ID: 978883696

View in Genome Browser
Species Human (GRCh38)
Location 4:113740822-113740844
Sequence AAGAGGAGACTACTATAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978883696_978883698 -1 Left 978883696 4:113740822-113740844 CCTAACTATAGTAGTCTCCTCTT 0: 1
1: 0
2: 2
3: 13
4: 183
Right 978883698 4:113740844-113740866 TAATTCAGTTTTGCTTTCTGAGG 0: 1
1: 0
2: 8
3: 57
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978883696 Original CRISPR AAGAGGAGACTACTATAGTT AGG (reversed) Intronic
901172329 1:7268188-7268210 AGGAGGTGACAACTAGAGTTTGG + Intronic
901749049 1:11394708-11394730 AAGGAGAGACTACTATAGATGGG - Intergenic
902453869 1:16517515-16517537 CAGAGGAAACTACTAAGGTTTGG + Intergenic
902498606 1:16892777-16892799 CAGAGGAAACTACTAAGGTTTGG - Intronic
904366232 1:30012548-30012570 GAGAGGAGGCTGCTTTAGTTGGG - Intergenic
904794667 1:33050484-33050506 AATAGGAAACTACTGTGGTTAGG + Intronic
905355837 1:37383789-37383811 AAGTGGAGTCTACTCTACTTGGG - Intergenic
906822979 1:48948702-48948724 AAGGAGTGACTACTGTAGTTAGG - Intronic
908658693 1:66415378-66415400 AAGAGGAAACAACTTTACTTCGG - Intergenic
908793371 1:67805071-67805093 AACAGGAGAGTACTGGAGTTGGG - Intronic
908894721 1:68885296-68885318 ATGAGGAGACCACTATTGTTGGG + Intergenic
911673276 1:100631231-100631253 GAGAGGAGAACACTATAGTGTGG + Intergenic
911771898 1:101754185-101754207 TAAAGGAGACTAATATAGCTAGG - Intergenic
913512223 1:119572322-119572344 TAGAAGAGACTACAATTGTTCGG - Intergenic
914006001 1:143732855-143732877 CAGAGGAAACTACTAAGGTTTGG + Intergenic
914254660 1:145951800-145951822 AGGAGGAGACCACCATAATTGGG + Intronic
918632240 1:186731487-186731509 AAGAGGACACTACTAGGGCTGGG + Intergenic
920000510 1:202795353-202795375 AAGAGGAGACTACTAGAAGCTGG + Intronic
921630965 1:217433280-217433302 AAGAGAACACTACTATACTCTGG - Intronic
922066804 1:222152118-222152140 AAGAGAAGACTACTCTGATTAGG + Intergenic
924446163 1:244133507-244133529 AATAGGAGACTAATCTACTTGGG + Intergenic
1063267132 10:4465347-4465369 AGGAGGAAACTACTGTAGTCTGG - Intergenic
1063898400 10:10706121-10706143 AAGATGAGACTAAAATAGTCAGG - Intergenic
1065473560 10:26109617-26109639 TAGAGGGGACTACTATAATCTGG + Intronic
1072902608 10:99422031-99422053 AGGAGTAGACTGATATAGTTTGG + Intronic
1073452993 10:103620381-103620403 AAGAGGAGGCTTCTGTGGTTTGG - Intronic
1074698856 10:116075624-116075646 AAAAGGAGACTATCATACTTAGG - Intronic
1078616830 11:12873638-12873660 AAAAGGAGACTACTTCAGTCAGG - Intronic
1079834660 11:25318700-25318722 AAGCCTAGACTACTATAATTTGG - Intergenic
1080119520 11:28661186-28661208 AAGAGAAGATTACTATGGTATGG - Intergenic
1080451014 11:32378979-32379001 AAGAAGGGACTAATATACTTGGG + Intergenic
1081200844 11:40213514-40213536 AAGGGGAGACCACAATAATTTGG - Intronic
1082908909 11:58347417-58347439 ATGAGGTTACTACTATAGTTAGG - Intergenic
1084589982 11:70084944-70084966 ATGAGGGGGTTACTATAGTTAGG - Intronic
