ID: 978870231

View in Genome Browser
Species Human (GRCh38)
Location 4:113566923-113566945
Sequence TTGTAGTAGTTGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978870231_978870237 18 Left 978870231 4:113566923-113566945 CCCTCCTCCTTCAACTACTACAA 0: 1
1: 0
2: 0
3: 24
4: 243
Right 978870237 4:113566964-113566986 CATTACTGTATTCCAGGACTTGG 0: 1
1: 0
2: 3
3: 19
4: 188
978870231_978870235 12 Left 978870231 4:113566923-113566945 CCCTCCTCCTTCAACTACTACAA 0: 1
1: 0
2: 0
3: 24
4: 243
Right 978870235 4:113566958-113566980 CTTGTCCATTACTGTATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978870231 Original CRISPR TTGTAGTAGTTGAAGGAGGA GGG (reversed) Intronic
900364116 1:2303832-2303854 TTGTAGGAGTAGAAGCTGGAGGG - Exonic
902143541 1:14377322-14377344 TTGTAGAAATTGGAGGAGGCAGG + Intergenic
904273761 1:29367214-29367236 TTGCATTTGTTAAAGGAGGAGGG - Intergenic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
905850600 1:41271498-41271520 TTGTAGAAGTTAGAGGAGGTTGG - Intergenic
906013553 1:42552622-42552644 TTGAGGTAATTGCAGGAGGAAGG + Intronic
906219981 1:44070955-44070977 TTGTATTACTTGTAGGAGGATGG + Intergenic
906241566 1:44245342-44245364 TTGTAGTCTTTGAATGAAGAGGG - Intronic
909429493 1:75570421-75570443 TGGTGGTAGGTGAAAGAGGAGGG + Intronic
910692659 1:89980859-89980881 TTGTAGGATATGGAGGAGGAAGG + Intergenic
911717415 1:101149613-101149635 TTGTAGTAAAGAAAGGAGGAGGG + Intergenic
913393131 1:118336323-118336345 TTTTAGTAGTGGAAGGTGCAAGG + Intergenic
914095479 1:144540757-144540779 TTGTTGTTGTTGAAGCAGAATGG + Intergenic
914255589 1:145959595-145959617 TTGTAGTTGTTGGAGGAACAGGG + Exonic
914303046 1:146393139-146393161 TTGTTGTTGTTGAAGCAGAATGG - Intergenic
914516684 1:148380079-148380101 TTGTTGTTGTTGAAGCAGAATGG + Intergenic
915618407 1:157060704-157060726 ATGCAGTACTTGAAGGAGAACGG - Intergenic
916513467 1:165494289-165494311 TTTTTGTAGGTGAAGGAGGATGG + Intergenic
917001320 1:170363828-170363850 TTGGAATAGTTTCAGGAGGATGG + Intergenic
917645660 1:177026356-177026378 TGGAAGTAGTTGGAGGAGCAGGG - Intronic
918043004 1:180924512-180924534 TTGAAGGTGTTGAAGGAGGTGGG + Intronic
919020632 1:192100873-192100895 GTGTAAGAGTTGAAGAAGGAAGG + Intergenic
919671852 1:200345444-200345466 TTATAATAATTGAAAGAGGAAGG - Intergenic
920084927 1:203408523-203408545 TGGGAGTAGTAGTAGGAGGAGGG + Intergenic
920155948 1:203951406-203951428 TTTTAGTTGTTGAAGGTGGGAGG - Intergenic
920654637 1:207866678-207866700 TTGGAGTAGATGCAGGGGGAAGG - Intergenic
921116889 1:212100364-212100386 TAGGAGTATTTGAAGGAAGAGGG - Exonic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921405205 1:214771566-214771588 ATGTAGAAGTTGCAGGAGAATGG - Intergenic
923183109 1:231542162-231542184 TTTTAGTTGTTTAAGGAGGGAGG + Intronic
923224848 1:231929883-231929905 TTGTAGTAGTTAAGGGGTGAGGG + Intronic
923267574 1:232329333-232329355 TTGAAGTAGTCGAAGTAGTAGGG - Intergenic
1063634485 10:7768612-7768634 GAGTAGCAGTTGAAGGAGGGAGG + Intronic
1064342665 10:14500807-14500829 TTGTAAGAGTTAAAGGAGTAGGG - Intergenic
1064810836 10:19196476-19196498 TTTAAGTATTTGAAGGAGGAGGG - Intronic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1067537701 10:47126707-47126729 TTGTAGCAGTGGCAGAAGGAAGG - Intergenic
1069939650 10:71945875-71945897 TTTTATTACTTGAAGGAGCAAGG - Intergenic
1070050909 10:72888725-72888747 TTGTAAGAGTTGAAGAAAGAAGG - Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1074552956 10:114462251-114462273 TAATAATAGCTGAAGGAGGAAGG - Intronic
