ID: 978877536

View in Genome Browser
Species Human (GRCh38)
Location 4:113659836-113659858
Sequence AAAAGGAACCTTCTGGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 366}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978877536 Original CRISPR AAAAGGAACCTTCTGGTTTG AGG (reversed) Intronic
900883340 1:5398107-5398129 AAAATAAAACTTCTAGTTTGGGG - Intergenic
901103254 1:6735792-6735814 AAAAGGACACTTCTGGATTTAGG + Intergenic
902824509 1:18963754-18963776 TGAAGGGACCTTCTGGTGTGTGG - Intergenic
903174687 1:21573876-21573898 AAAGGGAACTGACTGGTTTGGGG + Intronic
903297518 1:22353998-22354020 AAAATGAATCCTCTGTTTTGGGG - Intergenic
903440462 1:23384254-23384276 ACAAGGCCCCTTCTGGGTTGTGG + Intronic
904844228 1:33396688-33396710 CCAAGGAACCCTCTGGTATGGGG + Intronic
904916453 1:33973792-33973814 AGAAGGTGCCTTCTAGTTTGGGG + Intronic
905632128 1:39524749-39524771 AGAAGGACCTTTCTGGCTTGGGG + Intronic
905783389 1:40732448-40732470 AAAAGGAACACTCTGATTTTGGG + Intronic
907061553 1:51431405-51431427 AAAATGAACCATCTGATTTTGGG - Intronic
909220757 1:72958231-72958253 AAAAGTCATCTTTTGGTTTGGGG + Intergenic
909964836 1:81895686-81895708 AAAAGGTACTTTCAGGTCTGGGG - Intronic
910737521 1:90477027-90477049 AAAAGAGACCCTTTGGTTTGTGG - Intergenic
911982872 1:104587455-104587477 AAAAGAGACATTCTGGTTTTTGG - Intergenic
912262007 1:108120034-108120056 AAAATGAAATTTCTGATTTGGGG - Intergenic
913648180 1:120881952-120881974 TTATGGAAGCTTCTGGTTTGGGG + Intergenic
914078509 1:144381331-144381353 TTATGGAAGCTTCTGGTTTGGGG - Intergenic
914100670 1:144585171-144585193 TTATGGAAGCTTCTGGTTTGGGG + Intergenic
914173419 1:145249879-145249901 TTATGGAAGCTTCTGGTTTGGGG - Intergenic
914298315 1:146352478-146352500 TTATGGAAGCTTCTGGTTTGGGG - Intergenic
914528073 1:148491016-148491038 TTATGGAAGCTTCTGGTTTGGGG - Intergenic
914638314 1:149576051-149576073 TTATGGAAGCTTCTGGTTTGGGG + Intergenic
915013862 1:152714949-152714971 AAAAGGAACCATCTCTTTTTGGG - Intergenic
915113354 1:153579018-153579040 AAAAGGAACCTACCTATTTGAGG + Intergenic
917704945 1:177622984-177623006 AAAAGGAACCCTCAGGTTTAGGG + Intergenic
918839186 1:189512949-189512971 AAAAGGAATCTCCTGATCTGCGG - Intergenic
919572868 1:199270271-199270293 AACAGGACCCTTCTGGAATGAGG - Intergenic
919868834 1:201804825-201804847 AAAATGAACCTTCTTCTTTTTGG + Intronic
920105862 1:203553031-203553053 AAAAGGAAATATCTGGTTTCTGG + Intergenic
920155360 1:203945549-203945571 ACAAGGAATCTTCTGTTTTATGG + Intergenic
920670140 1:207997766-207997788 AAAATGGGTCTTCTGGTTTGAGG - Intergenic
921371644 1:214429571-214429593 ACAAGGAAACTTCTGGTTACTGG - Intronic
923522568 1:234747018-234747040 AAAAGGAAGCCTGAGGTTTGAGG + Intergenic
923806817 1:237266637-237266659 AAAAGGAACCTTTTGATTACTGG + Intronic
924499120 1:244619661-244619683 AACAGGGGCCTCCTGGTTTGGGG + Intronic
924829061 1:247573327-247573349 CAAAGGAATCTCCTGGTCTGTGG + Intronic
924841903 1:247720479-247720501 AAAAGGAACCTTCTGAGGTATGG + Intergenic
1063043982 10:2372962-2372984 ACAAGAAACTGTCTGGTTTGGGG + Intergenic
1063044289 10:2376418-2376440 AAAAGGAACTTTCTGGCTACAGG - Intergenic
1063394764 10:5676683-5676705 AAAAAGAAACTTCAGGTGTGGGG + Intergenic
1063496368 10:6512953-6512975 AAAGGGAAGCTTCAGGTCTGTGG - Intronic
1063887872 10:10598037-10598059 AAAAGGAACCCTTTGGTATCTGG + Intergenic
1064093752 10:12407394-12407416 AGAAGGAAACTTCTAGCTTGAGG - Intronic
1064175404 10:13071089-13071111 AAAAGGAAACCTCTGGGTGGTGG - Intronic
