ID: 978921447

View in Genome Browser
Species Human (GRCh38)
Location 4:114188015-114188037
Sequence GGCCTTTGCAGAATTAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978921447_978921454 24 Left 978921447 4:114188015-114188037 CCATGCCTAATTCTGCAAAGGCC No data
Right 978921454 4:114188062-114188084 CTCATGAACAGATGAGGAAATGG No data
978921447_978921453 18 Left 978921447 4:114188015-114188037 CCATGCCTAATTCTGCAAAGGCC No data
Right 978921453 4:114188056-114188078 ATATCACTCATGAACAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978921447 Original CRISPR GGCCTTTGCAGAATTAGGCA TGG (reversed) Intergenic
No off target data available for this crispr