ID: 978885371

View in Genome Browser
Species Human (GRCh38)
Location 4:113761516-113761538
Sequence GTGCAGCGGGGCCGAGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978885366_978885371 -4 Left 978885366 4:113761497-113761519 CCGAGGGGGCGGAGGTGGAGTGC 0: 1
1: 0
2: 4
3: 69
4: 555
Right 978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG 0: 1
1: 0
2: 4
3: 38
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978885371 Original CRISPR GTGCAGCGGGGCCGAGGCCG CGG Intronic
900043670 1:491143-491165 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
900065108 1:726146-726168 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
900162813 1:1232368-1232390 GCGCTGCGCGGCCGAGCCCGGGG + Exonic
900179711 1:1305819-1305841 GTGCAGTGGGCCGGAGGCCAGGG - Intronic
900344205 1:2203391-2203413 GTGCAGCTGTGCCCAGGCCTGGG - Intronic
901019656 1:6249365-6249387 GTGCAGCGTGGCGTAGCCCGAGG + Exonic
901489509 1:9589354-9589376 GTGCACCGGGGCCCAGCACGGGG - Intronic
901700626 1:11043282-11043304 GTGCAGCTGGGCTGAGGGGGAGG + Intronic
901719464 1:11184883-11184905 GTGGAGGGGGGCCGTGCCCGGGG - Intronic
902881044 1:19371955-19371977 GTGCTGGGGAGCCCAGGCCGGGG + Intronic
905198980 1:36303832-36303854 GTGAGCCGGGGCCGGGGCCGAGG + Exonic
906126635 1:43431063-43431085 GTGCTGAGGGTCCGAGGCCGTGG - Exonic
906140595 1:43531539-43531561 GTGCGGCGGGGGCGGGGGCGCGG - Intronic
906551230 1:46668118-46668140 CAGCAGCGGGGTCGGGGCCGAGG - Exonic
906556529 1:46718755-46718777 GTGAAGGGGGCCCGAGGCCGAGG + Exonic
906960387 1:50416316-50416338 GTGCGGTGGGGCAGAGGACGGGG + Intergenic
907244823 1:53102169-53102191 GTGCAGAGGGGCCGGGGCCTCGG - Intronic
908501219 1:64745225-64745247 GCGCGGCGGGGCTGGGGCCGGGG + Exonic
908951673 1:69568674-69568696 GTGCTGCGGGGGCCCGGCCGCGG + Intronic
909547977 1:76868361-76868383 GTGCGGCGGGGCTGGGGCCCAGG + Intronic
912435109 1:109656267-109656289 GCGCAGCGGGGCCGAGGGGGCGG + Exonic
912776424 1:112508905-112508927 ACGGGGCGGGGCCGAGGCCGGGG - Exonic
912800245 1:112715484-112715506 ATGGGGCGGGGCAGAGGCCGGGG - Intergenic
913565637 1:120069719-120069741 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
913632492 1:120723834-120723856 AGGCGGCGGGGCCGAGGCCGCGG + Intergenic
914286233 1:146229093-146229115 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
914547261 1:148679835-148679857 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
914619242 1:149390508-149390530 AGGCGGCGGGGCCGAGGCCGCGG + Intergenic
914702964 1:150150414-150150436 GCCTGGCGGGGCCGAGGCCGAGG - Intronic
915167866 1:153958550-153958572 GAGGAGCCGGGCCGAGGCCGCGG - Exonic
915266347 1:154720844-154720866 GAGTGGCGGGGCCGAGGCCCTGG + Intronic
915599978 1:156916017-156916039 GTGCAGAGGGGCTGAGGCTGAGG + Exonic
915740208 1:158113494-158113516 GAGCAGCGCGGAGGAGGCCGCGG - Intergenic
916694397 1:167221320-167221342 GGGCGGCGGGGCCGGGGCAGAGG + Intronic
917291616 1:173477260-173477282 GGGCGGCGGGGGCGGGGCCGCGG - Exonic
919747781 1:201019542-201019564 GTGAGGCGGGGCCCAGGCCTGGG - Intronic
919878752 1:201888900-201888922 CTGCGGCGGGGCCCAGCCCGCGG - Exonic
920352140 1:205344190-205344212 GTGCAGCGGGGCGGGGGCTCCGG - Exonic
921565325 1:216710769-216710791 GTGCAGCGGGGTGGGGGCGGTGG - Intronic
922792070 1:228316271-228316293 CTGCAGAGGGGCTGAGGCCCTGG + Intronic
922800457 1:228362534-228362556 GTGCAGAGGGGGTGAGGCCCAGG - Intronic
922925156 1:229342214-229342236 GGGCGGCGGGGGCGAGGGCGGGG + Exonic
924955783 1:248925323-248925345 GGGCAGTGGGGCCCAGGCAGGGG + Intergenic
1062855706 10:778538-778560 GTGCTGCGGGGCTGAGGTTGAGG - Intergenic
1062890544 10:1056686-1056708 GGGCTGCGGGGCGGAAGCCGGGG + Intronic
1064264043 10:13809974-13809996 GTACAGGGGAGCCGAGGCCCTGG - Intronic
1065102652 10:22345865-22345887 GGGCAGCGGGGCGGAGGCGTCGG - Intronic
1067450001 10:46376284-46376306 GTGCAGAGGGTCAGAGGGCGGGG + Intronic