1064252952 10:13720980-13721002 AAATGGAACCATATGGTATGTGG - Intronic
1064899425 10:20277391-20277413 AAAGAGAACCTTCTGTGTTGAGG - Intronic
1070146777 10:73780050-73780072 AACATGAATCTTCTGATTTGGGG + Intronic
1070150951 10:73804717-73804739 AAAAGGATCCTTTGGGTTTAAGG + Intronic
1070285675 10:75081871-75081893 AAAAAGAACATTCTGGTTTGTGG + Intergenic
1072010180 10:91296352-91296374 AAAATGAAGCATGTGGTTTGAGG + Intergenic
1072375743 10:94813922-94813944 GAAGGGAATCTTCTGGTCTGTGG + Intronic
1072389619 10:94969573-94969595 GAAGGGAATCTTCTGGTCTGTGG + Intronic
1072394739 10:95026919-95026941 CAATGGAATCTTCTGGTCTGTGG + Intergenic
1075079039 10:119370544-119370566 AAAAGGAAACATTTGGTATGTGG - Intronic
1075169239 10:120097727-120097749 AAAAGGAACATTCTAGGTCGGGG + Intergenic
1075383371 10:122037103-122037125 AAAAGGAACATTCTGGAATAAGG + Intronic
1075528402 10:123204940-123204962 AAAAGGAAGCCGCTGGTGTGAGG + Intergenic
1077869457 11:6249894-6249916 GAAAGGAATCACCTGGTTTGAGG + Intergenic
1078034428 11:7788212-7788234 AAAAGGCAACTTATGGTTTGGGG + Intergenic
1079743695 11:24098279-24098301 AAGAAGAGCCTTCTGGTTTATGG + Intergenic
1080117673 11:28638958-28638980 AGAGGGAATCTCCTGGTTTGTGG - Intergenic
1081080103 11:38731180-38731202 AAAAGAGACTTTCTGGTTTTGGG + Intergenic
1081483726 11:43511678-43511700 CAAAGGAAGATTCAGGTTTGGGG + Intergenic
1081748227 11:45488001-45488023 GAGTGGAACCTTCTGGTTGGAGG - Intergenic
1083385579 11:62306799-62306821 CAAAGGAATCTCCTGGTCTGTGG + Intergenic
1084593331 11:70103035-70103057 AGAAGGAAAGTTCTGGGTTGAGG - Intronic
1085157945 11:74313170-74313192 AAAAATAAAGTTCTGGTTTGTGG + Intergenic
1085380693 11:76115267-76115289 ACAGGGAAACTGCTGGTTTGTGG - Intronic
1085884396 11:80505554-80505576 CAAGGGAATCTTCTGGTCTGTGG - Intergenic
1087852933 11:103054072-103054094 AAATGGAACCTTCTGGAATGAGG - Intergenic
1089225616 11:116918407-116918429 AAATGGAAGCTTTTGCTTTGAGG - Intronic
1089755871 11:120686444-120686466 AAAAGGAACTTTCAGTTTTTAGG - Intronic
1090754781 11:129780212-129780234 AAAAGGAAACCTCTGGGTTACGG + Intergenic
1090797404 11:130146820-130146842 AAAAGGAACATGCTGTCTTGCGG + Intergenic
1091719379 12:2801450-2801472 AAAAGGCAACTTCTGGTTTCCGG - Intronic
1093040431 12:14373012-14373034 AAAGGGAATCTGCTGTTTTGAGG + Intronic
1093289184 12:17300800-17300822 ACAAGGAACCTTTTGAATTGGGG + Intergenic
1095367369 12:41423661-41423683 AACAGAAAACTTCTGTTTTGGGG - Intronic
1095941734 12:47731905-47731927 AAAAGGAACCACCTGTTTTCTGG + Intergenic
1096774049 12:53953616-53953638 AAAAGGATACATCTGGTTTGGGG + Intergenic
1097035267 12:56119710-56119732 AAGAGGATCTTTCTGGGTTGAGG + Intronic
1097752930 12:63378077-63378099 AGAAGGAATCTCCTGGTTTGTGG - Intergenic
1098072257 12:66688634-66688656 AAAAGGACCCTTCTGGGTTTTGG - Intronic
1099069362 12:78026030-78026052 AAAAGGAACAGTAAGGTTTGAGG - Intronic
1099253768 12:80290036-80290058 CAAGGGAATCTCCTGGTTTGTGG + Intronic
1099492173 12:83300820-83300842 AAAAGAGACATTCTGGTTTTTGG - Intergenic
1099964794 12:89434199-89434221 AGAAAGAACCTTCAGCTTTGGGG + Intronic
1100073803 12:90754553-90754575 AAAAGAAGCATTCTGGTTTTTGG + Intergenic
1100739992 12:97581392-97581414 CAAAGGAATCTCCTGGTCTGTGG - Intergenic
1100780374 12:98019279-98019301 AAAAGAAGCCTACTGATTTGAGG - Intergenic
1100902983 12:99264645-99264667 AAAACGAGCCTTCTCTTTTGAGG + Intronic
1102122581 12:110453725-110453747 CAAAGGTAATTTCTGGTTTGGGG - Exonic
1102945989 12:116988684-116988706 ACAGGGTACCTTCTGGTTTCTGG - Exonic
1103710708 12:122910387-122910409 AAAAACAACCTGCAGGTTTGAGG - Intergenic
1104115655 12:125746684-125746706 AGAGGGAATCTCCTGGTTTGCGG + Intergenic
1105587566 13:21759072-21759094 AAGAGGAACCTTCAGGAGTGAGG + Intergenic
1105635406 13:22211113-22211135 AAAAGGAAACTCCTGGGTGGTGG + Intergenic
1105639187 13:22244654-22244676 GACTGGAATCTTCTGGTTTGGGG - Intergenic
1107451701 13:40515862-40515884 AACAGGAAGCATCTGGATTGTGG - Intergenic
1108421991 13:50260309-50260331 AAAAAGAACATATTGGTTTGAGG - Intronic
1110826431 13:79976104-79976126 AGAAGGTACATTCTGGTTTTTGG - Intergenic
1110885586 13:80630151-80630173 AAATGGAGCCTTCAGGTTTGTGG + Intergenic
1110968663 13:81733213-81733235 CTAAGGAACCTCCTGGTCTGTGG + Intergenic
1111234647 13:85392925-85392947 AAAAAGCACATTATGGTTTGAGG + Intergenic
1111637711 13:90927552-90927574 AAAAGAAACCTTCTTGTGTTTGG - Intergenic
1112546562 13:100376943-100376965 CAAGGGAATCTTCTGGTCTGCGG + Intronic
1112718804 13:102218241-102218263 GGAAGGAAACTTCTGCTTTGTGG - Intronic
1114757764 14:25279615-25279637 AAAAGGAATTTTCTTGTTAGGGG + Intergenic
1115212999 14:30986917-30986939 AAAATGAACTTTTTGCTTTGTGG - Intronic
1115427224 14:33274027-33274049 AAACAGCATCTTCTGGTTTGGGG - Intronic
1116511773 14:45755679-45755701 AGAAGAAGCCTTCTGGTTTTTGG + Intergenic
1116677745 14:47927062-47927084 AAAGGGAACCTGCTGCCTTGAGG - Intergenic
1118160546 14:63285344-63285366 AAAAGAAACCTTTAGGTTTGGGG + Intronic
1118257487 14:64217727-64217749 AAAAAAAACCTTCAGATTTGTGG - Intronic
1118919952 14:70140825-70140847 AAAAGGAAACTCATAGTTTGTGG - Intronic
1119149575 14:72346126-72346148 AAAAAGAACCTTCATGCTTGAGG + Intronic
1119309896 14:73637103-73637125 AAAAGAAAACATCTGTTTTGTGG - Intergenic
1120180324 14:81336560-81336582 AAGTGGACCCTGCTGGTTTGTGG + Intronic
1120270905 14:82311428-82311450 AAATGCAACCATCTGATTTGTGG - Intergenic
1120450091 14:84655721-84655743 CAAGGGAATCTTCTGGTCTGTGG + Intergenic
1120606792 14:86588919-86588941 AAAAGGAACCATCTTATTTAGGG + Intergenic
1123098596 14:105778381-105778403 ACAAAAAACCTGCTGGTTTGAGG - Intergenic
1125824300 15:42662989-42663011 TAAGGTTACCTTCTGGTTTGGGG + Intronic
1127157990 15:56149697-56149719 AGAGGGAATCTCCTGGTTTGTGG - Intronic
1127269368 15:57386887-57386909 AAAAGGATCTTTCTGGTTCTTGG + Intronic
1127561027 15:60136124-60136146 ACAAGGAACCTTCTGGCCTTTGG - Intergenic
1127989052 15:64097361-64097383 AAAAGGAACCCCCTGGGTTTGGG - Intronic
1128380726 15:67110057-67110079 AAAGGAAACCTGCTGGTTTCAGG - Intronic
1128740046 15:70077568-70077590 AAGAGGACGCCTCTGGTTTGTGG + Intronic
1128906311 15:71471057-71471079 AAAAAGAACTTGCTGGTTTTGGG + Intronic
1129470152 15:75749072-75749094 AAAAGGAAACTTGTGGTTAGTGG + Intergenic
1129734878 15:77954070-77954092 AAAAGGAAACTTGTGGTTAGTGG - Intergenic
1129840713 15:78741921-78741943 AAAAAGAAACTTGTGGTTAGTGG + Intergenic
1130653666 15:85776993-85777015 AAATGGCACCTTCTGGTCTCAGG + Intronic
1130796207 15:87212407-87212429 AAAAGGAAGCTTGTCGTTTGGGG + Intergenic
1130974396 15:88762201-88762223 AACAGGAACCCTCTCCTTTGTGG - Intergenic
1133238502 16:4401243-4401265 GAAAGGAACTTGCTGGTGTGTGG + Intronic
1135571927 16:23556338-23556360 AGAAGGAACCTTCTGGGTAGAGG - Intronic
1136503581 16:30687837-30687859 AATAAGTACCTTCTGTTTTGTGG - Intergenic
1137046227 16:35664819-35664841 AGAAGAAACATTCTGGTTTTTGG - Intergenic
1139203386 16:65002358-65002380 GAATAGAACCTTCTGCTTTGGGG - Intronic
1140776039 16:78249766-78249788 AAAAGCCACGTTCTAGTTTGAGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142861927 17:2767477-2767499 AAAAGTCACCTCCTGGGTTGGGG - Intergenic
1143254243 17:5543962-5543984 AGAAGGACCCTTCTAGATTGGGG + Intronic
1143547120 17:7604039-7604061 AACAGGAACCTTGTGGCTGGTGG - Exonic
1144371890 17:14598831-14598853 AAAAGAAGCATTCTGGTTTTTGG - Intergenic
1144485203 17:15658816-15658838 CCAATGAACTTTCTGGTTTGGGG + Intronic
1145281582 17:21471405-21471427 AAAAGGAACCTTTTGTGATGTGG - Intergenic
1145421725 17:22839920-22839942 AAAAGGAACCTTCAACTCTGTGG - Intergenic
1145431048 17:22968392-22968414 AAAAGGAACCTTCAACTCTGTGG - Intergenic
1145440505 17:23099256-23099278 AAAAGGAACCTTCAACTCTGTGG - Intergenic
1145975057 17:28979061-28979083 AAAAGGAAGATTTGGGTTTGTGG + Intronic
1146073614 17:29707161-29707183 AAAAAGAACTTCCTGGTTTTTGG + Intronic
1148610568 17:48961899-48961921 AAAAGGTACCCTCTGCTTTTGGG - Intronic
1148722255 17:49762811-49762833 AAAAGGAACCTACTTGCATGAGG - Intronic
1149185248 17:53989934-53989956 ACAAAGAGCTTTCTGGTTTGTGG - Intergenic
1149303159 17:55324175-55324197 CAAAGGGTCCTTCTGCTTTGAGG - Exonic
1151485014 17:74393610-74393632 AAAAAGAACCCTATGTTTTGGGG - Intergenic
1153209630 18:2746700-2746722 AGAAGGAACTTTCTTGTTAGAGG + Intronic
1153313468 18:3700261-3700283 CAAGGGAATCTCCTGGTTTGCGG + Intronic
1156224352 18:35088638-35088660 ATGAGGAACATTCTGATTTGTGG + Intronic
1156453970 18:37282519-37282541 AAAAGGAAGCCTCTGGGTTTTGG - Intronic
1157457993 18:47854809-47854831 AAATGGACCATTGTGGTTTGCGG - Intronic
1157466343 18:47949549-47949571 AAAAGGAATGTTTTGGCTTGTGG - Intergenic
1158614270 18:58971549-58971571 AACAGAAACCTTATGGTTTCTGG + Intronic
1158669008 18:59457758-59457780 AAAGGAAACCATCTGATTTGTGG - Intronic
1160466705 18:79083544-79083566 GAAAGGAATCTCCTGGTCTGCGG + Intronic
1160620146 18:80164790-80164812 ATAAAAAACCTGCTGGTTTGAGG - Intronic
1161659224 19:5535904-5535926 ACCATGAACCTTCTGGTCTGAGG + Intergenic
1162045568 19:7997997-7998019 AAAAGAGAACTTCTGCTTTGCGG + Intronic
1162942782 19:14023586-14023608 AAAAAGAGGCTTCTGGTTTGAGG + Intergenic
1164112683 19:22184359-22184381 AGAGGGAATCTTCTGGTCTGTGG - Intronic
1165283792 19:34820303-34820325 AATAGGATCATTCTGGTTTCTGG + Intergenic
1168377228 19:55890606-55890628 AAAAGGAACATTCTAGATTCTGG - Intergenic
925970244 2:9101555-9101577 ATGGGGAACCTTCTGGGTTGAGG - Intergenic
926054461 2:9766307-9766329 ATAGGGAACCTTCTGGGCTGGGG - Intergenic
926410743 2:12599641-12599663 AAAAGGAAATCTCTGGTTGGAGG - Intergenic
926872332 2:17435597-17435619 AAAAGGGGCCTTCTGGTTCAAGG + Intergenic
928259668 2:29755397-29755419 AGAAGGAACCTTGCGGTTTTAGG + Intronic
928545012 2:32321544-32321566 AAAAGGAACTTTCTAGTAAGAGG - Intergenic
928596573 2:32864577-32864599 AAATGGAACCTTCTGGTTGGAGG - Intergenic
929230123 2:39550495-39550517 CAAAGGGACCTGCTGGTTTCTGG - Intergenic
933275300 2:80277628-80277650 AATAGGGACCTTCTGGTGAGAGG + Intronic
933413258 2:81951344-81951366 AAAGGGAATCTCCTGGTCTGTGG + Intergenic
933582628 2:84144597-84144619 AAAAGTAACCTTCTGGGGAGGGG - Intergenic
934155236 2:89193186-89193208 AAAAAGAATCTTCTTGTTTAAGG - Intergenic
934526282 2:95053720-95053742 AAAGGGGACCTTCTTGTTCGGGG + Exonic
934663261 2:96154307-96154329 GAAAGGAGCCTCCTGGCTTGGGG - Intergenic
935342320 2:102069006-102069028 AACAGGAACTCTCTGGTTTATGG + Intronic
940261027 2:151779922-151779944 AAATGTATCCTTCTGTTTTGGGG - Intergenic
940593884 2:155766171-155766193 AAAAGAAGCATTCTGGTTTTTGG + Intergenic
940722203 2:157294356-157294378 AAAAGGCTCCTTCTGTTATGTGG + Intronic
940805355 2:158180936-158180958 AAAGGGAGCATTCTGGTTTGTGG - Intronic
943094832 2:183416606-183416628 ACAAGGAATCTCCTGGTCTGTGG - Intergenic
944343014 2:198625429-198625451 CAAAGGAACCTTTTGCTTTCTGG + Intergenic
944838124 2:203599702-203599724 AAACCAAAACTTCTGGTTTGTGG + Intergenic
944992792 2:205256759-205256781 AAAAGGGAGCTTCTAGTTTCTGG + Intronic
945946713 2:216002006-216002028 AAAGGGAACCTTCTGACTTATGG - Intronic
946112537 2:217432761-217432783 AAAAGGATTCTTTTTGTTTGGGG + Intronic
947730261 2:232424489-232424511 AGAAGTGCCCTTCTGGTTTGAGG + Intergenic
948587814 2:239030600-239030622 CAAGGGAACTTTTTGGTTTGGGG - Intergenic
1169122421 20:3105203-3105225 AAAAAGAACAGTTTGGTTTGTGG - Intergenic
1169955567 20:11098890-11098912 AAAATGAATCTCCTGGTTGGGGG + Intergenic
1170915064 20:20614854-20614876 CAGAGGACCCTTCTGGTTTCAGG + Intronic
1172443119 20:34979483-34979505 GAACGGAACCTTCTGGTCTTTGG - Exonic
1173499531 20:43542656-43542678 AGAAAGAACTTTCTGGTATGAGG - Intronic
1177114906 21:17073493-17073515 AAATGGATATTTCTGGTTTGGGG + Intergenic
1177382095 21:20357862-20357884 AAAAGGGACCTTCTTGTGTATGG + Intergenic
1178252724 21:31020093-31020115 AAGAGGAATCTTCTAGTTTTGGG + Intergenic
1178301525 21:31457494-31457516 AAGAGCAACATTCTGGTTAGGGG + Intronic
1178676029 21:34632487-34632509 AAATGGAACCAACTGCTTTGAGG + Intergenic
1178743447 21:35224875-35224897 AAAAGGAAAGTTCTGGCCTGGGG + Intronic
1179565495 21:42245304-42245326 ACAAGGAACCTGTTGGGTTGTGG + Intronic
1181379510 22:22489816-22489838 AAGAGGAAGCATCTGGTGTGTGG - Intronic
1182047137 22:27284204-27284226 AAAATGAACCGTCTGGGTTCAGG - Intergenic
1182070945 22:27463193-27463215 AAAAGGGACCTTCCTGGTTGAGG + Intergenic
949619013 3:5789177-5789199 AAAAAGAACAAGCTGGTTTGTGG - Intergenic
949640919 3:6035484-6035506 AGAAGAGACCTTCTGGTTTTTGG + Intergenic
951031121 3:17882578-17882600 TAAAGGAACATTCTGGCTTTTGG + Intronic
951725771 3:25757065-25757087 AAGATGAAACTTCTGTTTTGAGG - Intronic
952775401 3:37041126-37041148 AACAGGAAGCTTCTGGACTGGGG - Intronic
953555112 3:43939511-43939533 AAAAGAAGCGTTCTTGTTTGTGG + Intergenic
954545354 3:51429930-51429952 GAAAGGAAGCTTCTGATTAGAGG - Intronic
956396514 3:68832250-68832272 AAAAGAGGCCTTCTGGTTTTTGG + Intronic
956906654 3:73772821-73772843 AAAAGGCACCTTCTGATTGAAGG + Intergenic
957776615 3:84762084-84762106 AAAAGGGGCCTTCTGGTTTTGGG - Intergenic
957993305 3:87654026-87654048 CAAAGGAATCTCCTGGTCTGTGG + Intergenic
958796372 3:98710486-98710508 AAAAGCAACATTCAGGGTTGGGG - Intergenic
958892961 3:99800778-99800800 AAAAAGTATCTTCTGGTTGGAGG + Intergenic
958975928 3:100667930-100667952 ATAGGGAATCTCCTGGTTTGTGG + Intronic
959412792 3:106046384-106046406 AAATGGCAACTTCTGGTTTCTGG + Intergenic
960058116 3:113290631-113290653 AAGAGTATCCTTTTGGTTTGGGG - Exonic
960763369 3:121097450-121097472 ATAGGGAACCTCCTGGTCTGCGG + Intronic
961234664 3:125355761-125355783 AAAAGGTACCCTCTTGTATGAGG + Intronic
962142098 3:132801487-132801509 AAAAGTAACCATCTTGTGTGGGG - Intergenic
962143663 3:132817630-132817652 AAAAGGATCGTTCTGGCTTCGGG + Intergenic
963006554 3:140731846-140731868 AAGAGGAATCTTCTGGTAGGAGG + Intergenic
963380870 3:144528654-144528676 AAAAGGATTGTTCTGGTTTTGGG - Intergenic
963758301 3:149259042-149259064 CAAAGGTGCCTTCTGGTGTGTGG - Intergenic