1076220313 10:128728501-128728523 TTGTTGGAGTTGAGAGAGGAAGG - Intergenic
1078157334 11:8810353-8810375 TTCTATTAGCTTAAGGAGGAGGG - Intronic
1079636124 11:22743611-22743633 TTGTAGCAGTGGAGGGAGGGAGG - Intronic
1079820555 11:25122159-25122181 TTCCTGGAGTTGAAGGAGGAAGG - Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080969756 11:37258478-37258500 TTGGAAGTGTTGAAGGAGGAGGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1087165029 11:94994598-94994620 TTGTAGGAGTTTTAGGAGGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1090872668 11:130762121-130762143 TTGGAGCAGTTGGAGAAGGAGGG - Intergenic
1090988693 11:131796399-131796421 TAGTAGGTGTTGAAGGAAGATGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1093115035 12:15198708-15198730 TTCTAGAAGGTGAAGGAGGCAGG - Intronic
1094070021 12:26402875-26402897 TTGGAGTAGTGAAAGGAGGCAGG - Intronic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097308011 12:58090432-58090454 TTGTAGGGGTTGAAAGAGTAGGG - Intergenic
1098425049 12:70353874-70353896 GGGTTGTAGTTGAAGGTGGATGG - Exonic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1099690646 12:85947406-85947428 ATGTAGTGGTTGGAGGAGGCGGG + Intergenic
1100951930 12:99860397-99860419 ATTTAGTAGTTTAGGGAGGAAGG + Intronic
1101391887 12:104308706-104308728 CAGTTGTAGTTGGAGGAGGATGG + Intronic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1106320162 13:28630293-28630315 TTGTGGGAGTTGAATGAGGATGG - Intergenic
1106858327 13:33876695-33876717 TTGTCGTAGTTGAACGAGCATGG + Intronic
1106916825 13:34524711-34524733 TTGTAGGAGTTGGGTGAGGAGGG - Intergenic
1107599057 13:41993917-41993939 TGTTGGTAGTTGGAGGAGGAGGG - Intergenic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1109523016 13:63536766-63536788 TTCTTGTAGTTGAGAGAGGAGGG + Intergenic
1110429047 13:75402021-75402043 TTGCATTAGATGCAGGAGGAAGG - Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111025872 13:82522699-82522721 TTGTTGTATTTTAAAGAGGAGGG + Intergenic
1111703176 13:91716142-91716164 TTATAGTCGTTGAAGAATGATGG + Intronic
1113208689 13:107948804-107948826 TTAGAGTAGTTCAAGTAGGATGG - Intergenic
1116245735 14:42409089-42409111 TTATAATAGTGGAAGGTGGAAGG - Intergenic
1117524869 14:56590037-56590059 TTTTTGTAGTTGAAGAAGAATGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1120368852 14:83606761-83606783 TTGTGGTAGTTGAAAGAGATGGG - Intergenic
1120566955 14:86071757-86071779 TTGTTGTAGTAGTAGAAGGAAGG + Intergenic
1121382254 14:93482955-93482977 ATGTAGTAATTGAAACAGGAAGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1123688748 15:22819582-22819604 TTGCAGTAGTAGAAGTAGTATGG - Intronic
1125280758 15:38040282-38040304 TTGTGGAAGTTGTAGCAGGATGG - Intergenic
1126598476 15:50405165-50405187 GTGGAGTCCTTGAAGGAGGAAGG - Intergenic
1128216659 15:65939011-65939033 TTGGACTAATTGGAGGAGGATGG + Intronic
1129671066 15:77607895-77607917 TTGTGGAAGTTGGGGGAGGAGGG - Intergenic
1132266654 15:100478921-100478943 TTTAAATATTTGAAGGAGGAGGG + Intronic
1133638721 16:7696467-7696489 TTGTAGTAGTTGCAGAAGAAGGG + Intronic
1135335348 16:21597119-21597141 TTCTAGTAGATGAAGGAAGGGGG + Intergenic
1137956107 16:52831531-52831553 TTGTAAAAATGGAAGGAGGAAGG + Intergenic
1138207727 16:55137147-55137169 TTGTGGTGGTTGAAAGATGAAGG + Intergenic
1138687855 16:58741449-58741471 TTGTGCTAGTTCAGGGAGGAAGG - Intergenic
1139116632 16:63962230-63962252 TTGCAGTAGTTATAGGATGAAGG - Intergenic
1139558881 16:67729343-67729365 TCGGAGTAATTGACGGAGGATGG + Exonic
