ID: 978889122

View in Genome Browser
Species Human (GRCh38)
Location 4:113801264-113801286
Sequence TTGCATGTCTTTCCTAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978889122_978889126 26 Left 978889122 4:113801264-113801286 CCTGTTCTAGGAAAGACATGCAA No data
Right 978889126 4:113801313-113801335 AGAAAAATGTTGTTGATGACTGG No data
978889122_978889123 1 Left 978889122 4:113801264-113801286 CCTGTTCTAGGAAAGACATGCAA No data
Right 978889123 4:113801288-113801310 ATCCAGACCTCTTATGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978889122 Original CRISPR TTGCATGTCTTTCCTAGAAC AGG (reversed) Intergenic
No off target data available for this crispr