ID: 978911925

View in Genome Browser
Species Human (GRCh38)
Location 4:114074011-114074033
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978911925_978911928 1 Left 978911925 4:114074011-114074033 CCAACCTCATTCTGTGAAACCAG No data
Right 978911928 4:114074035-114074057 ATCATCCTGATACCAAAATATGG 0: 10
1: 249
2: 2577
3: 8650
4: 6531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978911925 Original CRISPR CTGGTTTCACAGAATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr