ID: 978878738

View in Genome Browser
Species Human (GRCh38)
Location 4:113674490-113674512
Sequence CTTGATGCCCACAGTTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978878735_978878738 11 Left 978878735 4:113674456-113674478 CCTAAAGTTAAGAGCTTATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 978878738 4:113674490-113674512 CTTGATGCCCACAGTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978878738 Original CRISPR CTTGATGCCCACAGTTTACA AGG Intronic
No off target data available for this crispr