ID: 978904832

View in Genome Browser
Species Human (GRCh38)
Location 4:113993712-113993734
Sequence TAGCTGTGTGGTCCCTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978904820_978904832 29 Left 978904820 4:113993660-113993682 CCTGCCCCAGACAGTCCCCTCTT No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904826_978904832 12 Left 978904826 4:113993677-113993699 CCTCTTGTTCTCTTCTTGATCCA No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904829_978904832 -8 Left 978904829 4:113993697-113993719 CCAGGGAGCAGACAATAGCTGTG No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904824_978904832 14 Left 978904824 4:113993675-113993697 CCCCTCTTGTTCTCTTCTTGATC No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904823_978904832 23 Left 978904823 4:113993666-113993688 CCAGACAGTCCCCTCTTGTTCTC No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904825_978904832 13 Left 978904825 4:113993676-113993698 CCCTCTTGTTCTCTTCTTGATCC No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904819_978904832 30 Left 978904819 4:113993659-113993681 CCCTGCCCCAGACAGTCCCCTCT No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904822_978904832 24 Left 978904822 4:113993665-113993687 CCCAGACAGTCCCCTCTTGTTCT No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data
978904821_978904832 25 Left 978904821 4:113993664-113993686 CCCCAGACAGTCCCCTCTTGTTC No data
Right 978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978904832 Original CRISPR TAGCTGTGTGGTCCCTCTCA GGG Intergenic
No off target data available for this crispr