1140987239 16:80169690-80169712 TTGTTGTTGTTGAAGGGGCAAGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1149125269 17:53222336-53222358 CTGTAGTATTTGAAAGAGCATGG + Intergenic
1149167630 17:53772154-53772176 TTTTATTAGTTGAAAGAGGAGGG + Intergenic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1149754343 17:59174954-59174976 CTGGAGTAGTTGGAGGAGGTAGG - Intronic
1150567994 17:66360185-66360207 TTGCAGTATTTGAAGTTGGAGGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156194269 18:34755763-34755785 TTGTTGTAGTTGTTGGAGGGGGG - Intronic
1156215010 18:34989175-34989197 TTGTAATAGTTGCATGAGGGTGG - Intronic
1164790353 19:30972298-30972320 TTGGAGTGGGTGAGGGAGGAGGG - Intergenic
1164851482 19:31487905-31487927 TTGCAATAGCTGAAGGTGGAAGG - Intergenic
925095701 2:1198971-1198993 TTGAAGTAGTTTAAGAAGTATGG - Intronic
925484176 2:4309913-4309935 TTGGAGTAGTTTCAGGAGGAAGG + Intergenic
931813069 2:65873673-65873695 TTTTAGGATTTGAAGGAGGAAGG + Intergenic
931868525 2:66435819-66435841 TATTAGAAGTTGAAGTAGGAAGG + Exonic
932199896 2:69816272-69816294 TTGTACCAACTGAAGGAGGAAGG - Intronic
933676561 2:85062772-85062794 TAGAAGTATTTGAAGCAGGATGG - Intergenic
935600186 2:104914691-104914713 TTGCTTTAGCTGAAGGAGGAGGG + Intergenic
935957189 2:108388878-108388900 TTGTAGTGTTTGTAGGAGGAAGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
938166813 2:129036451-129036473 TTTTAGTTGTGGCAGGAGGAAGG - Intergenic
939352522 2:141057814-141057836 TTGAGGTATTTGAAGGAGAAAGG - Intronic
940227083 2:151410795-151410817 TGGAAGTAGTTGTTGGAGGAGGG + Intronic
941125364 2:161578214-161578236 CTCTAGTAGTGGAAGGAGGGAGG + Intronic
941147763 2:161873688-161873710 TTATAGTAGTGGGAGGAGGTGGG + Intronic
941588663 2:167390868-167390890 TGGTAGTTGTTAAAGCAGGAAGG - Intergenic
942481714 2:176395165-176395187 TTGGAGTAGTTGAAGGATAAGGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
944097046 2:195980041-195980063 TTGTATTAGTTTGAGTAGGAAGG - Intronic
944148763 2:196535072-196535094 TTTTAGCAGTTGAAGGAGAGTGG - Intronic
945094494 2:206206061-206206083 TTTTGGTAGTTGAATGGGGAAGG - Intronic
946510232 2:220348132-220348154 TTGCAGTTGTTGAGGGAGCATGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1169895886 20:10504523-10504545 TTGTTGTAGAGGAAGTAGGAGGG + Intronic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1171520015 20:25768653-25768675 TTTTAGAGGTTTAAGGAGGAAGG - Intronic
1171556904 20:26087840-26087862 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1172088922 20:32413180-32413202 TTGTTGTTGTTTAAGGATGAAGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1174894356 20:54433173-54433195 TGGTAGTTGTTGGGGGAGGAGGG - Intergenic
1176654148 21:9574940-9574962 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1179603374 21:42496149-42496171 TCGGAGGAGTTGGAGGAGGAGGG - Exonic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
950644503 3:14368991-14369013 GGGTGGTAGTTGAAGGATGAGGG + Intergenic
952702072 3:36338455-36338477 TTGAATTGGTTGAAGGAGTAGGG + Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
954115575 3:48465348-48465370 TTGCAGTAGCTGAGGGAGCAGGG + Intronic
954672254 3:52297397-52297419 TTGTAGTGGCTGGAGGAGGGTGG + Intergenic
954839475 3:53497678-53497700 TAGTAGTAGTAGTAGGGGGAGGG + Intronic
955025214 3:55160906-55160928 TTGTAGTAGCTGGAGCAGGGGGG - Intergenic
955095737 3:55796067-55796089 TTGTGGTGGTTGAGGGGGGAGGG + Intronic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
960893829 3:122480140-122480162 TAGTAGTTGTTGTAGGAGGTTGG + Intronic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
