ID: 978892636

View in Genome Browser
Species Human (GRCh38)
Location 4:113848316-113848338
Sequence CATGTGTTGCAGAAGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978892636_978892642 14 Left 978892636 4:113848316-113848338 CCAGGTTCCTTCTGCAACACATG No data
Right 978892642 4:113848353-113848375 TACAATTCAAGATGAGATTCGGG 0: 101
1: 7047
2: 10531
3: 9482
4: 7870
978892636_978892641 13 Left 978892636 4:113848316-113848338 CCAGGTTCCTTCTGCAACACATG No data
Right 978892641 4:113848352-113848374 CTACAATTCAAGATGAGATTCGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
978892636_978892643 19 Left 978892636 4:113848316-113848338 CCAGGTTCCTTCTGCAACACATG No data
Right 978892643 4:113848358-113848380 TTCAAGATGAGATTCGGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978892636 Original CRISPR CATGTGTTGCAGAAGGAACC TGG (reversed) Intergenic
No off target data available for this crispr