1067634301 10:47991246-47991268 GTGCAGAGGGTCAGAGGGCGGGG - Intergenic
1068396266 10:56465925-56465947 GTGCAGCCAGGCAGAGGCCCTGG - Intergenic
1068620510 10:59176709-59176731 GTGATGCGGCGCCGAGGCTGAGG - Exonic
1069438296 10:68406546-68406568 GCGCAGCCGGGGCGTGGCCGCGG - Intronic
1069949155 10:72007573-72007595 GTACACCAGGGCCGAGCCCGCGG - Exonic
1070151986 10:73811079-73811101 GAGCAGCGGCGCGGAGGCTGCGG + Intronic
1071201422 10:83223352-83223374 GTGCAGCGGGTCCGAGTGAGTGG - Intergenic
1071309437 10:84328765-84328787 CTGCAGCTGGGCCGCGGCCGAGG + Exonic
1071598111 10:86942623-86942645 GTGCTGCGAGGCCGAGGCCGGGG - Exonic
1072059816 10:91798732-91798754 GAGCGCCGCGGCCGAGGCCGTGG + Exonic
1072926289 10:99620217-99620239 CTGCAGCGGGGCGTGGGCCGGGG - Exonic
1073138039 10:101230318-101230340 CGGCAGCGGGGCCCCGGCCGGGG - Intergenic
1073336433 10:102714041-102714063 TTGCAGCGGGTCCGAGGCTTGGG - Intronic
1073509964 10:104036697-104036719 GTGCAGGGGAGCCCAGGCTGTGG - Intronic
1074165817 10:110872518-110872540 CTGGGCCGGGGCCGAGGCCGGGG - Intronic
1074372138 10:112908691-112908713 GGGAAGCGGGGCCCAGGCGGAGG + Intergenic
1075031904 10:119029643-119029665 GGGCCGCGGCGGCGAGGCCGGGG + Intergenic
1076674841 10:132142485-132142507 GGGGAGAGGGGCCGGGGCCGGGG - Intronic
1076683419 10:132186587-132186609 GGGCAGCGGGGGCGCGGGCGGGG + Intergenic
1076696129 10:132248283-132248305 GGGCAGCTGGGCCGTGGCAGGGG + Intronic
1076839829 10:133040557-133040579 GTGCAGGGGGGCTGAGGGTGAGG + Intergenic
1076916407 10:133424776-133424798 GTGGAGCGGGGCCGGGTGCGGGG - Intergenic
1077076991 11:706416-706438 GGGCGGCCGGGCCGAGGGCGCGG + Intronic
1077432185 11:2521287-2521309 GGACAGCGGGGCCGAGGGAGAGG - Intronic
1077544420 11:3163074-3163096 TTGTAGAGGGGCCGAGGCCCAGG - Intronic
1078256629 11:9664161-9664183 GGGCAGCAGGGCCGCGGCCATGG + Exonic
1078422061 11:11220732-11220754 GGGCAGCGGGACCAGGGCCGGGG - Intergenic
1078594420 11:12674487-12674509 GGGCGGCGGGGCCGCGGCGGCGG - Intergenic
1078935167 11:15943201-15943223 GTGCAGGGGAGCAGAGGCTGAGG + Intergenic
1080886852 11:36376006-36376028 GGGCAGCTGGGCCGGGGGCGGGG + Exonic
1081673879 11:44957155-44957177 ATACAGCGGGGCCGCTGCCGAGG + Intergenic
1082028696 11:47589853-47589875 GGGCGGCGGGGGCGAGGTCGGGG + Exonic
1082774762 11:57236554-57236576 GGTCAGCGGGGCCGTGGCCACGG - Exonic
1082810521 11:57476641-57476663 GTACGGGGTGGCCGAGGCCGGGG + Exonic
1083258288 11:61509731-61509753 GGGCGCCGGGGCGGAGGCCGGGG - Exonic
1083846074 11:65334259-65334281 GAGGAGCGGGGCCGAGGCCCGGG + Intronic
1084379982 11:68805617-68805639 GGGCACCGGGGCCAAGGTCGGGG + Intronic
1084892009 11:72241300-72241322 GTGCAGGGGGGCCGGGGGGGGGG + Intronic
1085054401 11:73395357-73395379 GTGCAGCGGGCCCTAGGCAGGGG + Intronic
1085717991 11:78889904-78889926 GTGCTGCGGGGCAGGGGTCGGGG + Exonic
1088764460 11:112962391-112962413 GTGCGGAGGGGCGGAGGGCGAGG + Intronic
1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG + Intronic
1089811874 11:121138683-121138705 GAGCAGCAGGGCTGAGGCTGAGG + Intronic
1089868167 11:121650090-121650112 GTGCTGGGGGGCCGGGGCTGCGG + Intergenic
1090056764 11:123430699-123430721 GTGCCGCGGGGCCGAGGGTGGGG + Exonic
1090450272 11:126800098-126800120 ATGCAGCGGGGCCCAGCCCCTGG - Intronic
1090749936 11:129737642-129737664 GTGCAGAGGGGCAGTGGCCATGG - Intergenic
1091219429 11:133921210-133921232 GTACAGCGTGGCCAAGGCAGAGG - Exonic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1091381868 12:67091-67113 CGGCAGCGGGGCCGATGACGGGG - Exonic
1091393375 12:139112-139134 GGGGAGAGGGGCCGAGGCCGAGG + Exonic
1092247649 12:6872554-6872576 CTGCAGCGGGGCGAGGGCCGTGG + Exonic
1096143799 12:49264586-49264608 GGGGACCGGGGGCGAGGCCGGGG + Intronic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1096614523 12:52824215-52824237 GAGGAGCCGGGCTGAGGCCGAGG - Exonic
1096651362 12:53063493-53063515 CTGAAGGGGGGCCGGGGCCGGGG - Intronic
1102254031 12:111405954-111405976 GGGCAGCCGGGCGGAGGCGGTGG - Exonic
1102585495 12:113920085-113920107 GTGCAGAGGGTCTGAGGCAGGGG - Intronic
1103565488 12:121813127-121813149 GTGCCGCGGGGCCACGGCTGAGG + Intronic
1103781567 12:123402274-123402296 CCGGAGCGGGGCCGGGGCCGTGG + Intronic
1104506444 12:129336786-129336808 ATGCAGCCGGGCCTGGGCCGAGG + Intronic
1104860237 12:131919695-131919717 GTGCAGAGGTGCAGAGGCCCCGG + Intronic
1104881883 12:132077525-132077547 CTGGAGCGGGGCCGACGCCGTGG - Exonic
1104944115 12:132408076-132408098 GTGGGGAGGGGCCGGGGCCGGGG - Intergenic
1105031418 12:132887176-132887198 GAGGTGCGGGGCTGAGGCCGGGG - Exonic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1105890776 13:24680901-24680923 GAGAAGCGGTGCCCAGGCCGGGG - Intronic
1106776644 13:33016251-33016273 GGGCAGGGGCGCCGAGGGCGAGG - Intergenic
1107437374 13:40391976-40391998 GTGCAGCTGCTCCGGGGCCGTGG - Intergenic
1107697093 13:43011171-43011193 GTGCTGTGGGGCCAAGGCCAAGG - Intergenic
1107708975 13:43134019-43134041 GTGCAGTGTGGCTGAGGCAGAGG + Intergenic
1108682344 13:52790795-52790817 GTGCAGCGGGGAGGAAGCTGAGG - Intergenic
1110705335 13:78597331-78597353 GGGCGGCGGGGCAGAGGCAGAGG + Intergenic
1110860538 13:80341143-80341165 AGGCAGCGAGGCCGAGGCGGGGG + Intergenic
1111123485 13:83882340-83882362 GTGGAGGGGGGCGGAGGGCGGGG + Exonic
1112507830 13:99985503-99985525 GTGCACCGGGGCGGAGGCTCGGG + Exonic
1113517584 13:110915137-110915159 GTGCAGCCGGGCAGGGGTCGGGG + Intergenic
1113517616 13:110915223-110915245 GAGCAGCCGGGCGGAGGGCGGGG + Intergenic
1113967695 13:114163764-114163786 ATTCAGCTGGGCCCAGGCCGAGG + Intergenic
1117680647 14:58199954-58199976 GTGCGGGGGCGCGGAGGCCGCGG - Intronic
1118885554 14:69863029-69863051 GAGCAGAGGGGCTGAGGCCAAGG + Intronic
1119615889 14:76099035-76099057 GTGCTGCGGGCCCCAGGCTGGGG - Intergenic
1120789158 14:88563260-88563282 GTCCAGCGGAGGCCAGGCCGCGG - Intronic
1122292575 14:100687551-100687573 GTGCAGGGAGGGCGAGGCGGGGG + Intergenic
1122603047 14:102930653-102930675 GTTCGCCGGGGCCGAGGCCGAGG + Exonic
1122804656 14:104250334-104250356 GGGGAATGGGGCCGAGGCCGGGG + Intergenic
1122920739 14:104878958-104878980 GTGCAGCGGGGCTGAGGCGGGGG + Intronic
1122924461 14:104893218-104893240 GTGCAGCAGGGCCTCAGCCGAGG - Intronic
1123804514 15:23857362-23857384 ATGCAGTGGGGCTGAAGCCGAGG + Intergenic
1124258207 15:28163147-28163169 GTGCAGCCGGGCCGGGGACAGGG - Exonic
1124439474 15:29675816-29675838 GTGCAGGGGCGCCGAGGGCTGGG - Intergenic
1124575492 15:30904062-30904084 CTGCTGCGGAGCCGAGGCCCCGG - Intronic
1124696798 15:31870453-31870475 GGGCGGCGGGGCCGGGCCCGCGG - Intronic
1124848104 15:33311105-33311127 CCGCGGCGGGGGCGAGGCCGTGG + Intronic
1125514226 15:40308901-40308923 CTGCAGCGGGGCTGGGGCGGAGG + Intergenic
1125516527 15:40324026-40324048 GAGCACCGGGGCAAAGGCCGGGG + Intergenic
1126489974 15:49225945-49225967 GAGCAGCTGGGCAGAGGCCTTGG + Intronic
1128001856 15:64200375-64200397 GTGCAGTGGTGCCCAGGCTGGGG + Intronic
1128153539 15:65377850-65377872 GTCCCGCGGGGCCGGCGCCGGGG + Exonic
1128269130 15:66293523-66293545 GAGGGGCGGGTCCGAGGCCGCGG + Intronic
1129393633 15:75232939-75232961 GTGTAGTGGGGACGAGGACGGGG + Intergenic
1129413382 15:75361774-75361796 GTGCTGAGGGGCTGAGGCTGGGG - Intronic
1129710675 15:77819042-77819064 GTGAGGCGGGGCCGCGGCCTGGG + Intronic
1130370983 15:83284878-83284900 GCGCAGCTGAGGCGAGGCCGTGG + Intergenic
1131051722 15:89352611-89352633 GAGCAGCTGAGCAGAGGCCGTGG - Intergenic
1131144049 15:90000471-90000493 GCGCCCCGGGGCCGAGGCCCAGG + Intergenic
1131475384 15:92734215-92734237 GCGCGGCGGGGCGGAGGCGGAGG - Intronic
1132502829 16:292159-292181 GTGCAGCAGGTCCGAGGCCCTGG - Intronic
1132594111 16:740524-740546 GGGCGGCGGGGCCCGGGCCGGGG - Intronic
1132605808 16:793286-793308 GAGCATCTGGGCCGAGGCTGTGG - Intronic
1132665980 16:1081552-1081574 GCTCAGCGGGGCTGGGGCCGGGG - Intergenic
1132727802 16:1346275-1346297 GTGCAGCTGAGCAGAGGGCGGGG - Exonic
1132974475 16:2704607-2704629 GGGCACCTGGGCAGAGGCCGGGG + Intronic
1133219554 16:4314013-4314035 GTCCGGAAGGGCCGAGGCCGAGG - Intergenic
1133311011 16:4847037-4847059 GTCCCGGGGGACCGAGGCCGAGG - Intronic
1133985510 16:10665270-10665292 GTGCAGCCTGGCCAAGGCAGAGG - Intronic
1134901808 16:17944749-17944771 CTCCAGCGAGGCCGAGGCTGAGG + Intergenic
1135577387 16:23596228-23596250 GGGCAGCGGCGCAAAGGCCGCGG + Exonic
1135712591 16:24730035-24730057 GCGCCGCGGGGGCCAGGCCGGGG + Intronic
1136028076 16:27482682-27482704 GTCCAGAGGGGCCAAGGCGGTGG - Intronic
1136365194 16:29806439-29806461 GCCCCGCGGGGCCGGGGCCGGGG - Intronic
1136683697 16:31982168-31982190 GAACAGCAGGGCCGAGGGCGAGG + Intergenic
1136784326 16:32925724-32925746 GAACAGCAGGGCCGAGGGCGAGG + Intergenic
1136885459 16:33928082-33928104 GAACAGCAGGGCCGAGGGCGAGG - Intergenic
1137426407 16:48384912-48384934 GCGCGGCCGGGCCGAGGGCGGGG - Intronic
1138478374 16:57285011-57285033 CTGCGCCGGGGCCTAGGCCGAGG - Intergenic
1138593001 16:58012821-58012843 ATGCAGGGGAGCCCAGGCCGTGG - Intronic
1139896171 16:70289460-70289482 GTGCAGCGGGCCCTTGGCGGGGG - Exonic
1140187566 16:72788445-72788467 GGGCAGCGGGGCTGAGATCGTGG + Exonic
1141701153 16:85642732-85642754 TTGCAGCGGGGCCGGGCCCTGGG + Intronic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1142312782 16:89323586-89323608 GGGCAGGGGGGCTGAGCCCGGGG + Intronic
1142376748 16:89710651-89710673 GAGCGGCAGGGCCGGGGCCGTGG - Exonic
1142395215 16:89828237-89828259 GGGGCGCGGGGCCGAGGCCGGGG - Intronic
1203086983 16_KI270728v1_random:1189730-1189752 GAACAGCAGGGCCGAGGGCGAGG + Intergenic
1142638221 17:1270692-1270714 CTGCAGCCGGGGCGAGGCGGAGG + Exonic
1142812230 17:2400733-2400755 GCGCGCCGGGGCCGAGGCTGCGG + Exonic
1143487191 17:7261551-7261573 GAGCAGCGGTGCTTAGGCCGGGG - Intronic
1143502591 17:7347868-7347890 GTGCAGGGGGGCAGTGGCCTGGG - Intronic
1143644757 17:8223121-8223143 GCGGCGCGGGGGCGAGGCCGAGG - Intergenic
1143730624 17:8880789-8880811 GTGCAGCAGGGCAGGGGCCAGGG + Intronic
1144850498 17:18241716-18241738 GTGAGGCGGGGCAGAGGCCGAGG + Intronic
1144930925 17:18858229-18858251 CTGCGGCGGGGCCGGGGCTGGGG + Exonic
1145007270 17:19344758-19344780 CTGCAGAGGGGCCCAGGCCAGGG + Intronic
1146787408 17:35731911-35731933 GTGGAGCGGGGCCGGGTCAGGGG + Intronic
1146901492 17:36592157-36592179 GTGAGGCCGGGCCGAGGGCGGGG + Intronic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147144614 17:38477875-38477897 GAACAGCAGGGCCGAGGGCGAGG + Exonic
1147158925 17:38559556-38559578 GTGGGGCGGGGCCCAGGACGGGG + Intronic
1149610455 17:57955126-57955148 GGGCCGCTGGGCCGGGGCCGCGG + Intronic
1150137615 17:62704214-62704236 GAGCCGCGGGGCCGAGGCGCAGG + Intronic
1150294697 17:64001554-64001576 GGGCAGCGGGGCCCAGGCCTGGG + Intronic
1151475024 17:74340408-74340430 GTGCACAGGGGCAGAGGCAGGGG + Intronic
1151977040 17:77488960-77488982 GTGCAGAGGGGCTGAGTCAGGGG + Intronic
1152111854 17:78360988-78361010 GTGCTGCGCGGCCCAGGCCTTGG + Intergenic
1152628616 17:81399681-81399703 GAGCAGCGCGGCCGGGGCCCGGG - Exonic
1152697501 17:81804322-81804344 GCGCGGCGGGGCCGGGGGCGCGG + Intronic
1152931847 17:83113973-83113995 GCACAGAGGGGCCCAGGCCGGGG + Intergenic
1154021030 18:10664033-10664055 CTGCAGGAGGGCCGAGGCCCGGG + Intergenic
1157271258 18:46278063-46278085 CTGCAGCTGGTCAGAGGCCGAGG - Intergenic
1157718811 18:49907798-49907820 GAGCAGCCTGGCCCAGGCCGGGG - Intronic
1158588690 18:58762233-58762255 ATGCAGTGGGGCAGAGGCAGTGG + Intergenic
1160458946 18:79022831-79022853 GGGCAGCGGGTCCTGGGCCGTGG + Intergenic
1160668388 19:344391-344413 GCGCCGCGGGGCCCGGGCCGGGG + Intronic
1160751422 19:736214-736236 TGGCAGCTGGACCGAGGCCGAGG + Intronic
1160766931 19:812884-812906 GGGCGGCGGGGCCAAGGCGGAGG - Exonic
1160795684 19:944444-944466 AAGCAACGGGGCTGAGGCCGTGG - Intronic
1161027204 19:2042212-2042234 GTGGGGCGGGGCCGCGGCGGGGG - Intronic
1161114556 19:2489280-2489302 GGGCGGCCGGGCCGAGGGCGGGG + Intergenic
1161333752 19:3700213-3700235 GGGCTGCGGGGCCGGGGCGGGGG - Intronic
1161354284 19:3810449-3810471 GGGCAGAGGGGCCCAGGCAGAGG - Intronic
1161628714 19:5340687-5340709 GTGAAGCGGGGCAGAGCCGGGGG - Exonic
1162675318 19:12294416-12294438 GAGAAGCGGGGCTGAGGGCGCGG + Intronic
1163832077 19:19551865-19551887 GGCAAGCGGGGCCGAGGCTGGGG - Intergenic
1165145707 19:33728724-33728746 GTGCAGGGGAGCCCAGGCCAGGG + Intronic
1165157178 19:33795926-33795948 GGGCAGCGGGGCAGAGACCCTGG + Intronic
1165349744 19:35269201-35269223 AGGCCGCGGGGCCGGGGCCGGGG - Intronic
1165420137 19:35718283-35718305 GTCCAGCGGGGCCGGGGACGGGG + Exonic
1165452197 19:35890174-35890196 ATGCAGCGTGGCTGTGGCCGGGG - Intronic
1165472054 19:36009531-36009553 GTGGGCCGGGGCGGAGGCCGAGG + Exonic
1166569606 19:43785178-43785200 GTGCAGCTGGGACAAGGCCAAGG - Intergenic
1167052001 19:47085126-47085148 ATGGGTCGGGGCCGAGGCCGAGG - Exonic
1167613503 19:50518357-50518379 GTTGAGCGTGGCCGAGGCGGTGG + Exonic
1167648919 19:50719352-50719374 CAGCTGCGGGGCCGGGGCCGCGG - Intronic
1168029124 19:53665725-53665747 GTGCAGTGGCTCAGAGGCCGGGG - Intergenic
1168144908 19:54415515-54415537 GGGCAGCGGGGCGGACGCCGGGG - Exonic
925041334 2:733597-733619 GTGCAGAGGAGCTGAGGCTGCGG + Intergenic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
928518323 2:32064130-32064152 CGGCGCCGGGGCCGAGGCCGAGG - Exonic
929107233 2:38377115-38377137 GGCCAGCGAGGCAGAGGCCGCGG - Intronic
929701917 2:44169359-44169381 GTGCTGCCGAGCCGCGGCCGGGG + Intronic
929789674 2:45013688-45013710 GTGCGGCGCGGGCGACGCCGCGG - Intergenic
931065168 2:58578136-58578158 GTGCAAGGGGCCCGAGGCAGAGG + Intergenic
931762513 2:65430972-65430994 GTGCGACGGGGGCGGGGCCGCGG - Intronic
932314070 2:70768060-70768082 GTGCAGCGGCTCCGCGGCGGCGG + Exonic
932722348 2:74147435-74147457 CTGCAGCGGGGCCGGGGCCTTGG - Intronic
933908014 2:86914161-86914183 GTCCGGCCAGGCCGAGGCCGAGG - Intronic
934128179 2:88919793-88919815 GGGCAGAGGGGCAGAGGCAGAGG - Intergenic
937123031 2:119453730-119453752 GTGCAGCGGGGAGGAGGAAGTGG + Intronic
937202781 2:120216201-120216223 GTGGAGCAGGGCCGAGACTGGGG - Intergenic
937208668 2:120253135-120253157 GCGGAGCGGGGCCGCTGCCGGGG - Intronic
937951071 2:127388174-127388196 CGGGGGCGGGGCCGAGGCCGGGG - Intronic
938727383 2:134120470-134120492 CTGCAGAGCGGCCGGGGCCGGGG - Intronic
939629706 2:144517004-144517026 GGGCAGCGGGGCTGGGGGCGCGG + Intronic
940640777 2:156342446-156342468 TGGCCGCGGGGCCGAGTCCGCGG - Intergenic
940971970 2:159904793-159904815 GGGCGGCGGGGGCGGGGCCGGGG - Intergenic
942044855 2:172094533-172094555 GTGCAGCCGGGCCGGGCCCCGGG + Intergenic
943578018 2:189653568-189653590 GGGCAGCGGGGCAGAGGCGCTGG - Intergenic
944615208 2:201452145-201452167 GCTCAGCGGGGCCCGGGCCGCGG + Intronic
945028325 2:205640565-205640587 CTGCAGCGGGGCTGAGACAGAGG - Intergenic
945947104 2:216004988-216005010 GTGCAGAGGCGCTGAGGCAGGGG + Intronic
946306529 2:218859755-218859777 GGGGAGCGGGGCCGAGGCGGGGG - Intergenic
947731259 2:232432897-232432919 CTGCAGCGGGACAGAGGCAGAGG + Intergenic
948382937 2:237563738-237563760 GTGCAGTGGAGCCGAGGAGGCGG - Intergenic
948401949 2:237691577-237691599 GTGCAGCGGTGCTGGGGCCTAGG + Intronic
948479114 2:238239486-238239508 GTGCTGCGGGGCCGGGCGCGCGG - Exonic
948582381 2:238996934-238996956 GTGAAGGTGGGCCGAGGCGGGGG - Intergenic
948988713 2:241541253-241541275 GTGGGGCGGGGCCGCGGCGGGGG + Intergenic
948995554 2:241576464-241576486 GTGCTGCGGTGCCGTGGCCAAGG + Intergenic
