ID: 978893923

View in Genome Browser
Species Human (GRCh38)
Location 4:113862761-113862783
Sequence GCTGCTAGTGAATATAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978893922_978893923 5 Left 978893922 4:113862733-113862755 CCTTAATCTGGCGGACACAATCT No data
Right 978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG No data
978893921_978893923 6 Left 978893921 4:113862732-113862754 CCCTTAATCTGGCGGACACAATC No data
Right 978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG No data
978893920_978893923 9 Left 978893920 4:113862729-113862751 CCACCCTTAATCTGGCGGACACA No data
Right 978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG No data
978893919_978893923 10 Left 978893919 4:113862728-113862750 CCCACCCTTAATCTGGCGGACAC No data
Right 978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978893923 Original CRISPR GCTGCTAGTGAATATAAAGC AGG Intergenic
No off target data available for this crispr