ID: 978911925 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:114074011-114074033 |
| Sequence | CTGGTTTCACAGAATGAGGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 978911925_978911928 | 1 | Left | 978911925 | 4:114074011-114074033 | CCAACCTCATTCTGTGAAACCAG | No data | ||
| Right | 978911928 | 4:114074035-114074057 | ATCATCCTGATACCAAAATATGG | 0: 10 1: 249 2: 2577 3: 8650 4: 6531 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 978911925 | Original CRISPR | CTGGTTTCACAGAATGAGGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||