ID: 978909017

View in Genome Browser
Species Human (GRCh38)
Location 4:114044497-114044519
Sequence TAGCCAGCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978909017_978909023 13 Left 978909017 4:114044497-114044519 CCGTCCACCACTGCTGCTGGCTA No data
Right 978909023 4:114044533-114044555 ACCGCTGACTTCCATCCCTCCGG 0: 10
1: 44
2: 108
3: 118
4: 166
978909017_978909025 23 Left 978909017 4:114044497-114044519 CCGTCCACCACTGCTGCTGGCTA No data
Right 978909025 4:114044543-114044565 TCCATCCCTCCGGATCCAGCAGG 0: 12
1: 72
2: 118
3: 157
4: 197
978909017_978909027 24 Left 978909017 4:114044497-114044519 CCGTCCACCACTGCTGCTGGCTA No data
Right 978909027 4:114044544-114044566 CCATCCCTCCGGATCCAGCAGGG 0: 20
1: 71
2: 130
3: 138
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978909017 Original CRISPR TAGCCAGCAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr