ID: 978884846

View in Genome Browser
Species Human (GRCh38)
Location 4:113756120-113756142
Sequence ATGTATGACTAACAGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978884843_978884846 -10 Left 978884843 4:113756107-113756129 CCCCAAATATGGTATGTATGACT 0: 1
1: 0
2: 0
3: 12
4: 161
Right 978884846 4:113756120-113756142 ATGTATGACTAACAGCTGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978884846 Original CRISPR ATGTATGACTAACAGCTGAG AGG Intronic
907172458 1:52481589-52481611 ATGGATGACTTTCAGCTGAAGGG - Exonic
907731378 1:57069791-57069813 ATGTATGGGTTACAGTTGAGGGG + Intronic
909233833 1:73126340-73126362 ATTTATGACTACTACCTGAGAGG + Intergenic
912002451 1:104852056-104852078 ATGAATTACTAAAGGCTGAGGGG + Intergenic
913076005 1:115340804-115340826 AGGAATGAAAAACAGCTGAGAGG + Intergenic
915256012 1:154629374-154629396 ATCTATGACTAACAGATGTTGGG + Intergenic
923950799 1:238951049-238951071 AAGTGTGACTGACAGCTCAGTGG + Intergenic
1063485662 10:6418312-6418334 ATGAATGACAAAGAGCTGATAGG + Intergenic
1063651083 10:7937670-7937692 AAGGATGAGTAACAGGTGAGAGG + Intronic
1068642879 10:59430572-59430594 ATTTATGACTAAGATCTGAATGG - Intergenic
1068956768 10:62825433-62825455 ATTTCTGAGTAACAGGTGAGAGG - Intronic
1070706900 10:78646355-78646377 ATGAATGACCAACAGCAGTGTGG + Intergenic
1070781099 10:79137914-79137936 ATTTATAACTCACAGCTGTGCGG + Intronic
1071422242 10:85512193-85512215 GTGTAAGAATAGCAGCTGAGAGG + Intergenic
1074506855 10:114078760-114078782 AAGTAGGAAGAACAGCTGAGAGG - Intergenic
1087814435 11:102642955-102642977 ATCAATGACTAACATCTGAAAGG - Intergenic
1091517141 12:1196185-1196207 AAGTAGGACTGACACCTGAGTGG - Intronic
1091853778 12:3722557-3722579 AGGTAGCACTTACAGCTGAGGGG + Intronic
1093145147 12:15556427-15556449 ATGCATGAATAACAGCTCATTGG - Intronic
1094528367 12:31248871-31248893 ATGTAGGAATAACAGGTGAATGG - Intergenic
1100024107 12:90106733-90106755 ATTAATGACTAACAGGTAAGTGG + Intergenic
1100209355 12:92385592-92385614 GTGTATGAGTAACGCCTGAGTGG - Intergenic
1105374349 13:19830065-19830087 ATCTGTGACTCACACCTGAGGGG - Intronic
1105603868 13:21910806-21910828 AGGTGTGACTGACTGCTGAGCGG + Intergenic
1105945224 13:25183864-25183886 AGGTTTGACTGAAAGCTGAGTGG - Intergenic
1106430841 13:29678916-29678938 AGGTATGACTACAAACTGAGAGG + Intergenic
1110160790 13:72375918-72375940 GTGTTTGAGTAACAGCAGAGAGG + Intergenic
1114170134 14:20264088-20264110 ATGTATTACTAATAGTTTAGAGG + Intronic
1115255776 14:31400288-31400310 ATGTTTCACTTACAGCTTAGTGG + Exonic
1117917197 14:60690073-60690095 ATGTATTTTTAACAGCTGTGTGG + Intergenic
1119207589 14:72806192-72806214 AAGGATGGCTAAGAGCTGAGGGG - Intronic
1126668805 15:51097243-51097265 ATGTATGAATAACAGCAAAAAGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129600152 15:76994105-76994127 ATGTCTGCCTTACAGCTGACGGG - Intronic
1135701030 16:24632575-24632597 ATGAATGAATGAAAGCTGAGGGG - Intergenic
1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG + Intergenic
1146390128 17:32414403-32414425 ATGCATGACTTACAGATGGGAGG - Intergenic
1147651722 17:42066357-42066379 ATGTGTTAATAACAGCTGATTGG - Intergenic
1149315774 17:55437218-55437240 ATGTACCAATAATAGCTGAGTGG - Intergenic
1152601890 17:81266961-81266983 ATGTATTATTAACAGCCAAGAGG + Intronic
1155957662 18:31967363-31967385 AGGAATGACTGAAAGCTGAGGGG + Intergenic
1158275353 18:55760869-55760891 ATGTATGGCTGACAGATAAGGGG - Intergenic
1167347260 19:48954511-48954533 ATAGATGACTAAAAACTGAGTGG - Intergenic
936665160 2:114586363-114586385 ACATATGATTAACAGCAGAGTGG + Intronic
936714390 2:115168284-115168306 ATGTATGACTAACATTAGAATGG + Intronic
943396807 2:187348458-187348480 AAGTATGAGAAAAAGCTGAGAGG + Intronic
946378709 2:219330376-219330398 TTGTATGACAAACAGATGGGAGG - Intronic
1169664966 20:8023193-8023215 AAATATGACTAACTTCTGAGGGG - Intergenic
1176365297 21:6029193-6029215 ATCTAAGACTCACAGGTGAGAGG + Intergenic
1178296921 21:31417902-31417924 ATGAATGAGCAACAGCTGAGTGG + Intronic
1178354029 21:31895622-31895644 ATTTATCACAAACAGCTGGGTGG + Intronic
1178379497 21:32096114-32096136 AGGGATGACAATCAGCTGAGGGG - Intergenic
1179758221 21:43509352-43509374 ATCTAAGACTCACAGGTGAGAGG - Intergenic
1184993159 22:48184080-48184102 ATGTTTGAATCACAGGTGAGTGG + Intergenic
953976224 3:47383578-47383600 ATGATTGAATTACAGCTGAGCGG + Intronic
955871154 3:63440162-63440184 AAGTAGAACTAACAACTGAGTGG + Intronic
957727157 3:84082462-84082484 ATGTATTCCAAACAGATGAGGGG - Intergenic
958192607 3:90202243-90202265 ATGTTTCAATAACAGCTGAAGGG - Intergenic
958416026 3:93874172-93874194 ATGTTTCAATAACAGCTGAAGGG - Exonic
959342231 3:105146140-105146162 ATGTATGTCAAACAGTTCAGTGG - Intergenic
960571243 3:119187396-119187418 ATTTATCAATGACAGCTGAGAGG - Intronic
962285894 3:134085291-134085313 ATGGATGACAAACGGTTGAGTGG - Intronic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
967952963 3:194854845-194854867 ATGCAGGACAAACAGCTCAGGGG - Intergenic
969449817 4:7266580-7266602 ATGGATGACTCACAGCTAACAGG - Intronic
971805727 4:31355902-31355924 AGGTCTCACTAACAGCTGAACGG - Intergenic
972694466 4:41431822-41431844 ATGGATGATTAAGGGCTGAGGGG + Intronic
978884846 4:113756120-113756142 ATGTATGACTAACAGCTGAGAGG + Intronic
981215708 4:142164544-142164566 ATGTTAGACTAACAGCTAGGAGG + Intronic
983440200 4:167772656-167772678 AAATATGACTTACAGCTGTGGGG - Intergenic
983984016 4:174036308-174036330 ATGACTCACTAACAGCTCAGTGG + Intergenic
984189057 4:176582923-176582945 ATGGATGACTCCCAGCTGTGTGG + Intergenic
985072042 4:186175910-186175932 ATGTCTGAAGAACAGCAGAGAGG + Intergenic
996866856 5:128133976-128133998 TTGAATGACTAACACCTCAGTGG + Intronic
997185539 5:131878094-131878116 ATGTATCCCTCACAGATGAGGGG + Intronic
997777227 5:136621393-136621415 ATGTTTGACTAACTGCATAGTGG - Intergenic
1001816253 5:174671809-174671831 ATGCATGCCTATCATCTGAGAGG + Intergenic
1008893806 6:56528110-56528132 ATGAATAACTAAGAGCAGAGAGG - Intronic
1010831425 6:80535136-80535158 ATATATGACTAACAGGTGGTAGG - Intergenic
1012060866 6:94478687-94478709 ATGTAAGCCTGACAGCTGAATGG - Intergenic
1012157602 6:95839631-95839653 ATCTATGACTAACAGATGTTGGG + Intergenic
1016376717 6:143428902-143428924 ATGGATGAATAACAGTTGATTGG - Intronic
1018072237 6:160174966-160174988 AGGTCTCACTAACAGCTGAACGG - Intronic
1018671273 6:166179485-166179507 ATGTATGACAATCAGTTGAGGGG - Intergenic
1020952203 7:14694266-14694288 AATTGTGACTAACAGCTAAGTGG + Intronic
1023975238 7:45024265-45024287 ATGTTTGACTGACTGCTGAATGG - Intronic
1024321062 7:48070081-48070103 ATGAATGACAAACAGGTCAGTGG + Intergenic
1026172940 7:67970584-67970606 ATGTCTGACTTACGGCTTAGTGG - Intergenic
1030099402 7:105932165-105932187 AGGTATAACTATCAGCTGATAGG - Intronic
1032872847 7:136004692-136004714 ATGTCTGACTTACAATTGAGGGG - Intergenic
1038464233 8:27745365-27745387 ATGGGTGAATAACAGATGAGAGG - Intronic
1043084838 8:75816398-75816420 GTGTATAACAAACAGCTGAAAGG - Intergenic
1048675433 8:136773344-136773366 ATGTATCACTAGCAGATAAGGGG + Intergenic
1051247341 9:15125187-15125209 TTCTATGAATTACAGCTGAGGGG - Intergenic
1052049433 9:23828118-23828140 ATGTATGAATAACAGAAGATTGG + Intergenic
1057447945 9:95131581-95131603 GTGTATGGCTAAAAGCTGGGAGG - Intronic
1059350271 9:113659411-113659433 AGGTGGGACTTACAGCTGAGGGG + Intergenic
1060228106 9:121808455-121808477 ATGAATGAATGACAGGTGAGAGG - Intergenic
1061936477 9:133860510-133860532 GTGTATGACTACAGGCTGAGGGG - Intronic
1189552182 X:42104486-42104508 ATGAATGACTCACAGCTGGAGGG + Intergenic
1193383654 X:80845706-80845728 AAGTATTAGTAATAGCTGAGAGG - Intergenic
1193454158 X:81708749-81708771 AGCTGTGACTGACAGCTGAGGGG - Intergenic
1197980137 X:132209497-132209519 ATGTTTTTCTAACAGCTGACAGG + Intronic
1201343416 Y:12957580-12957602 ATGGAGGGCTAACAGCTAAGGGG + Intergenic