962830642 3:139136318-139136340 TTGGAGTGGATGTAGGAGGAAGG + Intronic
963814709 3:149816559-149816581 TGTTAGCAGTTGAAGGAGGGTGG + Intronic
963926358 3:150955536-150955558 TTTTAGAAGTTGAAAGAGGCAGG + Intronic
964656106 3:159067521-159067543 TTGGAGTCTTTCAAGGAGGAAGG - Intronic
965285757 3:166817718-166817740 ATGTAGTAGTGGAAGGAGAGAGG - Intergenic
965856531 3:173095196-173095218 TTGTAGGAATTGAAGGAGTATGG + Intronic
968330025 3:197860288-197860310 ATTTAGAAGTTGAAGGAGGTTGG - Intronic
968563424 4:1296647-1296669 GAGTAGTAGCTGGAGGAGGACGG - Intronic
977338343 4:95726285-95726307 TTGAAGTATGTGAAGGAGGGAGG + Intergenic
977508865 4:97936993-97937015 TTGGAGTACTTGAAAGAGAAAGG - Intronic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979177527 4:117682701-117682723 TTGTAATAGTTTCAGAAGGATGG + Intergenic
981685303 4:147447806-147447828 TTGTGGTGGTTGAAGGGGAATGG - Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983098720 4:163597981-163598003 TTGGTGTATCTGAAGGAGGAGGG - Intronic
984391622 4:179141464-179141486 GTGTAATGGTTGGAGGAGGATGG - Intergenic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
987098676 5:14573326-14573348 TTCAAGTAGTTGATGGTGGAGGG + Intergenic
988629150 5:32910669-32910691 TGGTAGTATTTGAGGTAGGATGG + Intergenic
989987773 5:50722097-50722119 TTATAATATTTGAAGGATGAGGG + Intronic
990321768 5:54636601-54636623 TTGTAGTTGTGGAAAGAGGCAGG - Intergenic
990372288 5:55132384-55132406 TGCTGGTAGTTGAAAGAGGATGG - Intronic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
991648737 5:68829502-68829524 TTGTAGTGGCTGGTGGAGGAAGG - Intergenic
992365079 5:76083047-76083069 TTGTAGCAGGTGAAGGAGAGGGG - Intergenic
993475935 5:88364042-88364064 TTGTGGTACTTTAAGGAAGATGG - Intergenic
993478711 5:88396684-88396706 TTGGTGTGGTTGAAAGAGGAAGG + Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
994379934 5:99058717-99058739 TTGTAGAGGTTGTGGGAGGAAGG + Intergenic
995016892 5:107319961-107319983 TTCTACTATTTGAAGGGGGATGG - Intergenic
995496436 5:112749430-112749452 TTGAAGGATTTGGAGGAGGAGGG + Intronic
995594039 5:113729828-113729850 TTGGAGTACATGAAGGAGAAGGG - Intergenic
996646390 5:125823399-125823421 TGGAAGGAGTTGAAGGATGATGG - Intergenic
996965701 5:129305325-129305347 TTGGAGTACCTGAAGGAGGCGGG - Intergenic
998749191 5:145298494-145298516 TTGTAGCAGTTTTAAGAGGAGGG + Intergenic
1003226694 6:4212390-4212412 TTGCAGTAGCTGGAGGAGGAAGG - Intergenic
1004210108 6:13631758-13631780 GTGTACCAGTTGAAGGTGGAGGG - Intronic
1004760267 6:18657920-18657942 TTGGAGTACTTGAAGGAGACAGG + Intergenic
1004949442 6:20652103-20652125 TTGGAGTAGTTTCAGGAGGATGG + Intronic
1005438098 6:25836553-25836575 TGTTAGTATTTGGAGGAGGAAGG + Intronic
1006808443 6:36804561-36804583 GTGAGGTTGTTGAAGGAGGAGGG - Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009608642 6:65907351-65907373 TTGCAGTAGTTTCAGTAGGATGG - Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1009856363 6:69269884-69269906 TTGTAATATTTGATGGAAGAAGG - Intronic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1012004648 6:93697440-93697462 TTGTAGTAGTTGACATAGGAAGG + Intergenic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1014154804 6:118098244-118098266 TTGTCTTAATTGTAGGAGGATGG - Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015659978 6:135564857-135564879 TTGTAGTACCTGAAAGAGGCAGG - Intergenic
1016271197 6:142292598-142292620 TTTTAGGAGTTGCAGGTGGAGGG - Intergenic
1016623384 6:146138431-146138453 TTGTAATAGTTTGAGTAGGATGG + Intronic
1021442712 7:20696389-20696411 TATCAGTAGTTGCAGGAGGAAGG + Intronic
1023130117 7:36994615-36994637 TTGCAGGAGTGGGAGGAGGAAGG - Intronic
1025028627 7:55537811-55537833 TTGAAGTAGTGGAAGTTGGAGGG - Intronic
1025280500 7:57623614-57623636 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1025304231 7:57841893-57841915 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1026055838 7:66982909-66982931 TTGTTGTTGTTGCAGGAGGAGGG - Intergenic
1027357344 7:77370880-77370902 TTGTAGTAGCTGAAGGCACAGGG - Intronic
1027814905 7:82955964-82955986 TTGTAGTTACTGGAGGAGGAGGG - Exonic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028812090 7:95099115-95099137 TTGTAGTAAAAGAAGCAGGAAGG + Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1031797248 7:126190677-126190699 TTATAGTAGTTAAAGCAGTATGG + Intergenic
1032635297 7:133700702-133700724 TTTTATTAGCTGAAGGAGGTTGG + Intronic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033410469 7:141113266-141113288 CTGTTCTAGTTGAAGCAGGAGGG + Intronic
1033579263 7:142716703-142716725 TTGTGGTAGTTGAAGGATAAGGG - Intergenic
1037926079 8:22845139-22845161 TTCTAGTCCTTGAAGGATGAAGG + Intronic
1038343078 8:26705326-26705348 TTGTAATAGTTTTAGGAGGTGGG + Intergenic
1039305218 8:36254730-36254752 TTTCAGTACTTGAAGGAGGAAGG - Intergenic
1039722004 8:40174341-40174363 TTGTGGTAGTTGCAGGACGAGGG + Intergenic
1041513929 8:58679200-58679222 TTCTAGTTTTTAAAGGAGGAAGG + Intergenic
1041730001 8:61053426-61053448 ATGTAGTGTTTCAAGGAGGAGGG + Intergenic
1042968435 8:74381013-74381035 TTGGAGTAGGTGAGGGAGAAAGG + Intronic
1044794847 8:95886196-95886218 TGTGAGTAGTTGAAAGAGGATGG - Intergenic
1044906013 8:97003786-97003808 TTGTGGTAGGTGAGGCAGGATGG + Intronic
1046631044 8:116623425-116623447 TTGTAGTAGCTGAAGGCAGGAGG - Intergenic
1047904963 8:129463072-129463094 TTGTAGTATTTGATGAAGAAAGG + Intergenic
1050254589 9:3780596-3780618 TTATAGTAGCTGAAAGAGGCTGG - Intergenic
1050765353 9:9126153-9126175 TTGTAGGATTTTAAGCAGGAGGG + Intronic
1051103111 9:13545547-13545569 TTGTTGTTGTTGCAGGGGGAGGG + Intergenic
1052001013 9:23280736-23280758 TTGTAGTAAGTGGAAGAGGATGG - Intergenic
1052394904 9:27927257-27927279 ATTTAATAGATGAAGGAGGAAGG + Intergenic
1052619828 9:30892069-30892091 TTATAGTAGTTGCAGGTGGAAGG + Intergenic
1055067963 9:72137773-72137795 TTGTAACAGTTGAAGGTGGGGGG - Intronic
1058273534 9:103007892-103007914 TCTTAGTAGTTGATGCAGGAGGG - Intronic
1059139063 9:111834923-111834945 TGGTAGTAGGTCAAGGAAGAGGG - Intergenic
1203631871 Un_KI270750v1:78398-78420 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1186403748 X:9283456-9283478 TTTTACCAGTTGAGGGAGGATGG - Intergenic
1187152538 X:16694330-16694352 TTGCTGTAGATGAAGAAGGAGGG - Intronic
1187398757 X:18940857-18940879 TTTAGGTAGTTGAAGTAGGAAGG - Intronic
1189369777 X:40418505-40418527 TTATAGTGGTTGGATGAGGAAGG + Intergenic
1190291404 X:48995183-48995205 TGGGAGGAGTTGGAGGAGGAAGG + Intronic
1190881933 X:54497576-54497598 TGGAAGTGGTTTAAGGAGGAGGG - Intergenic
1191665927 X:63702629-63702651 TTGTACTTGTTGAAGGGGAAAGG - Intronic
1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG + Intergenic
1193491287 X:82152020-82152042 CTATAGTAGTTAAAGGAGTATGG + Intergenic
1193762134 X:85480080-85480102 TTGGAGTATTTGAAGGAGAGTGG - Intergenic
1196829159 X:119762765-119762787 CTTTAGTAATTGAAGGAGGGAGG + Intergenic
1198802742 X:140464144-140464166 TTGTAGTATTTGAATAAGGGAGG + Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic