ID: 978889265

View in Genome Browser
Species Human (GRCh38)
Location 4:113803307-113803329
Sequence ACAAAGTCATGAATAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978889262_978889265 6 Left 978889262 4:113803278-113803300 CCAGCCTGCACTCAAGAGAAGGG No data
Right 978889265 4:113803307-113803329 ACAAAGTCATGAATAGCAGAAGG No data
978889264_978889265 2 Left 978889264 4:113803282-113803304 CCTGCACTCAAGAGAAGGGTATT No data
Right 978889265 4:113803307-113803329 ACAAAGTCATGAATAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978889265 Original CRISPR ACAAAGTCATGAATAGCAGA AGG Intergenic
No off target data available for this crispr