964180201 3:153874405-153874427 ATAAAGAACTTGCTGGTTTGAGG - Intergenic
967250712 3:187535400-187535422 AAAAGAAACCTTTTCTTTTGTGG + Intergenic
968219303 3:196923338-196923360 AAATGGAAGCTGCTGGTTTTTGG + Intronic
968376202 4:44035-44057 AAAATGAACCTTCTGAGATGTGG - Intergenic
969255575 4:5999548-5999570 AAAAGGAAGCTTCTGGCTGAAGG - Intergenic
969917164 4:10502091-10502113 CAAAGGCACCATCTGCTTTGGGG + Intronic
973863752 4:55091333-55091355 AAAAGGAAACTTTTTGTTTGGGG - Intronic
974491683 4:62572055-62572077 AGAAGGAATCTCCTGGTCTGCGG + Intergenic
975717185 4:77216441-77216463 AAAAGGTACCTTCTATTCTGGGG + Intronic
976092658 4:81473672-81473694 GGAAGGAATCTCCTGGTTTGTGG - Intronic
978351268 4:107823392-107823414 AAAAGGAACCCTTGTGTTTGTGG - Intergenic
978361891 4:107939374-107939396 AAAAGGAGAGTTCTGGTTTCAGG + Intronic
978877536 4:113659836-113659858 AAAAGGAACCTTCTGGTTTGAGG - Intronic
979171450 4:117604412-117604434 AAAAGGAGCATTCTTTTTTGGGG + Intergenic
979705310 4:123713580-123713602 CAAGGGAATCTTCTGGTCTGTGG - Intergenic
982253885 4:153433814-153433836 AAAAGAAACCATCATGTTTGGGG + Intergenic
982513625 4:156317091-156317113 AATAAAAACCTGCTGGTTTGAGG - Intergenic
982725657 4:158903124-158903146 AAAGGGAATCTCCTGGTCTGTGG + Intronic
983840805 4:172455212-172455234 CCAAGGAACCTCCTGGTCTGCGG - Intronic
984903080 4:184601752-184601774 AAAAGCGACGTTCTGGTTTTTGG - Intergenic
985332314 4:188851679-188851701 AATAAAAACCTGCTGGTTTGCGG + Intergenic
986936848 5:12899791-12899813 AAAAGAAATCTTCTATTTTGTGG + Intergenic
987596163 5:20002100-20002122 GAAAGGAAAATTCTGGCTTGAGG - Intronic
989410013 5:41109140-41109162 AAAAAGATACTTATGGTTTGAGG - Intergenic
990905387 5:60797526-60797548 AAAAGCATCCTTCAGGCTTGAGG + Intronic
990920284 5:60957200-60957222 AAAAGTAAGCTTCAGGTATGTGG - Intronic
991191026 5:63874005-63874027 TAAATGTAACTTCTGGTTTGTGG + Intergenic
991236646 5:64406958-64406980 AGAGGGAATCTCCTGGTTTGTGG - Intergenic
992722671 5:79576215-79576237 GAACTGAACCTTCTGCTTTGAGG + Intergenic
992976952 5:82130483-82130505 CAAAGGAATCTCCTGGTCTGTGG + Intronic
993608966 5:90031511-90031533 CAAAGGAATCTCCTGGTCTGTGG - Intergenic
993897275 5:93551311-93551333 AAAAGGAAGCTTAAGGTTTCTGG - Intergenic
994093539 5:95828609-95828631 ACAATGAAGGTTCTGGTTTGGGG + Intergenic
994864829 5:105254516-105254538 AAAAAACACCTTCTGATTTGAGG - Intergenic
996406261 5:123107458-123107480 AAAAGCAACTCTGTGGTTTGTGG - Intronic
998814917 5:146003292-146003314 CAAAGGAACCTTCTGGGTGCTGG + Intronic
999702414 5:154240028-154240050 AAAAGGGAGCTTCTGGATTCAGG - Intronic
1000666908 5:164009520-164009542 CAGAGGAATCTTCTGGTTTATGG - Intergenic
1001119821 5:168970726-168970748 AAGAGGATCTTTCTGGTTTCAGG - Intronic
1002665116 5:180817370-180817392 AAAAAGGAACTCCTGGTTTGGGG + Intergenic
1003434302 6:6071787-6071809 AGAAGAAACATTCTGGTTTTTGG + Intergenic
1003461125 6:6329526-6329548 TAAAGAACCCTTCAGGTTTGAGG - Intergenic
1003467946 6:6399304-6399326 AGCAGGAACCTTCTGGTTCCTGG - Intergenic
1003959410 6:11195302-11195324 AAAAGGAACCTATTGCTTTGAGG + Intronic
1005964957 6:30720778-30720800 AAAAGGGCTCTTCGGGTTTGGGG + Intronic
1006411713 6:33877773-33877795 AAGAGCAACCCTCTGGTGTGGGG - Intergenic
1006735789 6:36271503-36271525 ACAAGGCACCTTCTAGTGTGAGG + Intronic
1007311888 6:40953329-40953351 AAGAGAAACCTTCTGCTTGGAGG + Intergenic
1008227325 6:48936567-48936589 AAAGGGAAACTGCTGCTTTGAGG - Intergenic
1008394512 6:50991076-50991098 AAAGTTAACCCTCTGGTTTGAGG + Intergenic
1009054432 6:58317503-58317525 AAAAGAGGCCTTCTGGTTTTTGG - Intergenic
1011493228 6:87913782-87913804 ACATGGAACCATCTGGGTTGGGG - Intergenic
1011571354 6:88740054-88740076 AAAAGGAACATTGTGATTTTAGG - Intronic
1014719891 6:124903512-124903534 AAAAGGGAACTTCCGCTTTGGGG + Intergenic
1014954735 6:127600560-127600582 AAAAGGAATCCTCTGGGTTATGG + Intergenic
1015226334 6:130861363-130861385 AAAAGGAATCTTCAGGCTGGGGG - Intronic
1015796628 6:137018990-137019012 AAATTGAACATTTTGGTTTGTGG + Intronic
1016918881 6:149271802-149271824 AAAAGGCAGCTTCTGCTTTCTGG - Intronic
1018039913 6:159912538-159912560 GAAAAGAAGCTTCTTGTTTGTGG - Exonic
1019956041 7:4415169-4415191 AAAAGAAAACAGCTGGTTTGAGG + Intergenic
1020635920 7:10695882-10695904 GGAAGGAATCTCCTGGTTTGTGG - Intergenic
1020753466 7:12170996-12171018 CAAAGGAATCTCCTGGTCTGTGG + Intergenic
1020763947 7:12298331-12298353 AAAAAAAACCTTCTTGTCTGAGG + Intergenic
1022289473 7:28987146-28987168 GAAGGGAAGCTGCTGGTTTGCGG + Intergenic
1022343330 7:29488553-29488575 AAAAGGAATCTTCGGGTCAGAGG - Intronic
1022664822 7:32400815-32400837 GAAGGGAACCTTCTGTATTGTGG - Intergenic
1022712845 7:32867925-32867947 AAAAGAAACCATTTTGTTTGGGG + Intergenic
1024060636 7:45696015-45696037 AAATGGAGCCTTCTGCTTTAAGG + Intronic
1024152917 7:46591017-46591039 AGAGGGAATCTCCTGGTTTGTGG - Intergenic
1025472995 7:60881280-60881302 AAAAGGAAGGTTCTACTTTGGGG + Intergenic
1025514009 7:61608586-61608608 AAAAGGAAGGTTCTACTTTGGGG - Intergenic
1025538354 7:62037426-62037448 AAAAGGAAGGTTCTACTTTGGGG - Intergenic
1027609670 7:80345029-80345051 AAAAGGAACTTTGTTGTATGTGG + Intergenic
1027843301 7:83341617-83341639 CAAGGGAATCTCCTGGTTTGCGG - Intergenic
1028195836 7:87906404-87906426 AAAAAGAACATTCTGGTTGAAGG + Intronic
1031834987 7:126671722-126671744 AAAAGGAAACCTCTGGGTTATGG - Intronic
1032215424 7:129953316-129953338 GCAAGGAACCTGCTGGTGTGGGG - Intergenic
1032364361 7:131285333-131285355 AAGATGAACCTCCTGGTGTGGGG + Intronic
1033684526 7:143626177-143626199 AAAAGGAACCCTCTGATTGATGG + Intronic
1033687702 7:143705396-143705418 AAAAGGAACCCTCTGATTGATGG + Intronic
1033700085 7:143831446-143831468 AAAAGGAACCCTCTGATTGATGG - Intergenic
1034046975 7:147939849-147939871 AAAAGGAAACTTTTTGTATGGGG - Intronic
1034145291 7:148865638-148865660 AAAAAGAAGGTACTGGTTTGTGG + Intronic
1037682603 8:21110047-21110069 AAAAGAAACCTTCTTCTTTGAGG - Intergenic
1037805783 8:22057303-22057325 TAATGGAACCTTCTGATCTGGGG + Intronic
1040658095 8:49535677-49535699 AAAAGGACCCCTGGGGTTTGTGG - Intergenic
1042929273 8:73997213-73997235 TTAAGGATACTTCTGGTTTGGGG - Intronic
1043267577 8:78285860-78285882 CAAAGGAAAGTTCTGGTTTTGGG + Intergenic
1043776058 8:84270504-84270526 ATGAGGAAACTTCTGGCTTGAGG + Intronic
1044013059 8:87018547-87018569 AAAAGGAACCTACTCCTTTAGGG - Intronic
1044820056 8:96150004-96150026 CAAAGGAAGTTTCTGGTTTTTGG - Intronic
1045183627 8:99813813-99813835 AAAAGAAACCTGCTAGATTGAGG - Intronic
1046382909 8:113473847-113473869 AAAAGGATCCTGGTGGTATGTGG - Intergenic
1046605500 8:116367203-116367225 AAAGTGGACTTTCTGGTTTGAGG + Intergenic
1048175966 8:132153246-132153268 AAAAGGAAACCTCTGGGTTAGGG - Intronic
1048842331 8:138576930-138576952 AGAAGGAACCTGGTGGTTTTTGG + Intergenic
1049246641 8:141566222-141566244 TGAAGGAATCTTCTGGCTTGGGG + Intergenic
1050015667 9:1231144-1231166 AGGAGGAAGCTTCTGGTTTATGG + Intergenic
