ID: 978889587

View in Genome Browser
Species Human (GRCh38)
Location 4:113807897-113807919
Sequence AGGAGTATATTCTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978889577_978889587 25 Left 978889577 4:113807849-113807871 CCCAGGAATAGTTGGATGGGACG No data
Right 978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG No data
978889583_978889587 -1 Left 978889583 4:113807875-113807897 CCTAGAAAAAGGGGCCATGAATA No data
Right 978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG No data
978889578_978889587 24 Left 978889578 4:113807850-113807872 CCAGGAATAGTTGGATGGGACGG No data
Right 978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978889587 Original CRISPR AGGAGTATATTCTCTGAGGA AGG Intergenic
No off target data available for this crispr