ID: 978917112 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:114140681-114140703 |
Sequence | ACTGATATCCAGAATGTACA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 9601 | |||
Summary | {0: 3, 1: 43, 2: 989, 3: 3864, 4: 4702} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
978917112_978917116 | 23 | Left | 978917112 | 4:114140681-114140703 | CCTTGTACATTCTGGATATCAGT | 0: 3 1: 43 2: 989 3: 3864 4: 4702 |
||
Right | 978917116 | 4:114140727-114140749 | GAAGATATTCTCCCACTCTGTGG | No data | ||||
978917112_978917117 | 24 | Left | 978917112 | 4:114140681-114140703 | CCTTGTACATTCTGGATATCAGT | 0: 3 1: 43 2: 989 3: 3864 4: 4702 |
||
Right | 978917117 | 4:114140728-114140750 | AAGATATTCTCCCACTCTGTGGG | 0: 8 1: 751 2: 1526 3: 13936 4: 17182 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
978917112 | Original CRISPR | ACTGATATCCAGAATGTACA AGG (reversed) | Intergenic | ||
Too many off-targets to display for this crispr |