1050158682 9:2694801-2694823 CCAGGGAACCTTCTGATTTGTGG - Intergenic
1050834138 9:10054561-10054583 AAAAAGACCTTTCTGGGTTGTGG - Intronic
1051212600 9:14760463-14760485 AAAAGGACTCTACTGGTATGAGG + Intronic
1051353858 9:16223376-16223398 GAAGGGAATCTCCTGGTTTGCGG - Intronic
1051375151 9:16394894-16394916 ATAAGAAACTTGCTGGTTTGAGG + Intergenic
1052931523 9:34059453-34059475 AAAAGGATCATGCTAGTTTGAGG + Intergenic
1053036607 9:34831995-34832017 AAAATGAACCATCTGAATTGTGG + Intergenic
1053345644 9:37376381-37376403 CAAGGGAACCTTCTGGGGTGCGG + Intergenic
1053356095 9:37446866-37446888 GGAAGAAACATTCTGGTTTGAGG + Intronic
1055386882 9:75772015-75772037 CAAGGGAATCTTCTGGTCTGTGG + Intergenic
1056244268 9:84678763-84678785 AAAAAGAGTGTTCTGGTTTGGGG - Intronic
1061461820 9:130745570-130745592 AAATGGAACCTCCTGGAGTGAGG + Intronic
1203573023 Un_KI270744v1:150115-150137 AAAATGAACCTTCTGAGATGTGG + Intergenic
1186225390 X:7393961-7393983 AAAAAGAAAGTTCAGGTTTGAGG - Intergenic
1186281379 X:7996719-7996741 AAAATGAACTTTTTTGTTTGTGG + Intergenic
1186773362 X:12839499-12839521 CAAAGGAATCTCCTGGTCTGTGG + Intergenic
1187029654 X:15472576-15472598 AAAAGGAATCATATGGTATGTGG - Intronic
1187145824 X:16636433-16636455 AAATGGAACCATATGATTTGTGG - Intronic
1188165378 X:26856480-26856502 AAAATCAACCTTCTGTTTTAAGG - Intergenic
1188260154 X:28014281-28014303 AAAATGATGCTTATGGTTTGAGG + Intergenic
1188993397 X:36852072-36852094 AAAATGATCCTTCTGGCTTAGGG - Intergenic
1189560149 X:42183926-42183948 AAACAGAATCTTTTGGTTTGGGG + Intergenic
1191135266 X:57057757-57057779 AAAAGAGACATTCTGGTTTTTGG + Intergenic
1191705231 X:64086687-64086709 AAAAGAATCATTCTGGTTTTTGG - Intergenic
1192080767 X:68045839-68045861 GCAAGGGACCTTGTGGTTTGTGG - Exonic
1192330624 X:70172733-70172755 GAAAGGACACTTCCGGTTTGGGG + Intergenic
1193118545 X:77798849-77798871 AGCAGGAAACATCTGGTTTGGGG - Intergenic
1193151592 X:78130198-78130220 AAGATGAAACTTCTGTTTTGAGG + Exonic
1193774155 X:85622442-85622464 AGAAGGAATCTCCTGGTCTGTGG - Intergenic
1194963952 X:100266830-100266852 CAAAGGAATCTCCTGGTCTGCGG - Intergenic
1195414173 X:104602327-104602349 AGAGGGAATCTCCTGGTTTGCGG - Intronic
1196698810 X:118643773-118643795 AAAAAGTAGCTTCTGATTTGAGG - Intronic
1196909493 X:120471187-120471209 CAAAAGAACCATCTGGTTTTGGG + Intergenic
1197038575 X:121907580-121907602 AAAAGGAAACCTCTGGGTTATGG - Intergenic
1198607502 X:138357721-138357743 TAAGGGAACCTTCTGGGTAGTGG - Intergenic
1199783979 X:151087639-151087661 GAAAGGACCCTTCTGGTTGCTGG - Intergenic
1200838509 Y:7756158-7756180 AAAAGGATCCTTCTGGCTATAGG + Intergenic
1201543298 Y:15132563-15132585 AGAAGAAACATTCTGGTTTTGGG - Intergenic
1201563639 Y:15344004-15344026 CAAGGGAATCTTCTGGTCTGTGG + Intergenic
1201797598 Y:17915586-17915608 AAAAGGGATCTTCTGATTTCTGG - Intergenic
1201803955 Y:17990373-17990395 AAAAGGGATCTTCTGATTTCTGG + Intergenic
1201855719 Y:18539042-18539064 AAAAGGGATCTTCTGATTTCTGG + Intergenic
1201877602 Y:18781343-18781365 AAAAGGGATCTTCTGATTTCTGG - Intronic
1202171652 Y:22052690-22052712 AAAAGGGATCTTCTGATTTCTGG - Intergenic
1202219710 Y:22533682-22533704 AAAAGGGATCTTCTGATTTCTGG + Intergenic
1202323468 Y:23662401-23662423 AAAAGGGATCTTCTGATTTCTGG - Intergenic
1202358953 Y:24084503-24084525 AAAAGGGATCTTCTGATTTCTGG - Intergenic
1202511825 Y:25585611-25585633 AAAAGGGATCTTCTGATTTCTGG + Intergenic
1202547303 Y:26007653-26007675 AAAAGGGATCTTCTGATTTCTGG + Intergenic