTTGGG + Intergenic
978283068 4:107040022-107040044 ATCACTAGGGTCATTTCTTTGGG - Intronic
978836836 4:113160860-113160882 TTGACCAAGTCCATTTATTCCGG - Intronic
978865504 4:113504797-113504819 ATGACCAAGTTCATTTCTTTTGG - Intronic
979486025 4:121271380-121271402 ATCACCAAGTTCATGCCTTGAGG + Intergenic
980223806 4:129954941-129954963 ATATCCAAGTTCTTTACTTTGGG + Intergenic
980269911 4:130570719-130570741 ATGAAGAAGGTCTTTTCTTTCGG - Intergenic
982738400 4:159031285-159031307 ATAGCCAAGTTCAACTCTTTAGG - Intronic
983347789 4:166548626-166548648 AATACCAAGTTCTTGTCTTTGGG - Intergenic
983503743 4:168529540-168529562 TTTACCAGATTCATTTCTTTGGG - Intronic
983802592 4:171952526-171952548 ATTATCAAGTTCAATTTTTTAGG + Intronic
984355166 4:178648965-178648987 ATGTCCAACTTTATTTATTTAGG + Intergenic
984418997 4:179495782-179495804 ATATTAAAGTTCATTTCTTTAGG + Intergenic
984696957 4:182788572-182788594 ATAAACAAGATCATTGCTTTTGG - Intronic
986545205 5:8889655-8889677 ATAAGCATGTTCATTTCTGTGGG + Intergenic
986593468 5:9395515-9395537 AAAACCAATTTCATTTCCTTAGG - Intronic
987991861 5:25223117-25223139 ATGACCAAGTGTACTTATTTAGG - Intergenic
988838589 5:35060225-35060247 ATGAATAATTTCATTTCTTGTGG + Exonic
989316048 5:40079879-40079901 ATGAACAATTTGATTTCTTTTGG - Intergenic
989390326 5:40893993-40894015 ATGGCCAAGATAATTCCTTTGGG - Intergenic
989469926 5:41804102-41804124 ATGACCCAGGTCACTTCTTGTGG + Intronic
989675347 5:43966278-43966300 AGGACCCAGTTCATCTCATTGGG - Intergenic
992491064 5:77245149-77245171 ATGTTCTAGTTCATTACTTTTGG - Intronic
992720187 5:79552995-79553017 TTGACCCAGTTCATCTATTTGGG - Intergenic
993271188 5:85798428-85798450 AAGAACAAGTTCCATTCTTTCGG - Intergenic
993669997 5:90748580-90748602 AAGACCCAGTTCATGTCTTAGGG - Intronic
993761547 5:91802218-91802240 ATTACCAAGTTTTTTTCTCTAGG + Intergenic
993786260 5:92141564-92141586 ATGCCTAGGTTCATTTCTATGGG + Intergenic
993993461 5:94688860-94688882 ATGAGCAGTTTTATTTCTTTTGG - Intronic
994080508 5:95703916-95703938 ATGAAAAAGTCCATTTCTATTGG - Intergenic
994577955 5:101605103-101605125 AAGTACATGTTCATTTCTTTGGG - Intergenic
996838689 5:127822711-127822733 AGGACAAAGATCATTCCTTTAGG + Intergenic
998631433 5:143903271-143903293 TTGTCCAAGGTCATTTCCTTTGG + Intergenic
998742431 5:145219800-145219822 ATGAAGAAGTTGATTTCATTAGG + Intergenic
1000309289 5:160025889-160025911 ATTTCCAAGTTCATATTTTTAGG - Intronic
1000444621 5:161304583-161304605 AGCATCAAATTCATTTCTTTTGG + Intronic
1000592715 5:163177795-163177817 AGGACAAAGTTCATTTTGTTTGG + Intergenic
1001993959 5:176140115-176140137 AGTACCGATTTCATTTCTTTTGG + Intergenic
1004345638 6:14846685-14846707 ATGACTATGTTCATTTCCTAGGG - Intergenic
1010480543 6:76347670-76347692 ATGTCCAAGTGCATTGCTATGGG + Intergenic
1010690940 6:78910567-78910589 ACGACCTAGTCCATTTCCTTAGG - Intronic
1011573644 6:88769138-88769160 TTAACAAAGTTCTTTTCTTTGGG + Intronic
1012061266 6:94485286-94485308 ATTACCTAGTTTATTTCCTTAGG - Intergenic
1012390197 6:98729567-98729589 ATGACCCAGTACCTTTCTTCTGG + Intergenic
1013290975 6:108718656-108718678 AAGACCAAGTTCTTTGCCTTGGG - Intergenic
1013487405 6:110610574-110610596 ATAACAAAGTTCATTGTTTTAGG - Exonic
1016306952 6:142694759-142694781 ATGACCTAGTTCACTTCCCTAGG + Intergenic
1018216343 6:161531552-161531574 CTGCCCAGGTTCCTTTCTTTGGG - Intronic
1018410452 6:163540097-163540119 ATGAATAAGTTCTTTTTTTTTGG + Intronic
1019871901 7:3771490-3771512 ATGACTGAGTTCATCTCTTGGGG + Intronic
1020195738 7:6037312-6037334 ATGTCCTAGTTCATTTGCTTAGG - Intronic
1021384609 7:20012827-20012849 ATGATACAGTTCATTTCTGTAGG - Intergenic
1024981680 7:55162421-55162443 AGGACCAAGTTCAATTCTATAGG + Intronic
1027395575 7:77750340-77750362 ATGGCTAAATTCATTTCCTTAGG - Intronic
1027481094 7:78697957-78697979 GTGTACAAGTTCATTTCTTTAGG + Intronic
1028784971 7:94782283-94782305 ATGACCATGCTTATGTCTTTTGG - Intergenic
1029853905 7:103493922-103493944 ATAACCAAGGCAATTTCTTTAGG - Intronic
1029898227 7:104009717-104009739 ATGATTAAGTTCATACCTTTGGG + Intergenic
1030214822 7:107033494-107033516 ATGAAAAATTTCATTTATTTTGG + Intergenic
1031784446 7:126011451-126011473 ATGTCCTAGTTTTTTTCTTTGGG + Intergenic
1035782223 8:2237376-2237398 ATGGCGAATTTTATTTCTTTGGG + Intergenic
1036486151 8:9180823-9180845 ATGCCCAATTTTTTTTCTTTTGG + Intergenic
1037100966 8:15045479-15045501 ATAACCAAGTTGCTTTCCTTGGG + Intronic
1037153638 8:15672358-15672380 TTGAGCAAGTCCATTGCTTTGGG - Intronic
1037153649 8:15672479-15672501 TTGAGCAAGTCCATTGCTTTGGG - Intronic
1038410404 8:27354126-27354148 GCCACCAAGTTCCTTTCTTTTGG - Intronic
1038896776 8:31792097-31792119 ATGACCTTTTTCATTTATTTGGG + Intronic
1039340373 8:36642616-36642638 ATGAGTGATTTCATTTCTTTTGG - Intergenic
1039376095 8:37035800-37035822 ATGACCAAGCTCCATTCTTTGGG - Intergenic
1039691022 8:39864856-39864878 TTGCCTCAGTTCATTTCTTTAGG - Intergenic
1041681676 8:60599720-60599742 AGGAGGAAGTTCATTTATTTTGG - Intronic
1042325166 8:67520802-67520824 CTGACCCAGTTCATGTCTTCAGG + Intronic
1042571832 8:70173694-70173716 ATGACAAACTTCATTTCCTGGGG - Intronic
1043163182 8:76871561-76871583 GTGACCCAGTTCTTCTCTTTTGG - Intergenic
1043977913 8:86603903-86603925 ATGACCCAGTTCTTTTCCTTAGG + Intronic
1045690230 8:104752807-104752829 ATGAACAATTTCATTTTTTCAGG + Intronic
1046213814 8:111115840-111115862 CTAATCAAGTTCATTTCTCTGGG + Intergenic
1047091098 8:121576547-121576569 TTTGCCAAGTTCATTTCTGTTGG - Intergenic
1049873043 8:144995944-144995966 GTGACCAAGTTGACTTCATTCGG + Intergenic
1052270546 9:26624034-26624056 ATGAGCAGCTTCTTTTCTTTTGG - Intergenic
1053599138 9:39592281-39592303 ATGGCCAAGTTTAATTCTTTGGG + Intergenic
1053856890 9:42346782-42346804 ATGGCCAAGTTTAATTCTTTGGG + Intergenic
1054568406 9:66783973-66783995 ATGGCCAAGTTTAATTCTTTGGG - Intergenic
1054798226 9:69322518-69322540 GTGAATATGTTCATTTCTTTTGG + Intergenic
1054809927 9:69426643-69426665 GTTACCAAGTTCATCTCTGTAGG + Intergenic
1054964765 9:71010783-71010805 ATAACCAATTTCATTTCTTTTGG - Intronic
1055093964 9:72390996-72391018 AAGACAAAGGCCATTTCTTTTGG - Intergenic
1055492558 9:76820506-76820528 ATGACCCAGTTAATTTTCTTGGG - Intronic
1055570526 9:77612142-77612164 ATGAGTAACTTAATTTCTTTGGG - Intronic
1056028028 9:82521097-82521119 ATGACAAAATTCTTTCCTTTTGG + Intergenic
1056382238 9:86065720-86065742 ATTTCTAACTTCATTTCTTTAGG - Intronic
1058384473 9:104417837-104417859 ATGACTAATTTAATTTTTTTTGG - Intergenic
1058501978 9:105629321-105629343 CTGACCAAATTCATTGCTTTTGG - Intronic
1059018856 9:110551967-110551989 ATGACCAAGGGCACTTCTTTGGG - Intronic
1059395481 9:114031751-114031773 CTGACCCAGTGCATTTCTTAAGG - Intronic
1059630353 9:116115303-116115325 ATTGCCAAGTTCATGGCTTTTGG + Intergenic
1060125266 9:121038663-121038685 ATGACAAACTTAATTTCTCTAGG + Intronic
1188087385 X:25916665-25916687 ATGGCCAAGTACATTGCTTTGGG + Intergenic
1188732256 X:33664223-33664245 TATACCAATTTCATTTCTTTGGG - Intergenic
1192110783 X:68361746-68361768 ACAACCAATTTCATTTCCTTTGG + Intronic
1195434783 X:104829476-104829498 AGTACCCAGTTCATTTCATTGGG - Intronic
1195470212 X:105221187-105221209 ATGGCCATGGTCATTTCTTCAGG - Intronic
1196010426 X:110881070-110881092 ATGACCAAGGTGATCCCTTTTGG - Intergenic
1197781074 X:130161043-130161065 ACTAGCAAGTTCATTTCTGTAGG + Intronic
1197816358 X:130502671-130502693 AAAACCAAGTACAATTCTTTGGG - Intergenic
1199242316 X:145561744-145561766 ATTCCCAAATTCAGTTCTTTTGG + Intergenic
1200619097 Y:5418217-5418239 ATGACTAAGTTATTTTATTTTGG + Intronic