ID: 978917112

View in Genome Browser
Species Human (GRCh38)
Location 4:114140681-114140703
Sequence ACTGATATCCAGAATGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9601
Summary {0: 3, 1: 43, 2: 989, 3: 3864, 4: 4702}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978917112_978917116 23 Left 978917112 4:114140681-114140703 CCTTGTACATTCTGGATATCAGT 0: 3
1: 43
2: 989
3: 3864
4: 4702
Right 978917116 4:114140727-114140749 GAAGATATTCTCCCACTCTGTGG No data
978917112_978917117 24 Left 978917112 4:114140681-114140703 CCTTGTACATTCTGGATATCAGT 0: 3
1: 43
2: 989
3: 3864
4: 4702
Right 978917117 4:114140728-114140750 AAGATATTCTCCCACTCTGTGGG 0: 8
1: 751
2: 1526
3: 13936
4: 17182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978917112 Original CRISPR ACTGATATCCAGAATGTACA AGG (reversed) Intergenic
Too many off-targets to display for this crispr