1086026849 11:82304027-82304049 AAGAAGAGACTACTTAATTTGGG + Intergenic
1087002111 11:93431654-93431676 AAGAGGAGACAACTATTGTAAGG + Intronic
1089979538 11:122760892-122760914 AAGAGATGACCAGTATAGTTAGG - Intronic
1090106751 11:123861773-123861795 AAGAAGTCACTACTATAGTGAGG + Intergenic
1093991500 12:25593505-25593527 AAGGGGAGAGTACTATATTAAGG + Intronic
1095138479 12:38635846-38635868 AAAAACAGACTACTATAGTTGGG - Intergenic
1095398782 12:41791071-41791093 CAAAGGAGACTACTATAATGGGG - Intergenic
1095430126 12:42125111-42125133 GAGAGGAGACTATAATTGTTTGG + Intronic
1096173133 12:49490422-49490444 AAGAAGAGACTAATGTAGCTGGG - Intronic
1099241101 12:80140035-80140057 AAGAGAAGAATACAGTAGTTGGG - Intergenic
1099611485 12:84877646-84877668 AAGATGAGACTAAAATAGTAAGG - Intronic
1099845170 12:88019480-88019502 AAAAGCAGACTAATATAGTGTGG + Intronic
1099898856 12:88682305-88682327 AAGAGCAGAATAATATGGTTTGG + Intergenic
1101220784 12:102637592-102637614 CACTGGAGACTACTATAGGTAGG - Intergenic
1101479119 12:105079809-105079831 CAGAGGAAACTACTATTGTTTGG + Intronic
1102306988 12:111812437-111812459 AAGAGGAGTTTGCTGTAGTTTGG - Intergenic
1106130677 13:26936810-26936832 AAGGGCAGAATGCTATAGTTTGG + Intergenic
1106975639 13:35209627-35209649 AAGAGAAGACTACTATAGTCAGG - Intronic
1108208335 13:48113563-48113585 AAAAGGGGACTACTGTATTTGGG + Intergenic
1108318174 13:49258752-49258774 CAGTCTAGACTACTATAGTTAGG - Intronic
1108893688 13:55295427-55295449 AGGGGCAGAATACTATAGTTTGG + Intergenic
1110161199 13:72380380-72380402 AAGAGGAGAATACGAATGTTGGG + Intergenic
1111330347 13:86757659-86757681 AGGAGGAGAATAGTCTAGTTGGG + Intergenic
1111418032 13:87975575-87975597 AACAGAAAACTAATATAGTTTGG - Intergenic
1111674368 13:91368724-91368746 ACGAGGAGCCTACTAAATTTGGG + Intergenic
1111733745 13:92110654-92110676 AAAATGAGACTACTATTGCTTGG - Intronic
1112730367 13:102353787-102353809 AATAGGAGACTAATACAGTTAGG - Intronic
1113046032 13:106156311-106156333 AAGAGGAGCCTTCTGGAGTTGGG + Intergenic
1113645451 13:111991822-111991844 AAGAACAGACTAATATAGGTAGG + Intergenic
1115747541 14:36452638-36452660 GATAGGAAACTAATATAGTTTGG + Intergenic
1116672112 14:47856221-47856243 AAGATGTGACTACAATAGTCTGG - Intergenic
1118365082 14:65087817-65087839 AGGAGCAGAATAATATAGTTTGG + Intronic
1119561082 14:75590386-75590408 AACAGCAGAATACTATGGTTTGG - Intronic
1119992540 14:79215574-79215596 AAGAGGAGACCACTTTTGCTTGG - Intronic
1120591469 14:86378931-86378953 AACTGGAGACTACTAGAGGTGGG + Intergenic
1120693680 14:87620904-87620926 AGGAGCAGAATAATATAGTTTGG - Intergenic
1120840081 14:89077918-89077940 AAGAGGAGACAATTGTAGGTGGG + Intergenic
1121281499 14:92702395-92702417 AAGGGGAGACTACTGTAGCCAGG + Intergenic
1122221491 14:100241416-100241438 AAGATGAGACAACTACAGCTGGG + Intronic
1125337569 15:38642260-38642282 AAGAGGAGACTAATCTCCTTAGG + Intergenic
1125860277 15:42992689-42992711 AAGAGGAGAGAACTATAGAAGGG - Intronic
1126049536 15:44673654-44673676 AAGAGAAGACTATTATAGAGAGG - Intronic
1127042166 15:54989019-54989041 ACAAGGAGCCTACTAAAGTTAGG - Intergenic
1128036728 15:64533566-64533588 GAGAGGAGACAACAATATTTTGG - Intronic
1128307386 15:66608522-66608544 AACTGGAGACTACTAGAGTGGGG + Intronic
1129847038 15:78772800-78772822 AGGAGGAGACTACCATTCTTTGG + Intronic
1137997076 16:53229225-53229247 AAGAGAAAAATACTATATTTAGG - Intronic
1138499961 16:57435002-57435024 ATGAGGAGTCTGATATAGTTTGG + Intronic
1138549085 16:57737382-57737404 AGGAGGAGACTCCTAGACTTGGG + Intronic
1145767797 17:27471361-27471383 AAGAGGTGACTTCTTTAGATGGG + Intronic
1149107164 17:52983279-52983301 TAGAGGACAATACTATGGTTAGG + Intergenic
1155980162 18:32171433-32171455 AAGAACAGACTAATATAGATGGG - Intronic
1156241121 18:35255197-35255219 AACAGGAGACTACTAGAGATGGG - Intronic
1158318096 18:56234664-56234686 AAGAAGAGTATAATATAGTTGGG + Intergenic
1158869563 18:61671758-61671780 AAGATGCTACTGCTATAGTTTGG - Intergenic
1159598351 18:70405058-70405080 AAGGTGAGACTACTGTATTTGGG + Intergenic
1163069235 19:14824382-14824404 CACTGGAGACTACTATAGTGGGG - Intronic
1167640220 19:50677517-50677539 AAGAGGAGACTAGCAGAATTGGG - Intronic
1167772508 19:51530073-51530095 AGGAGGAGACTAGTAAAGTGGGG + Intronic
926643579 2:15264163-15264185 AAGAGGAGAGCACTGTAGTAGGG + Intronic
927267105 2:21163155-21163177 TAGAGGAGGCTAATATGGTTTGG - Intergenic
928825937 2:35420981-35421003 ATGAGGGTACTGCTATAGTTTGG - Intergenic
930854746 2:56002361-56002383 AGGATGAGACTACTATACCTTGG + Intergenic
930983138 2:57551940-57551962 AAAAGGTGACTGATATAGTTTGG - Intergenic
932018629 2:68059473-68059495 AAGAAGAGACCACTTTTGTTTGG - Intronic
934870942 2:97864813-97864835 AAGTGGAGAATAATAAAGTTCGG - Intronic
936721828 2:115260648-115260670 AATCACAGACTACTATAGTTAGG - Intronic
938420756 2:131144458-131144480 AAGAGCAGACTTCTAGATTTGGG + Intronic
938633846 2:133200881-133200903 AAGCGGGGACAACTATAGCTTGG - Intronic
940505740 2:154550616-154550638 AAGAGGAGTCTACTTTAAGTAGG - Intergenic
940765774 2:157788200-157788222 AAGTGGGGACTACTGTAGTCTGG - Intronic
942257263 2:174115799-174115821 AAGAGGAAACTGTTTTAGTTAGG - Intronic
942496755 2:176548060-176548082 AAAATGAGAATTCTATAGTTTGG - Intergenic
944222281 2:197314381-197314403 TTGAGGAGATAACTATAGTTTGG - Intergenic
945360669 2:208892616-208892638 CATAGGAAACTAATATAGTTAGG - Intergenic
945665480 2:212736055-212736077 AAGGGGGGATTACTATGGTTTGG + Intergenic
1169470789 20:5883901-5883923 AGAGAGAGACTACTATAGTTTGG - Intergenic
1171563146 20:26147847-26147869 AAGAGAAGACTACAATACTATGG - Intergenic
1173482927 20:43417096-43417118 AAGAGGCTATTACTCTAGTTGGG - Intergenic
1173910131 20:46662074-46662096 AAGAGGAGACTGCCATGGATGGG - Intronic
1174109009 20:48184855-48184877 AAGAGGAGACTACATTCATTGGG + Intergenic
1175543561 20:59763373-59763395 AAGAAGAGACTAATACAGTAGGG + Intronic
1176995396 21:15549662-15549684 AATAGGAAACTAATATAGGTTGG - Intergenic
1178987284 21:37317420-37317442 AAGAGGATACTACTACAGACAGG + Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
956999093 3:74863469-74863491 AAGAGAGGACTCCTATTGTTGGG + Intergenic
957554041 3:81743087-81743109 AAGAAGAGAAGAATATAGTTAGG - Intronic
958563329 3:95776760-95776782 GAGAAGAGACTAATATAGTAAGG + Intergenic
960127830 3:114019789-114019811 GAGAGGTGACTACTGTAGTTAGG - Intronic
965389758 3:168090995-168091017 AAGTGGAGACTACAAAAGGTGGG + Intronic
969229975 4:5823446-5823468 AAAAGGACACTAATATGGTTTGG + Intronic
973317009 4:48771858-48771880 AAGAGGAGACTACTATGGGCAGG + Intronic
975708226 4:77132221-77132243 AAGGGGAGAATACGATAGCTTGG - Intergenic
976739487 4:88343980-88344002 AAGAGGAGGCCACTATAGGCAGG + Intergenic
976988378 4:91330768-91330790 AAGGGGAGACTACTGTAATTTGG - Intronic
977460567 4:97320188-97320210 AAGAGGAAACTAAGATAGATGGG - Intronic
977499254 4:97818219-97818241 AAGAACAGACTACTATAAATAGG - Intronic
978128050 4:105158893-105158915 AAGAGAAGCCTACTATTTTTTGG - Intronic
978740615 4:112133674-112133696 AAGAGAAGACTGCTATAGGCAGG - Intergenic
978883696 4:113740822-113740844 AAGAGGAGACTACTATAGTTAGG - Intronic
982798704 4:159675200-159675222 AAGAGTAGACAACTCTAGTGAGG - Intergenic
982999117 4:162389158-162389180 AAGAGAAGACTAAAATACTTTGG - Intergenic
983051148 4:163049020-163049042 AAAGGGGGACTGCTATAGTTAGG + Intergenic
983355048 4:166646192-166646214 AAGAGGAGATTACTACAGAAGGG - Intergenic
983583775 4:169334847-169334869 AAGAGGAGACTCCTGCAGGTGGG + Intergenic
986814108 5:11389713-11389735 AAGAAGAGCCTACTACAGTCTGG + Intronic
987845261 5:23275815-23275837 AAGAGGATAGTACTATAATGGGG + Intergenic
988438077 5:31199888-31199910 AAGAGGATACAAGTATAGTAGGG - Intronic
990629443 5:57651709-57651731 CAGAGGAGACCTCTAAAGTTTGG + Intergenic
992956560 5:81915396-81915418 GATTGGATACTACTATAGTTTGG - Intergenic
994232291 5:97321529-97321551 AACAGAATCCTACTATAGTTGGG - Intergenic
995493350 5:112715401-112715423 CAGGGGATACTACTTTAGTTTGG + Intronic
996387459 5:122924614-122924636 AAGGGGGGACTACTATATTCAGG + Intronic
996566739 5:124887623-124887645 AAGAGGAAAGTACTCTGGTTAGG + Intergenic
996727244 5:126683423-126683445 TAGAGGAGGTTAATATAGTTTGG + Intergenic
1000118631 5:158176107-158176129 AGGAGAAGACTACTACAGTAAGG + Intergenic
1000597375 5:163231414-163231436 AATAGGAGAATACTATACTAAGG + Intergenic
1000825349 5:166037811-166037833 AAGGGTAGAATAATATAGTTTGG - Intergenic
1001123971 5:169002737-169002759 GAGAAGAGACTGCTAAAGTTAGG - Intronic
1008153098 6:47979771-47979793 GAGAGGAGAATACTATCCTTAGG + Intronic
1009738228 6:67706941-67706963 AAGTGGAGACTGATATGGTTTGG - Intergenic
1009776264 6:68209537-68209559 AAGAATGGACTAATATAGTTTGG + Intergenic
1013311983 6:108903237-108903259 AAAAGGAGAGTATTTTAGTTAGG - Intronic
1015362279 6:132354348-132354370 AAGGGGAGAGTACTATATTAAGG - Intronic
1015662601 6:135591919-135591941 AAGTGTAGACTACTAGAGGTGGG - Intergenic
1017728806 6:157296268-157296290 AAGAAGAGAGAACTACAGTTTGG - Intronic
1020755254 7:12192878-12192900 AAGAACAGAGTGCTATAGTTTGG + Intergenic
1021328050 7:19298728-19298750 ATGAGGAGATTACAATATTTTGG + Intergenic
1021486249 7:21171569-21171591 AAGAGAAGTCTACTGTATTTTGG - Intergenic
1027528597 7:79301725-79301747 AAGGGTAGAATAATATAGTTTGG + Intronic
1029361473 7:100091387-100091409 AAAAAGAGACTACATTAGTTTGG - Intronic
1030895515 7:115054767-115054789 GAGCAGAGTCTACTATAGTTAGG - Intergenic
1031723117 7:125201981-125202003 AAGAGGAAGCTATTATTGTTTGG + Intergenic
1032630900 7:133650619-133650641 AAGGAGTAACTACTATAGTTAGG - Intronic
1033987873 7:147248617-147248639 AAGTTGAGACTACTCTAGTTTGG + Intronic
1039020688 8:33202557-33202579 ACTAGGAGACTGATATAGTTTGG - Intergenic
1042594591 8:70433355-70433377 AAGAGGAGTCCACTTTAGGTAGG + Intergenic
1043197959 8:77324161-77324183 AAAAAGAGACTACTATAGTTAGG - Intergenic
1043500441 8:80849089-80849111 AAGAGGTGAGTAGTAAAGTTAGG + Intronic
1044703706 8:94987903-94987925 TAGGGGAGGCTACTATAGTAAGG - Intronic
1045982340 8:108205477-108205499 AAGTGGGAACTACTGTAGTTGGG - Intronic
1045995539 8:108358150-108358172 AAGAGTGGAATAATATAGTTTGG - Intronic
1046044903 8:108953126-108953148 AAAGGGAGACTACTATAAGTGGG + Intergenic
1046735640 8:117773712-117773734 AAGAGGAGAAAACTTTATTTAGG + Intergenic
1051077017 9:13251295-13251317 AAGAGGAGAACATTATAGTCAGG - Intronic
1051531964 9:18114101-18114123 AAGAGGAGAGCACTTTACTTGGG + Intergenic
1052303463 9:26978946-26978968 AAAAGGAGTTTACCATAGTTTGG - Intronic
1055631772 9:78231979-78232001 GAAAGGAGACTACTATAGGCTGG + Intergenic
1058197673 9:101998863-101998885 TAGAGGAGATTATTATAGTTTGG + Intergenic
1058776737 9:108291673-108291695 GAGAGGGGACTACTGTATTTTGG - Intergenic
1059022916 9:110596329-110596351 AAGAGCAGAATAATATGGTTTGG - Intergenic
1059607809 9:115854419-115854441 AATTGGAGACTACTAAAGTGAGG + Intergenic
1188295308 X:28440483-28440505 AAAAGGAGGGTGCTATAGTTTGG + Intergenic
1190112569 X:47603644-47603666 CAGTGGAGACTACCACAGTTGGG - Intronic
1192704771 X:73518174-73518196 AGGAGCAGAATGCTATAGTTTGG - Intergenic
1192757406 X:74060881-74060903 TATATGAGACTGCTATAGTTCGG - Intergenic
1193930406 X:87545246-87545268 CAGAGGAGACTGATATTGTTTGG + Intronic
1193939129 X:87658371-87658393 CAGTAGAGACTCCTATAGTTAGG + Intronic
1196191207 X:112796708-112796730 AAAAGGAAACTACCATAGATTGG - Intronic
1198597697 X:138254946-138254968 TGGAGGAGACTACTGTATTTTGG + Intergenic
1198865821 X:141121690-141121712 ATGAGGAGATTAGTATAGATAGG - Intergenic
1200596485 Y:5147377-5147399 TACTGGAGACTACTAGAGTTGGG + Intronic
1201015809 Y:9600205-9600227 ATGAGGAGATTAGTATAGATAGG - Intergenic
1201623678 Y:15988787-15988809 GGGAGGAGACTACTAGTGTTGGG - Intergenic
1202048760 Y:20759665-20759687 AAAAAGAGACTTCCATAGTTGGG + Intronic