1171464643 20:25319069-25319091 CTGCTGCGGGGCCAGGGCCGAGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173576523 20:44115860-44115882 CTGCAGCGGGGCGGTGGCCGGGG + Exonic
1173972541 20:47163925-47163947 GTGCAGTGGGGCTGAGGACCGGG - Intronic
1175517252 20:59577472-59577494 GCGGAGCGGAGCCGGGGCCGCGG - Intergenic
1175731131 20:61354606-61354628 GTGCAGCGGGGCTGAGCCACAGG - Intronic
1175749214 20:61483675-61483697 GGGCAGCGGGGGCGGGGCGGGGG - Intronic
1175873764 20:62220112-62220134 GGTCCGCGGGGCCGGGGCCGGGG + Exonic
1175877793 20:62238643-62238665 GAGCTGCGGGGCCTGGGCCGCGG + Intronic
1175892171 20:62320769-62320791 GTGCAGACGGGCCCAGGCCATGG + Exonic
1176086002 20:63295842-63295864 TTACAGCGTGGCCGAGGCCCCGG - Intronic
1176118034 20:63441686-63441708 GTGCCCCGGGGCCCAGGCTGTGG - Intronic
1176147676 20:63572694-63572716 GGGCAGCGGGGCCCAGGGAGGGG - Intronic
1176283334 20:64327742-64327764 CGGCAGCGGGGCCGATGACGGGG + Intergenic
1176302499 21:5105230-5105252 ATGACACGGGGCCGAGGCCGTGG + Intergenic
1176376708 21:6090373-6090395 ATGGAGAGGGGCCGAGGCCGTGG + Intergenic
1176861164 21:14012286-14012308 GTGCTGTGGGGCAGGGGCCGGGG + Intergenic
1177014990 21:15775745-15775767 GTGCAGCGGGGGCGGGGGGGGGG - Intronic
1178457730 21:32771440-32771462 GGGCCTCGGGGCTGAGGCCGGGG - Exonic
1179746767 21:43447871-43447893 ATGGAGAGGGGCCGAGGCCGTGG - Intergenic
1179783924 21:43719256-43719278 GCGGCGCGGGGCCGAGGCGGGGG - Exonic
1179854528 21:44156693-44156715 ATGACACGGGGCCGAGGCCGTGG - Intergenic
1179875801 21:44266802-44266824 GTCCAGCTGGGCCCAGGCCAAGG - Intergenic
1179890606 21:44333407-44333429 GTGCAGCAGGACCTGGGCCGAGG + Intronic
1180581877 22:16845790-16845812 GGGCAGCAGGGCAGAGGCCAGGG + Intergenic
1180956963 22:19745543-19745565 GGGCAGCTGGGCTGACGCCGTGG + Intergenic
1181271025 22:21658441-21658463 GTGCAGCCAGGCCGAGGGCTAGG + Intronic
1181574866 22:23787288-23787310 CTCCCGCGGGGCCGAGCCCGGGG - Intronic
1181967978 22:26669820-26669842 GTGCAGGGAGGCGGAGGCCCTGG + Intergenic
1183366164 22:37408184-37408206 GTGCAGCCGGGCCCAGGACTGGG - Intronic
1183432413 22:37773748-37773770 GTGCGGCAGGGCTGAGGCCTGGG - Intronic
1183650842 22:39152492-39152514 GAGCTGCGGGGCCGCGGCTGCGG + Exonic
1183655273 22:39180778-39180800 GTGGAGCGAGGCCAAGGCCAAGG + Intergenic
1183942102 22:41301795-41301817 GCCCCGCGGGGCAGAGGCCGGGG + Intronic
1184697382 22:46147635-46147657 GTCCACCGGGGCAGGGGCCGTGG - Intergenic
1184697947 22:46150352-46150374 GTGTCCCGGGGCCGAGGCCCGGG + Intergenic
1185226348 22:49655793-49655815 GTGCAGCAGAGCCAAGGACGGGG + Intronic
1185278756 22:49961043-49961065 GGCCGGCGGGGCCGGGGCCGGGG + Intronic
949559429 3:5188112-5188134 GTGCTGGGCGGCCGGGGCCGCGG + Exonic
952430577 3:33219125-33219147 GTACAGCGGGGCGGAGGGCGAGG + Exonic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
954146832 3:48638723-48638745 CTGCAGGGGGACCCAGGCCGTGG + Intronic
954277965 3:49554680-49554702 CTGCGCCGGGGCCGGGGCCGGGG - Exonic
954367633 3:50154924-50154946 GTGGAGCGGGGGCGGGGCGGTGG + Intergenic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955916333 3:63912142-63912164 GGGCAGCCGGGCCGGGCCCGGGG + Intronic
956652948 3:71521918-71521940 GTGCATTGGAGCCAAGGCCGAGG - Intronic
956691119 3:71878368-71878390 GTGCTGCGGTGCTGATGCCGAGG + Intergenic
960864285 3:122184284-122184306 GAGCTCCGGGGCCGGGGCCGGGG + Intronic
961401065 3:126643249-126643271 GTACAGCAGGGCAGAGGCAGAGG + Intronic
961446407 3:126983564-126983586 GTGCGGCGGGGCTGGGACCGCGG + Intergenic
961625055 3:128255843-128255865 GGGGAGCGGGGCCGGGGCTGGGG + Intronic
961754842 3:129121645-129121667 GTGGGGCGGGGCCGAGGCCGAGG - Exonic
962770863 3:138609047-138609069 GCGCAGCAGGGCCGAGAGCGTGG - Intronic
964477404 3:157109527-157109549 GTGCAGGGGGGCCTAGACAGAGG - Intergenic
964851921 3:161104802-161104824 TTGCAGCGGTGCCGAGGAAGAGG - Exonic
965074905 3:163963885-163963907 GGGCAGCGGGGCCCTGGCCCTGG - Intergenic
968500303 4:946859-946881 GTGCACAGGCGCCGAGACCGAGG + Intronic
968500317 4:946919-946941 GTGCACAGGCGCCGAGACCGAGG + Intronic
968500331 4:946980-947002 GTGCACAGGCGCCGAGACCGAGG + Intronic
968500346 4:947041-947063 GTGCACGGGCGCCGAGACCGAGG + Intronic
968500362 4:947106-947128 GTGCACGGGCGCCGAGACCGGGG + Intronic
968573471 4:1354317-1354339 GTCCAGCGGAGGAGAGGCCGGGG + Intronic
968647375 4:1747505-1747527 GTGCAGGGGGTCCGGGGCTGCGG - Intergenic
968730240 4:2266020-2266042 GTGCAGGGGAGCCAAGGCCTCGG - Intergenic
968764893 4:2463033-2463055 AGGCAGGGGGGCCGGGGCCGAGG - Intronic
969378980 4:6782416-6782438 GTGCAGCTTGGCCGGGGCGGCGG - Intronic
970188077 4:13484002-13484024 GGGCGGCGGGGAGGAGGCCGGGG + Intronic
970194637 4:13542442-13542464 GTGCAGCGGGGCCGGCGGCGGGG - Exonic
975793886 4:77984826-77984848 GGGCAGAGGGGCAGAGGCAGAGG + Intergenic
976629373 4:87220699-87220721 GAGCCGCGGGGGCGAGGCCGTGG - Intronic
977064977 4:92303907-92303929 GAGCAGCGGGGCCGGGCCAGAGG - Intronic
978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG + Intronic
979349264 4:119627300-119627322 GGGCGGCGGCGCGGAGGCCGGGG - Intronic
982108435 4:152031489-152031511 GTGCAAAGGGGCTGAGGCTGGGG + Intergenic
984638986 4:182143224-182143246 GTGATGCGGGGCGGAGGCCTAGG + Intergenic
985941834 5:3142463-3142485 GTTCTGCGGGGCCGGGGCCCTGG + Intergenic
986330494 5:6713585-6713607 GGGCGGCGGGGCCGAGGGGGCGG - Intergenic
986737787 5:10681011-10681033 GTGCAGCAGAGCCGGGGCCATGG + Exonic
986748016 5:10761081-10761103 CTTCCGCGGGGCCGAGGCGGCGG + Exonic
988781859 5:34529591-34529613 GTGGAGTGGGGCCGTGGCCTGGG - Intergenic
989178886 5:38556726-38556748 TTGGGGCGGGGCCGGGGCCGGGG - Intronic
990410357 5:55535089-55535111 GTGCAGCAGGGGCGGGGCCAGGG + Intergenic
990910213 5:60844436-60844458 GCGCGGCGGAGGCGAGGCCGGGG - Intergenic
991371568 5:65925587-65925609 GGGCAGCGGGCCGGGGGCCGGGG - Intergenic
998130686 5:139649770-139649792 GTGCAGCGTGGCAGGCGCCGGGG - Intronic
999375066 5:151081008-151081030 GGGCACCCGGGCCGAGGACGAGG + Intronic
1000918460 5:167110096-167110118 GTGCAGGGGTGGGGAGGCCGAGG + Intergenic
1001407007 5:171483612-171483634 GTGGGCCGGGGCTGAGGCCGAGG - Intergenic
1001641270 5:173245836-173245858 GGGCGGCGGGGCCCAAGCCGAGG - Intergenic
1002166603 5:177351554-177351576 GTGTAGTGGGGCCAGGGCCGGGG + Exonic
1002277666 5:178114128-178114150 GGGCCGGGGGGCGGAGGCCGAGG - Intronic
1002296125 5:178232339-178232361 CTCCAGCGGGGCCGGGGCAGCGG + Intronic
1002730173 5:181327786-181327808 CTGCTGTGAGGCCGAGGCCGAGG - Intergenic
1003049426 6:2766084-2766106 GCGCAGCTGGGACGAGGCGGAGG + Exonic
1004660763 6:17707007-17707029 GTGCCGCGCGGCCGAGAGCGTGG - Intergenic
1004767650 6:18748598-18748620 GGGCAGAGGGGCCGTGGCCCTGG + Intergenic
1006152507 6:31996943-31996965 GTGCAGCAGGGCGTAGGCTGTGG - Exonic
1006158813 6:32029680-32029702 GTGCAGCAGGGCGTAGGCTGTGG - Exonic
1007126925 6:39433269-39433291 GTGCACTGGGGCCTGGGCCGTGG + Intronic
1007224731 6:40304967-40304989 GTGGAGTGGGGCAGAGGCTGTGG + Intergenic
1013612926 6:111811984-111812006 GTGCAGAGGGTCCTAGGACGTGG - Intronic
1014272541 6:119349855-119349877 GTCCCGCGGGGGCGGGGCCGAGG + Intergenic
1015150786 6:130034735-130034757 GTCCAGCCTGGCCGAGGCCCAGG - Intronic
1015812270 6:137172641-137172663 GCGGAGTGGGGCCGAGGTCGGGG - Intronic
1017073734 6:150599844-150599866 GAGCAGTGGGGCCGAGCCCGAGG + Exonic
1017194451 6:151684805-151684827 GTGCTGGGGGGCCAAGGCTGCGG + Intronic
1019024249 6:168943864-168943886 GTGCAGCAGGACCCAGGCCTGGG - Intergenic
1019331701 7:463602-463624 CCGCAGTGGGGCCGGGGCCGCGG - Intergenic
1019536163 7:1530912-1530934 GGGCAGCGGGGCCCGGGCCGCGG + Intronic
1019927976 7:4205879-4205901 GTTCTGCGGGGCCATGGCCGGGG - Exonic
1020139982 7:5606764-5606786 GTGCAGTGGGAGGGAGGCCGTGG + Intergenic
1020238597 7:6374896-6374918 GTGTCGCGGGGCGGGGGCCGCGG + Intronic
1022923420 7:35037699-35037721 GGGCGGCGGGGGCGGGGCCGCGG - Intronic
1023287033 7:38631153-38631175 GCGGAGCGGGGCCGGGGCCAGGG - Intronic
1024112445 7:46161106-46161128 GTGCTGCGAAGCCGAGGCCCTGG + Intergenic
1024630088 7:51239725-51239747 GTGGAGCTGGGCAGAGGCTGTGG - Intronic
1026471160 7:70694762-70694784 ATCCAGCGCGGCCGAGGCCCCGG - Intronic
1029363933 7:100105514-100105536 GTGCAGTGGGACCGAGGCTCAGG + Exonic
1029487528 7:100852661-100852683 ATGGGGCGGGGCCGAGGACGGGG + Intronic
1029926974 7:104328650-104328672 GTGCTGCTGGGCTGAGGCGGAGG + Exonic
1031317272 7:120273371-120273393 GCGCGGTGGGGCCGGGGCCGGGG - Intergenic
1031629907 7:124033213-124033235 GCGCAGCGGGGCCACGGCGGGGG - Intergenic
1033253223 7:139777885-139777907 GGGCGGAGCGGCCGAGGCCGAGG + Intronic
1034483609 7:151341980-151342002 GTGGAGCTGGGCCGGGGCCGGGG + Intronic
1034487084 7:151372781-151372803 GTGCAGCGGGGCTGGAGCTGGGG + Intronic
1035357070 7:158282495-158282517 GAGCAGCGGGGTCGAGGCTGCGG + Intronic
1036397009 8:8378193-8378215 GTGCAGGGGCGCTGGGGCCGGGG + Intronic
1036585837 8:10122495-10122517 GTACAGTGGGGCTGAGGCAGTGG + Intronic
1037803834 8:22048937-22048959 CTCCCGCGGGGCCGAGCCCGCGG - Intergenic
1038176433 8:25185051-25185073 GCGCAGCCGGGCCGAGCCCCCGG - Intronic
1039903156 8:41767274-41767296 GGGGATCGGGGCCGGGGCCGGGG - Intronic
1040471347 8:47738000-47738022 GGGCCGCGGGGCCGAGCCAGGGG - Exonic
1041045068 8:53880716-53880738 GAGCAGTGGGGCTGCGGCCGGGG + Intronic
1041284945 8:56251034-56251056 ATGCAGGGGGGCAGATGCCGGGG - Intergenic
1044873879 8:96645434-96645456 GGGCGGCTGGGCCGAGGCCTTGG + Intronic
1047081956 8:121472265-121472287 GCGCAGCCAGGCAGAGGCCGAGG + Intergenic
1047259218 8:123241143-123241165 GGACGGAGGGGCCGAGGCCGGGG + Intronic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1048009206 8:130443158-130443180 CTGCAGTGGGGCCGGGGACGGGG - Intronic
1049194686 8:141308617-141308639 GTGCGGAGGGGCCGGGGCCGGGG - Intergenic
1049427027 8:142542280-142542302 CCGCAGCGTGGCCGTGGCCGTGG - Exonic
1049531939 8:143159412-143159434 GGGCAGAGGGGCCGAGGGCCGGG + Intronic
1049620924 8:143597981-143598003 GTGCAGCGGGGACGGGGGCTGGG - Exonic
1050387864 9:5110185-5110207 GTGGAGCAGGGCTGAGGCTGGGG - Intronic
1051170626 9:14315504-14315526 GTGCAGGCGGGGCGGGGCCGCGG + Intronic
1056902558 9:90613410-90613432 GAGCAGCGAGGCGGAGGCCTTGG - Exonic
1056960689 9:91119850-91119872 ATGCAGCGGGGCAGGGGCCTGGG + Intergenic
1057245531 9:93451678-93451700 CCGCTGCGAGGCCGAGGCCGAGG - Intronic
1058421060 9:104833882-104833904 ATCCAGAGGGGCCGAGGCAGAGG + Intronic
1058923446 9:109640052-109640074 TTACCGCGGGGCCGGGGCCGTGG + Intergenic
1058951791 9:109910805-109910827 GTGCAGAGGGACTGAGGCTGAGG + Intronic
1061293705 9:129666151-129666173 GGGTGGCGGGGCCGGGGCCGGGG + Intronic
1061349629 9:130054092-130054114 GGGCCGGGGGGCGGAGGCCGAGG + Intronic
1061384741 9:130282588-130282610 GAGCAGAGGGGCCGGGGCCACGG + Intergenic
1061559646 9:131394264-131394286 GTGGGTCGGGGCCGGGGCCGGGG + Intronic
1061898087 9:133658838-133658860 GAGCAGCGGGGCGGGGGCGGGGG - Exonic
1062361972 9:136192707-136192729 TTGCAGCGGGGGCGGGGCTGGGG - Intergenic
1062461877 9:136665718-136665740 GTGGGGCGGGGCCGGGGGCGGGG + Intronic
1062556222 9:137114434-137114456 GGGCGGCCGGGCCGGGGCCGGGG + Intronic
1062592656 9:137281119-137281141 CTGCAGCGGGGCCGGCGGCGGGG - Exonic
1185460376 X:330592-330614 GTGCCTGGGGGCCGAGGCCCTGG + Intergenic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1189445480 X:41076852-41076874 GTGCTGAGGGGCCGAGGCCGCGG + Intergenic
1195637192 X:107131623-107131645 GCGCCGCGGGACCAAGGCCGCGG + Intronic
1197774551 X:130110772-130110794 GGGGAGCGGGGCGGACGCCGGGG + Intergenic
1200093873 X:153648220-153648242 GCGCGGGGAGGCCGAGGCCGAGG + Exonic
1200173802 X:154097803-154097825 TCGCAGCGGCGCCGAGGGCGGGG - Intergenic