ID: 978905901

View in Genome Browser
Species Human (GRCh38)
Location 4:114005108-114005130
Sequence CAGAGATATAAGATATAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978905901_978905904 -1 Left 978905901 4:114005108-114005130 CCACCTTATATCTTATATCTCTG No data
Right 978905904 4:114005130-114005152 GGTTAGATATCACTTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978905901 Original CRISPR CAGAGATATAAGATATAAGG TGG (reversed) Intergenic
No off target data available for this crispr