ID: 978869360

View in Genome Browser
Species Human (GRCh38)
Location 4:113556690-113556712
Sequence GGCTCCCCAAAGACCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978869350_978869360 15 Left 978869350 4:113556652-113556674 CCAGTGTGCCAAGTCCATCCATT 0: 1
1: 0
2: 1
3: 10
4: 163
Right 978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 188
978869352_978869360 1 Left 978869352 4:113556666-113556688 CCATCCATTTCTAGTTACCCCAG 0: 1
1: 4
2: 1
3: 11
4: 154
Right 978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 188
978869356_978869360 -3 Left 978869356 4:113556670-113556692 CCATTTCTAGTTACCCCAGGGGC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 188
978869349_978869360 19 Left 978869349 4:113556648-113556670 CCAACCAGTGTGCCAAGTCCATC 0: 1
1: 0
2: 4
3: 41
4: 211
Right 978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 188
978869351_978869360 7 Left 978869351 4:113556660-113556682 CCAAGTCCATCCATTTCTAGTTA 0: 1
1: 0
2: 0
3: 17
4: 228
Right 978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978869360 Original CRISPR GGCTCCCCAAAGACCCCTGA AGG Intronic
900488220 1:2933539-2933561 TGCTCCCCGCAGACCCCTGTAGG + Intergenic
900488230 1:2933570-2933592 TGCTCCCCGCAGACCCCTGCAGG + Intergenic
902255926 1:15188528-15188550 GGGCCCCCAAAGACCCTTGTTGG + Intronic
903172703 1:21563748-21563770 GGCGCCCACAGGACCCCTGAGGG - Intronic
904392429 1:30194854-30194876 AGCTCCCCAAAGGCTCCTCATGG - Intergenic
905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG + Exonic
913135044 1:115880170-115880192 GGCTCCCCAGAGAGTCCTGGGGG + Intergenic
913147570 1:116007306-116007328 GAGTTCCCAAAGAGCCCTGAGGG - Intronic
914420259 1:147522448-147522470 AGCTCTCTAAAGACCCCTGGTGG - Intergenic
919755592 1:201064219-201064241 GGGTCCCCAGAATCCCCTGAGGG - Intronic
922249291 1:223832929-223832951 GGTTCCACAGAGACCCCTGTGGG - Intronic
922650421 1:227333594-227333616 GGCTGACCACAGACCCATGAAGG - Intergenic
922750293 1:228067082-228067104 GGCTCCCCATGGGCACCTGAGGG - Intergenic
924246927 1:242094257-242094279 GGCACTCAAAAGTCCCCTGAAGG - Intronic
1063149387 10:3322689-3322711 GGCTCTCCACAGAGTCCTGAGGG - Intergenic
1064005002 10:11692358-11692380 GCCTCCTCAGAGACCCCAGAAGG - Intergenic
1069521225 10:69123591-69123613 TGCTTCCCAAAGTCCCCAGATGG - Intronic
1071259682 10:83908652-83908674 GACTCCCCCAACACCACTGAGGG + Intergenic
1072292248 10:93974934-93974956 TGCTCCCCAGAGCCTCCTGAAGG + Intergenic
1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG + Intronic
1075225390 10:120624417-120624439 GGGTCCCCAAGGACCCCTACTGG - Intergenic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077320246 11:1937778-1937800 GGGTCTGCAATGACCCCTGACGG - Intronic
1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG + Intergenic
1081127789 11:39341694-39341716 GCCTGCCCAAACACCCGTGAAGG - Intergenic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1084572161 11:69966316-69966338 GGATGCCAATAGACCCCTGAGGG - Intergenic
1089392171 11:118109598-118109620 GGGTCCCTAAAGATCCTTGATGG - Intronic
1090843059 11:130509242-130509264 GGCACCACCAAGACCCCTGCAGG - Intergenic
1091363028 11:134993272-134993294 TGCTCCCCAAAGCCTCCAGAAGG + Intergenic
1091973770 12:4809547-4809569 GGCTCGGCAAAGACTCCTGGCGG - Exonic
1092108063 12:5938111-5938133 GGGTCCCCAAAGAGCCCTCTGGG + Intronic
1093108699 12:15122148-15122170 AGCCCTCCATAGACCCCTGATGG + Intronic
1095079736 12:37985101-37985123 GGCTCCCAAATGTCCCCTCATGG - Intergenic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1096679062 12:53242701-53242723 GCCTCCCCCACGGCCCCTGAAGG + Intergenic
1102005183 12:109585185-109585207 GGAGCCCCAGAGACCCCTGGAGG - Intronic
1102893967 12:116583623-116583645 TGCTCCCCAAAGACACTTGATGG + Intergenic
1103927052 12:124429055-124429077 GGCACCCCAAAGAGGCCTGAGGG + Intronic
1105407849 13:20146189-20146211 GGCTCCCCACACACGGCTGATGG + Intronic
1108779996 13:53818361-53818383 GGCTTCCCAAAGACCACTGATGG - Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1117126686 14:52635725-52635747 GGCTCTCCAAAGAACACTGCTGG - Exonic
1118880152 14:69818941-69818963 GCCTCCCCAAACACCGCTGACGG - Intergenic
1119534665 14:75393396-75393418 GGATCCTCAAAAACCCCTGGTGG + Intergenic
1122768307 14:104085924-104085946 GACTCCCCAACGACCCCCGTGGG - Intronic
1122811478 14:104291474-104291496 GCCGCCCCAGGGACCCCTGAAGG - Intergenic
1123039600 14:105485100-105485122 GGGACCCCAGAGACCCCTGATGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1129857239 15:78833142-78833164 TGCTCCCCAAAAGCACCTGAAGG + Intronic
1130694037 15:86112020-86112042 TGTTCCCCAACGACCCCAGATGG + Intergenic
1131657707 15:94478877-94478899 GGCTCCCCAAGGACAACCGAAGG - Intronic
1132942708 16:2515929-2515951 GGCTGCCCAAAGACCTGTGTAGG - Intronic
1134371989 16:13634291-13634313 AGGTCCCCAAAGGCACCTGAAGG + Intergenic
1134502070 16:14777007-14777029 GGTTCCCCAAAGCCCTCTGCAGG - Intronic
1134578491 16:15351886-15351908 GGTTCCCCAAAGCCCTCTGCAGG + Intergenic
1134724097 16:16405658-16405680 GGTTCCCCAAAGCCCTCTGCAGG - Intergenic
1134943332 16:18306211-18306233 GGTTCCCCAAAGCCCTCTGCAGG + Intergenic
1136886402 16:33932758-33932780 GGGACCCCCAAGACCCCAGAAGG + Intergenic
1138717547 16:59041604-59041626 TGCTCCCCTGAGAGCCCTGACGG - Intergenic
1144132457 17:12259967-12259989 GGCCCCCCTTAGACCCCTGAAGG - Intergenic
1144435871 17:15240187-15240209 AGCCCTTCAAAGACCCCTGAGGG - Intronic
1147141185 17:38461426-38461448 TGCTCCCCAGAGGCCCCTGGTGG + Intronic
1147143653 17:38473284-38473306 GGGACCCCCAAGACCCCAGAAGG - Intronic
1147211799 17:38876123-38876145 GGTTCCACAAAGACCCCTCCAGG + Intronic
1147863338 17:43536856-43536878 GGCTCCACTAAGACCCAGGAGGG + Intronic
1148147688 17:45376425-45376447 GGCTCCCCCAACCCTCCTGACGG + Intergenic
1148189123 17:45666644-45666666 AGCTCCCCACATACCCCTAAGGG + Intergenic
1148888303 17:50789320-50789342 CCCCCTCCAAAGACCCCTGAGGG - Intergenic
1150008569 17:61485334-61485356 GGGTCCACAAAGACCCCAGAAGG + Intergenic
1150602976 17:66666508-66666530 AGCTTCTCAAAGTCCCCTGAAGG - Intronic
1151569106 17:74917335-74917357 GGCCCCCCAGGGACCCCAGAGGG - Exonic
1151786925 17:76279618-76279640 GGCTTCCCATGGGCCCCTGAGGG + Intronic
1151975692 17:77482560-77482582 GGCTCCCCAAAGTCATCTCAGGG - Intronic
1151980683 17:77506691-77506713 AGCTCCCCCGAGAGCCCTGAAGG + Intergenic
1152623169 17:81376015-81376037 GGCACCCTGGAGACCCCTGAGGG - Intergenic
1153731165 18:8013320-8013342 GGCTCCCCAAAAACTTCTAATGG + Intronic
1157582368 18:48781089-48781111 GGCTCCCAAATGACCCCAAAGGG + Intronic
1159255759 18:65943368-65943390 GGCCACCAAAAGACCCCTGCAGG + Intergenic
1160826052 19:1081097-1081119 GGCACCCCAAAGGCTCCCGAAGG - Intronic
1161647912 19:5465701-5465723 GGCTCCCCAAGGTCCCCAGTGGG - Intergenic
1163667488 19:18610115-18610137 GGGTCCCCACAGGACCCTGAAGG - Intronic
927349667 2:22094415-22094437 GACTCCCCAAAGACCCAGAATGG - Intergenic
927490126 2:23515783-23515805 GGCTCCCCAAAGAAACCACAAGG + Intronic
929254971 2:39800594-39800616 GGATCCCCAAAGATCTCTTATGG + Intergenic
929825847 2:45309260-45309282 GACTCTCCCAAGACCCCTGATGG + Intergenic
932434008 2:71692440-71692462 GGCTCCACAAAGTCCCCCCAGGG - Intergenic
937143873 2:119626042-119626064 GGCTCCCCTGAAACCCCTGGGGG - Intronic
937217985 2:120324698-120324720 GGGTCTCCAGAGACACCTGAGGG - Intergenic
937247885 2:120505235-120505257 GCCTCCACATAGAGCCCTGATGG + Intergenic
940152275 2:150615676-150615698 GGCTCCAGGAAGAACCCTGAGGG + Intergenic
941223392 2:162813441-162813463 GCCTCACCAATCACCCCTGATGG - Intronic
945723286 2:213445891-213445913 GGTTCCTCAAAAAACCCTGAGGG + Intronic
946307899 2:218866277-218866299 GGCTACCCAACGCCCTCTGAAGG - Intronic
947518136 2:230824588-230824610 GGCAGCTCAAAGACGCCTGAAGG + Intergenic
1171303466 20:24084366-24084388 GGCTCCCTGAAGACCACTGCTGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG + Intronic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1172730330 20:37081881-37081903 GACTCACCAGAGACCCCTGCTGG + Intronic
1172775707 20:37405493-37405515 TGCTGCCCAAAGACCCCTCAAGG - Exonic
1173891419 20:46513704-46513726 AGCTCCTCAAAGATCCCTCAGGG - Intergenic
1174271038 20:49368746-49368768 GGCTCCCCTGAGACCCCGGCAGG - Exonic
1179843256 21:44091320-44091342 GGCTCCCCAAAGGCCAGTGAGGG + Intronic
1180200822 21:46223042-46223064 GTCTCCCCCAAGTGCCCTGAAGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1180626706 22:17198721-17198743 GGCTCTTCCAAGACCCCGGAGGG - Intronic
1180744513 22:18078408-18078430 GGGTCCCCCGAGCCCCCTGAGGG - Exonic
1180869818 22:19139794-19139816 GGCTCCCCAACCACCACAGAGGG + Intronic
1183092987 22:35536039-35536061 GCCTCACCAAACATCCCTGAAGG - Intergenic
1184943277 22:47783917-47783939 GGAGCCCCCAAGAACCCTGAAGG - Intergenic
1185157850 22:49205038-49205060 GGGTCCACACTGACCCCTGAAGG + Intergenic
949954736 3:9258456-9258478 GGTTCCCCCAGGAGCCCTGAAGG + Intronic
950123897 3:10499809-10499831 GGATGCCCAGAGACCCCTTAGGG - Intronic
952885931 3:38010967-38010989 GGGTCCTCAAAGCCCCCTGAAGG + Intronic
953293257 3:41687787-41687809 TGCTAACCAAACACCCCTGAAGG + Intronic
953663851 3:44911189-44911211 GGGGCCCCTAAGAACCCTGAGGG + Intronic
953918101 3:46933433-46933455 GCCTACCCAAAGGCCCCTGAGGG + Intronic
954682909 3:52355555-52355577 GGCTGCCCACAGAGCCCTGGAGG + Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
957419883 3:79953883-79953905 AGCTCCCCAAAGGCCCCAAAGGG - Intergenic
962739097 3:138349631-138349653 TACTCCCCAATGGCCCCTGATGG + Intronic
963071978 3:141311929-141311951 GGCTCACGAACGACCCCTGGAGG - Intergenic
969540736 4:7787538-7787560 GCCTCCCGGAAGACCACTGAGGG + Intronic
973801314 4:54481703-54481725 GTCTCCCCCAAGACCCAGGAAGG + Intergenic
975856714 4:78632569-78632591 GGCTCCCCCAACACCCCTACTGG + Intergenic
977575187 4:98666811-98666833 GTCTGCCCCAACACCCCTGATGG - Intergenic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
980087918 4:128410470-128410492 CCCTCCCCAAGGACTCCTGAGGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985996951 5:3602403-3602425 GGGTCCGCAAAGCCTCCTGAAGG - Intergenic
986353895 5:6905526-6905548 GGGTCACCAGAGAGCCCTGAGGG + Intergenic
986604242 5:9505683-9505705 GGCTCCCAAAACACCTCTGCTGG + Intronic
996540856 5:124629231-124629253 GGCTCCCCAGTGTCCCGTGATGG + Intergenic
1001935078 5:175697896-175697918 ACCTCCCCAAACACCCCTCATGG + Intergenic
1003345344 6:5261172-5261194 GTCTCCGCCAAGACCCCAGACGG - Exonic
1006538372 6:34719443-34719465 GGCACGTCAAAGACCACTGAAGG + Intergenic
1007871560 6:45045230-45045252 TGGTCCCCATAGACCACTGATGG - Intronic
1011547993 6:88501469-88501491 GACTCACCTAAGACCACTGATGG - Intergenic
1013803852 6:113975416-113975438 GGCTCCCCACAGTCATCTGAGGG - Intronic
1016465648 6:144322453-144322475 TGCTCCACAAAGTCCCCTGCAGG - Intronic
1016569059 6:145492373-145492395 GCCACCCCCAAGGCCCCTGAGGG + Intergenic
1016729728 6:147416315-147416337 GTGTCCCCACAGTCCCCTGAAGG + Intergenic
1017716802 6:157218653-157218675 GGCTCCCCAAGGCCCCCGGCTGG + Intergenic
1019325572 7:436672-436694 GGCTCCCCGCAGACCACTGAGGG - Intergenic
1019415570 7:925227-925249 TGCTCCCCGAAGACCCCGGGAGG + Intronic
1019702950 7:2482956-2482978 GGCTCCCTACTGACCCCTGGAGG - Intergenic
1019733533 7:2639755-2639777 GGCTCCACAGAGGCCACTGAGGG - Intronic
1024891583 7:54210415-54210437 GTCTCCCCAAATAAACCTGAAGG + Intergenic
1026523340 7:71134431-71134453 GGCTCACCAAAGGTCCCTGCTGG + Intronic
1026559935 7:71440312-71440334 TGCTCCCCCACGACCTCTGATGG + Intronic
1034526310 7:151665257-151665279 GTCTCCCCAGGGACCCATGAGGG - Intronic
1035033491 7:155880126-155880148 GGCTCACCACAGACATCTGATGG + Intergenic
1036632662 8:10526141-10526163 GGCCCCCCAGAGCTCCCTGATGG + Intronic
1041908048 8:63055003-63055025 GGCTCCTGAAAAACCCCTTAGGG + Intronic
1043103842 8:76083022-76083044 GCCACCCCCAAGACCCCAGAAGG - Intergenic
1045355979 8:101389489-101389511 GGCTCCCCACATTCCCCTTAAGG + Intergenic
1048294661 8:133205580-133205602 GAGTCCCCAGAGAGCCCTGACGG - Intronic
1048324175 8:133426289-133426311 GGCTCCCCAACCACCCCTGATGG - Intergenic
1049552425 8:143266834-143266856 GGTTCCCCAAAGCCCCTTCATGG - Intronic
1051716914 9:19994658-19994680 GGCTTCCCAAGGACCTCTGAGGG + Intergenic
1051966788 9:22837373-22837395 GGTTCCCCAAAGATCTCTGAAGG + Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1055336404 9:75237077-75237099 GCCTGCCCCAACACCCCTGAAGG - Intergenic
1056457888 9:86781155-86781177 GTGTCCCCAAAGCCACCTGAAGG + Intergenic
1057302277 9:93893897-93893919 GGCTTCCCAAAGCCCCATCAGGG + Intergenic
1058429180 9:104903269-104903291 GGCTCTCCAAAAGCCCCTAATGG - Intronic
1060920841 9:127419238-127419260 TGCTCCCCAAAGACCAAGGAGGG - Intergenic
1061052489 9:128204575-128204597 GGCTCCCCACAAACCCCCAAAGG + Intronic
1061743511 9:132723909-132723931 TTCTTCCCAAAGACCCCTGGGGG - Intergenic
1062145932 9:134989674-134989696 GGCTTCCCACTCACCCCTGAGGG + Intergenic
1062331697 9:136047755-136047777 GACTCCCCAAAAACCCATCAAGG + Intronic
1062631459 9:137464936-137464958 GGCTTCCCCGGGACCCCTGATGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185670730 X:1807352-1807374 GGCTCCTCACTGACTCCTGAGGG - Intergenic
1191579897 X:62749029-62749051 GGCTCCCAAATGTCCCCTCACGG + Intergenic
1199686464 X:150269702-150269724 GGCTCCCCAAACACCAATCAAGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic